This work is supported by the Topsector Life Sciences &#38; Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children&#39;s Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial technical support to set up monolayers on membrane inserts.

<ol>
	<li>Haegebarth, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signaling,+lgr5,+and+stem+cells+in+the+intestine+and+skin.">Wnt signaling, lgr5, and stem cells in the intestine and skin.</a> The American Journal of Pathology. 174 (3), 715-721 (2009).</li><li>Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+intestinal+barrier+and+current+techniques+for+the+assessment+of+gut+permeability.">The intestinal barrier and current techniques for the assessment of gut permeability.</a> Cells. 9 (8), 1909 (2020).</li><li>Mart&#237;nez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HT29+Cell+Line.">HT29 Cell Line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+single+Lgr5(+)+liver+stem+cells+induced+by+Wnt-driven+regeneration.">In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration.</a> Nature. 11 (2), 179-194 (2013).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expanding+human+airway+organoids+for+disease+modeling.">Long-term expanding human airway organoids for disease modeling.</a> The EMBO Journal. 38 (4), 1-20 (2019).</li><li>Karthaus, W. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+multipotent+luminal+progenitor+cells+in+human+prostate+organoid+cultures.">Identification of multipotent luminal progenitor cells in human prostate organoid cultures.</a> Cell. 159 (1), 163-175 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1-2), 324-338 (2015).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+living+biobank+of+breast+cancer+organoids+captures+disease+heterogeneity.">A living biobank of breast cancer organoids captures disease heterogeneity.</a> Cell. 172 (1-2), 373-386 (2018).</li><li>Vlachogiannis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+model+treatment+response+of+metastatic+gastrointestinal+cancers.">Patient-derived organoids model treatment response of metastatic gastrointestinal cancers.</a> Science. 359 (6378), 920-926 (2018).</li><li>Van De Wetering, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+derivation+of+a+living+organoid+biobank+of+colorectal+cancer+patients.">Prospective derivation of a living organoid biobank of colorectal cancer patients.</a> Cell. 161 (4), 933-945 (2015).</li><li>Driehuis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreatic+cancer+organoids+recapitulate+disease+and+allow+personalized+drug+screening.">Pancreatic cancer organoids recapitulate disease and allow personalized drug screening.</a> Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).</li><li>Tiriac, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+profiling+identifies+common+responders+to+chemotherapy+in+pancreatic+cancer.">Organoid profiling identifies common responders to chemotherapy in pancreatic cancer.</a> Cancer Discovery. 8 (9), 1112-1129 (2018).</li><li>d'Aldebert, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+colon+organoids+from+inflammatory+bowel+disease+patients.">Characterization of human colon organoids from inflammatory bowel disease patients.</a> Frontiers in Cell and Developmental Biology. 8, 363 (2020).</li><li>Dotti, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alterations+in+the+epithelial+stem+cell+compartment+could+contribute+to+permanent+changes+in+the+mucosa+of+patients+with+ulcerative+colitis.">Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis.</a> Gut. 66 (12), 2069-2079 (2017).</li><li>VanDussen, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+enhanced+human+gastrointestinal+epithelial+culture+system+to+facilitate+patient-based+assays.">Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays.</a> Gut. 64 (6), 911-920 (2015).</li><li>Noel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+primary+human+macrophage-enteroid+co-culture+model+to+investigate+mucosal+gut+physiology+and+host-pathogen+interactions.">A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions.</a> Scientific Reports. 7, 45270 (2017).</li><li>Bartfeld, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+human+gastric+epithelial+stem+cells+and+their+responses+to+bacterial+infection.">In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection.</a> Gastroenterology. 148 (1), 126-136 (2015).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signalling+induces+maturation+of+Paneth+cells+in+intestinal+crypts.">Wnt signalling induces maturation of Paneth cells in intestinal crypts.</a> Nature Cell Biology. 7 (4), 381-386 (2005).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dll1+marks+early+secretory+progenitors+in+gut+crypts+that+can+revert+to+stem+cells+upon+tissue+damage.">Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage.</a> Nature Cell Biology. 14 (10), 1099-1104 (2012).</li><li>de Lau, W. B. M., Snel, B., Clevers, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+R-spondin+protein+family.">The R-spondin protein family.</a> Genome Biology. 13 (3), 1-10 (2012).</li><li>Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+quiescence+of+Lgr5++stem+cells+in+intestinal+organoids+enables+differentiation+of+hormone-producing+enteroendocrine+cells.">Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells.</a> Cell Stem Cell. 20 (2), 177-190 (2017).</li><li>Beumer, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteroendocrine+cells+switch+hormone+expression+along+the+crypt-to-villus+BMP+signalling+gradient.">Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient.</a> Nature Cell Biology. 20 (8), 909-916 (2018).</li><li>Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Niche-independent+high-purity+cultures+of+Lgr5++intestinal+stem+cells+and+their+progeny.">Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny.</a> Nature Methods. 11 (1), 106-112 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forskolin-induced+swelling+in+intestinal+organoids:+An+in+vitro+assay+for+assessing+drug+response+in+cystic+fibrosis+patients.">Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients.</a> Journal of Visualized Experiments. (120), (2017).</li><li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+surrogate+Wnts+support+organoid+growth+and+deconvolute+Frizzled+pleiotropy+in+vivo.">Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo.</a> Cell Stem Cell. 27 (5), 840-851 (2020).</li><li>Srinivasan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TEER+measurement+techniques+for+in+vitro+barrier+model+systems.">TEER measurement techniques for in vitro barrier model systems.</a> Journal of Laboratory Automation. 20 (2), 107-126 (2015).</li><li>Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+corrected+transepithelial+electrical+resistance+(TEER)+measurement+to+quantify+rapid+changes+in+paracellular+permeability.">Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability.</a> Die Pharmazie. 65 (1), 19-24 (2010).</li><li>Lea, T., Verhoeckx, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caco-2+cell+line.">Caco-2 cell line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).</li><li>Heo, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+Cryptosporidium+infection+in+human+small+intestinal+and+lung+organoids.">Modelling Cryptosporidium infection in human small intestinal and lung organoids.</a> Nature Microbiology. 3 (7), 814-823 (2018).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nature Biotechnology. 25 (6), 681-686 (2007).</li></ol>

The authors declare no conflict of interest.

This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a disease- and patient-specific manner as well as the study of patient-specific responses to a variety of drug treatments. Although cell lines can form differentiated and polarized monolayers containing intestinal enterocytes and goblet-like cells, many different enzymes and transporters are aberrantly expressed in these cell lines, resulting in reduced complexity and physiological relevance3,30. Organoid culture is technically more demanding and laborious than cell culture; however, organoids are more representative of the in vivo&#160;situation, whereas cell lines have repeatedly failed to represent tissue responses in complex setups.
Although primary tissue-based models can be representative of the in vivo&#160;situation, they require the use of test animals or access to human material, which is associated with limited availability and ethical constraints. Additionally, primary tissue has no or limited expandability and is not stable in extended experimental timeframes. Organoid technology requires limited amount of primary tissue to establish genetically and physiologically stable long-term expanding cultures while still representing epithelial tissue complexity and patient heterogeneity. Different cell lines, such as Caco-2, are often used to prepare epithelial monolayers. Caco-2 cells take 21 days to establish a polarized epithelial monolayer that can be used for any experiment30. Organoid-derived epithelial monolayers are prepared from organoid single cells as described in the current protocol, and after 3-6 days, form a polarized epithelium that can be further differentiated to enrich them with enterocytes or goblet cells.
Monolayers are a static model lacking a microfluidic flow or mechanic stretch as is seen in organs-on-a-chip. They do, however, offer the opportunity for co-culturing with (autologous) immune cells, as well as bacteria or parasites17,18,19, 31. Organoids are suitable for monolayer preparation when they are in their expansion phase; for intestinal organoids, this is usually 3 days after passaging. Dissociation of organoids to single cells should be performed quickly to avoid long-term exposure to digestive enzymes. To increase the survival of stem cells after the preparation of a single-cell suspension, the Rho-associated protein kinase inhibitor (ROCK inhibitor), Y27632, is added to the cells to prevent anoikis-induced cell death32. Furthermore, it is critical to culture the monolayers on a membrane precoated with ECM to ensure that they maintain their organoid characteristics and polarization. For functional screening assays that quantify GI tract epithelial cell responses to external stimuli, it is important that organoid cultures represent the required cellular complexity depending on the type of assay to be developed and eventual readouts.
Intestinal organoids represent different epithelial cell types present in vivo, such as stem, TA, enterocyte, Paneth, goblet, and enteroendocrine cells4,5, and are prepared and maintained using a defined organoid medium prepared as described in this protocol. Enterocyte differentiation can be promoted by culturing organoids for an additional four days using culture conditions that dually inhibit the Wnt pathway, by removal of Wnt molecules/activators, and the addition of the Porcupine inhibitor, IWP-2 (enterocyte colon differentiation medium, eDM). As mucus-producing goblet cells are essential for barrier function homeostasis as well, a second culture condition aims to produce a more heterogeneous cell population containing stem, enterocyte, and goblet cells, in which Notch and EGF pathways are inhibited while Wnt signaling is kept partially active by reducing Wnt3aCM to 10% (or 0.1 nM for NGS-Wnt) instead of 50% (0.5 nM NGS-Wnt) used in IEM. In contrast to eDM, which enriches for enterocyte differentiation, this second condition supports the presence of several cell types and is therefore called combination differentiation medium (cDM).
Applications of organoid-derived monolayers include the monitoring of epithelial barrier integrity as well as examining tight junction and transporter expression. Barrier integrity, permeability, and transport can be analyzed using the readouts introduced in this protocol. While TEER measures ionic conductance through tight junctions, the permeability assay measures water flow and thus paracellular permeability through the tight junctions28,29. Epithelial barrier integrity, permeability, and transport functionality of the monolayers can be evaluated by measuring the traffic of different fluorescent or radioactive substrates across apical and basolateral compartments of the membrane inserts. TEER measurements allow for the quantification of barrier integrity, showing an increase in values when differentiating towards polarized enterocytes and goblet cells, and a decrease after inducing injury to the monolayers.
The Lucifer Yellow permeability assay can be used for initial barrier integrity assessment as well as the confirmation of reduced integrity after inducing injury to the monolayers. This protocol introduces Lucifer Yellow permeability from the apical to basolateral compartment as an indication of monolayer integrity. Similarly, other fluorescently labeled reagents, such as 4 or 40 kDa dextran, can be employed to evaluate increased paracellular permeability as the result of barrier damage-inducing agents. Fluorescently labeled substrates, such as Rhodamine 123, can be used for measuring the activity of different transporters, such as P-glycoprotein-1. The fluorescence assay described in this protocol allows the measurement of the levels of proteins, such as lysozyme, that are secreted into the apical compartment. Responses to injury induction by pro-inflammatory cytokines can be measured with these readouts, as well as the potential effects of barrier-restoring compounds.

The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal homeostasis by producing mucus, antimicrobial peptides, and hormones, respectively. The intestinal epithelium is constantly replenished by dividing leucine-rich repeat-containing G-protein-coupled receptor 5-positive (LGR5+) stem cells in the bottom of intestinal crypts producing transit-amplifying (TA) cells that migrate upwards and differentiate into other cell types1. Disruption of intestinal epithelial homeostasis by genetic and environmental factors, such as exposure to food allergens, medicinal compounds, and microbial pathogens, leads to disruption of intestinal barrier function. These conditions cause several intestinal diseases including inflammatory bowel disease (IBD), celiac disease, and drug-induced GI toxicity2.
Studies on the intestinal epithelium are performed using several in vitro platform systems such as membrane inserts, organs-on-a-chip systems, Ussing chambers, and intestinal rings.These platforms are suitable for establishing polarized epithelial monolayers with access to both apical and basolateral sides of the membrane, using transformed cell lines or primary tissue as models. Although transformed cell lines, such as the colorectal (adeno)carcinoma cell lines Caco-2, T84, and HT-29, are able to differentiate into polarized intestinal enterocytes or mucus-producing cells to some extent, they are not representative of the in vivo&#160;epithelium as several cell types are missing, and various receptors and transporters are aberrantly expressed3. In addition, as cell lines are derived from a single donor, they do not represent interpatient heterogeneity and suffer from reduced complexity and physiological relevance. Although primary tissues used in Ussing chambers and as intestinal rings are more representative of the in vivo&#160;situation, their limited availability, short-term viability, and lack of expandability make them unsuitable as a medium for high-throughput (HT) studies.
Organoids are in vitro epithelial cultures established from different organs such as the intestine, kidney, liver, pancreas, and lung. They are proven to have long-term, stable expandability as well as genetic and phenotypic stability and therefore are representative biological miniatures of the epithelium of the original organ with faithful responses to external stimuli4,5,6,7,8,9. Organoids are efficiently established from either resected or biopsied normal, diseased, inflamed, or cancerous tissue, representing heterogeneous patient-specific responses10,11,12,13,14,15,16. This paper demonstrates how to establish intestinal epithelial monolayers derived from organoid cultures. Monolayers have been successfully established from small intestinal as well as colonic and rectal organoid cultures. This model creates an opportunity to study the transport and permeability of the epithelial cells to drugs as well as their toxicological effects on the epithelium. Moreover, the model allows co-culture with immune cells and bacteria to study their interactions with the intestinal epithelium17,18,19. Furthermore, this model can be used to study responses to therapies in a patient-specific manner and initiate screening efforts to look for the next wave of epithelial barrier-focused therapeutics. Such an approach could be extended to the clinic and pave the way toward personalized treatments.
Although the epithelial monolayers in this protocol are prepared from human normal intestinal organoids, the protocol can be applied and optimized for other organoid models. Epithelial organoid monolayers are cultured in intestinal organoid expansion medium containing Wnt to support stem cell proliferation and represent intestinal crypt cellular composition. Intestinal organoids can be enriched to have different intestinal epithelial fates, such as enterocytes, Paneth, goblet, and enteroendocrine cells, by modulating Wnt, Notch, and epidermal growth factor (EGF) pathways. Here, after the establishment of monolayers in expansion medium, they are driven toward more differentiated intestinal epithelial cells, as described previously20,21,22,23,24,25. For screening purposes, depending on the mode of action of the compound of interest, its target cells, and the experimental conditions, the monolayers can be driven toward the cellular composition of choice to measure the effects of the compound with relevant functional readouts.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100% ethanol</td>
			<td>Fisher Emergo</td>
			<td>10644795</td>
			<td></td>
		</tr>
		<tr>
			<td>1250, 300, and 20 &#181;L low-retention filter-tips</td>
			<td>Greiner bio-one</td>
			<td>732-1432 / 732-1434 / 732-2383</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well HTS Fluoroblok Transwell plate (light-tight)</td>
			<td>Corning</td>
			<td>351156</td>
			<td rowspan="2">Plates require REMS AutoSampler for TEER measurements</td>
		</tr>
		<tr>
			<td>24-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>3378</td>
		</tr>
		<tr>
			<td>24-well plate with Transwell inserts</td>
			<td>Corning</td>
			<td>3470</td>
			<td>membrane inserts</td>
		</tr>
		<tr>
			<td>40 &#181;m cell strainer</td>
			<td>PluriSelect</td>
			<td>43-50040-01</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>657160</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well black plate transparent bottom</td>
			<td>Greiner bio-one</td>
			<td>655090</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well fast thermal cycling plates</td>
			<td>Life Technologies Europe BV</td>
			<td>4346907</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Fluoroblok Transwell plate</td>
			<td>Corning</td>
			<td>351162</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>7369</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well transparent culture plate</td>
			<td>Greiner bio-one</td>
			<td>655180</td>
			<td></td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>Bio-Techne Ltd</td>
			<td>2939</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase Cell Dissociation Reagent</td>
			<td>Life Technologies Europe BV</td>
			<td>A11105-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Advanced DMEM/F-12</td>
			<td>Life Technologies Europe BV</td>
			<td>12634028</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 supplement</td>
			<td>Life Technologies Europe BV</td>
			<td>17504001</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture microscope (light / optical microscope)</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CellTiter-Glo</td>
			<td>Promega</td>
			<td>G9683</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 incubator</td>
			<td>PHCBI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma-Aldrich</td>
			<td>D5942</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC treated H2O</td>
			<td>Life Technologies Europe BV</td>
			<td>750024</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS) with Ca2+ and Mg2+</td>
			<td>Life Technologies Europe BV</td>
			<td>14040091</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, powder, no calcium, no magnesium</td>
			<td>Life Technologies Europe BV</td>
			<td>21600069</td>
			<td></td>
		</tr>
		<tr>
			<td>EnzChek Lysozyme Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>E22013</td>
			<td></td>
		</tr>
		<tr>
			<td>EVOM2 meter with STX electrode</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gastrin</td>
			<td>Bio-Techne Ltd</td>
			<td>3006</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass pipettes</td>
			<td>Volac</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMAX</td>
			<td>Life Technologies Europe BV</td>
			<td>35050038</td>
			<td></td>
		</tr>
		<tr>
			<td>hEGF</td>
			<td>Peprotech</td>
			<td>AF-100-15</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Life Technologies Europe BV</td>
			<td>15630056</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Noggin</td>
			<td>Peprotech</td>
			<td>120-10C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Rspo3</td>
			<td>Bio-Techne Ltd</td>
			<td>3500-RS/CF</td>
			<td></td>
		</tr>
		<tr>
			<td>IWP-2</td>
			<td>Miltenyi Biotec</td>
			<td>130-105-335</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 primary antibody</td>
			<td>Sanbio</td>
			<td>BSH-7302-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 secondary antibody</td>
			<td>Agilent</td>
			<td>K400111-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Kova International Glasstic Slide with Counting grids</td>
			<td>Fisher Emergo</td>
			<td>10298483</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow hood</td>
			<td>Thermo scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lucifer Yellow CH dilithium salt</td>
			<td>Sigma-Aldrich</td>
			<td>L0259</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel, Growth Factor Reduced (GFR)</td>
			<td>Corning</td>
			<td>356231</td>
			<td>extracellular matrix (ECM)</td>
		</tr>
		<tr>
			<td>MicroAmp Fast 8-Tube Strip, 0.1 mL</td>
			<td>Life Technologies Europe BV</td>
			<td>4358293</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 8-Cap Strips</td>
			<td>Life Technologies Europe BV</td>
			<td>4323032</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes</td>
			<td>Eppendorf</td>
			<td>0030 120 086</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettes (1000, 200, and 20 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microtome</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-15334</td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 secondary antibody</td>
			<td>VWR</td>
			<td>VWRKS/DPVR-HRP</td>
			<td></td>
		</tr>
		<tr>
			<td>Multichannel pipette (200 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>N-acetylcysteine</td>
			<td>Sigma-Aldrich</td>
			<td>A9165</td>
			<td></td>
		</tr>
		<tr>
			<td>NGS Wnt</td>
			<td>U-Protein Express</td>
			<td>N001-0.5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma-Aldrich</td>
			<td>N0636</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Forward</td>
			<td>Custom-made</td>
			<td>GGAGTTATCCTGCTCCCCAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Reverse</td>
			<td>Custom-made</td>
			<td>CTAGGAGGTGAAGGTCCAACG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Forward</td>
			<td>Custom-made</td>
			<td>ACACGTACCCACAGAAGCTC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Reverse</td>
			<td>Custom-made</td>
			<td>GGAATGCAGGCCACTGAAAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Forward</td>
			<td>Custom-made</td>
			<td>AGGATCTGAAGAAGTGTGTCACTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Reverse</td>
			<td>Custom-made</td>
			<td>TAATGGAACAGATGTTGAAGTGCT</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Forward</td>
			<td>Custom-made</td>
			<td>ACGCCGAATATAATCCCAAGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Reverse</td>
			<td>Custom-made</td>
			<td>AAATCAGTGCCGTGGTTCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Optical adhesive covers</td>
			<td>Life Technologies Europe BV</td>
			<td>4311971</td>
			<td></td>
		</tr>
		<tr>
			<td>PD0325901</td>
			<td>Stemcell Technologies</td>
			<td>72184</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/streptomycin</td>
			<td>Life Technologies Europe BV</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plate shaker</td>
			<td>Panasonic</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Fisher Emergo</td>
			<td>A25776</td>
			<td></td>
		</tr>
		<tr>
			<td>Primocin</td>
			<td>InvivoGen</td>
			<td>ANT-PM-2</td>
			<td>antimicrobial formulation for primary cells</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>Q32852</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent reservoir for multichannel pipet</td>
			<td>Sigma-Aldrich</td>
			<td>CLS4870</td>
			<td></td>
		</tr>
		<tr>
			<td>REMS AutoSampler with 24-probe or 96C-probe</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit</td>
			<td>Thermo scientific</td>
			<td>87023</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-Free DNase Set</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>SB202190</td>
			<td>Sigma-Aldrich</td>
			<td>S7076</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettes</td>
			<td>Greiner bio-one</td>
			<td>606180 / 607180 / 760180</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettor (Pipet-Aid)</td>
			<td>Drummond</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Single edge razor blade</td>
			<td>GEM Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Superscript 1st strand system for RT-PCR</td>
			<td>Life Technologies Europe BV</td>
			<td>11904018</td>
			<td></td>
		</tr>
		<tr>
			<td>Tecan Spark 10M plate reader</td>
			<td>Tecan</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>Life Technologies Europe BV</td>
			<td>15250-061</td>
			<td></td>
		</tr>
		<tr>
			<td>TrypLE Express Enzyme (1x)</td>
			<td>Life Technologies Europe BV</td>
			<td>12605-010</td>
			<td>Cell dissociation reagent</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Grant</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Y27632 (ROCK inhibitor)</td>
			<td>AbMole</td>
			<td>M1817</td>
			<td></td>
		</tr>
	</tbody>
</table>

organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport,&#160;antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 &#181;L (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7 days depending on the organoid culture (Figure 1C). After harvesting the organoids and washing the ECM away (Figure 1D), organoids can be disrupted to a small size by mechanical shearing. Depending on the morphology of the organoids (cystic Figure 1C, budding Figure 1E), organoids can be disrupted using plastic or glass pipettes (Figure 1F). Organoids are disrupted in a suspension (Figure 2A), which should be regularly monitored under the microscope. It is important to avoid making them too small, as groups of cells need to stay together to ensure organoid growth. Figure 2B shows the organoids in ECM drops just after passaging. In general, cystic organoids are plated at a relatively high density while budding organoids are plated in a low density; however, this can differ between different organoid cultures.
When passaging organoids for the preparation of monolayers, be sure to plate them at a high density, and let them grow for three days so they are in optimal expansion conditions. Organoids can be harvested for monolayer preparation when they are comparable with Figure 3A in size and density, where 6 wells of a 6-well plate, each containing 200 &#181;L of organoid domes, are typically enough for seeding a full 24-well plate of membrane inserts. After the preparation of a single-cell suspension with the cell dissociation reagent, single cells and small clumps of cells should be visible (Figure 3B), and live cells can be counted (Figure 3C). The arrows indicate dead cells stained with trypan blue, which should be excluded from counting. The single cells and small clumps are then seeded in the membrane inserts as seen in Figure 4A. Monolayer formation is visible after 1-3 days (Figure 4B,C), and the monolayers will be generally be confluent after 3-6 days depending on the organoid culture (Figure 4D). Monolayers stay in expansion medium until they are confluent, after which they can be enriched with, amongst others, enterocytes or goblet cells using different enrichment media. Figure 5A shows a monolayer that was cultured for 8 days in expansion medium (IEM). When enriched with enterocytes (eDM), a structure is seen, as in Figure 5B,&#160;while monolayers exposed to combination medium (cDM) show a smoother structure (Figure 5C).
Monolayer formation can be quantitatively followed by measuring TEER (Figure 6A). A completely confluent monolayer has a TEER value of ~100 &#8486;&#183;cm2, which increases to ~1000 &#8486;&#183;cm2 when exposed to either differentiation medium (Figure 6B). Monolayers in all medium conditions show a low apparent permeability (Papp) to Lucifer Yellow&#160;(0.45 kDa). Lysozyme secretion by ileal monolayers cultured in IEM was higher than that of monolayers cultured in IEM until confluent and for another 4 days in eDM or cDM (denoted as + subsequent eDM or cDM) (Figure 6D). Monolayers cultured in IEM, IEM + subsequent eDM or IEM + subsequent cDM show different morphology, as can be observed with H&#38;E staining (Figure 6E). While colon organoid-derived epithelial monolayers in IEM and cDM media have a smooth apical surface, enterocyte-differentiated monolayers present an invaginated apical morphology in the absence of Wnt. Ki67-positive proliferative cells can be detected in expansion conditions only. Alcian Blue and MUC2 stain mucus produced by goblet cells, which is visualized in the monolayers differentiated in eDM and more prominently in cDM when Wnt, Notch, and EGF signaling are inhibited, respectively (Figure 6E). Upon differentiation, proliferative cells decrease while goblet cell and enterocyte marker gene expression increases in comparison to that observed under IEM conditions, as shown by LGR5, MUC2, and ALPI gene expression quantification by qRT-PCR, respectively (Figure 6F).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62074/62074fig1v3.jpg" /> 
Figure 1: Establishing an intestinal organoid culture from frozen organoids. (A) Representative brightfield image of an intestinal organoid culture after thawing. (B) ECM domes (50 &#181;L) seeded in each well of a 24-well culture plate. (C) Representative image of a normal intestinal organoid culture ready for passaging. (D) Representative image on how to check the presence of ECM in a 15-mL tube containing organoids under a light microscope. (E) Representative image of a budding intestinal organoid culture ready for passaging. (F) A 10 &#181;L plastic pipette tip fitted on a low-retention 1250 &#181;L filter tip (left) and a narrowed glass pipette (right) for mechanical shearing of organoids. Scale bars = 100 &#181;m. Abbreviation: ECM = extracellular matrix. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62074/62074fig1v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62074/62074fig2v2.jpg" /> 
Figure 2: Processing intestinal organoids for maintenance or preparation of monolayers. (A) Representative image of intestinal organoids after mechanical disruption. (B) Representative image of an intestinal organoid culture seeded after passaging. Scale bars = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62074/62074fig2v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62074/62074fig3v2.jpg" /> 
Figure 3: Preparing single cells from intestinal organoids for monolayer preparation. (A) Intestinal organoids ready to harvest for monolayer preparation. (B) Single cells and small clumps of cells after single cell preparation. (C) Visible single cells and small clumps during counting in a grid chamber. Scale bars = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62074/62074fig3v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62074/62074fig4v2.jpg" /> 
Figure 4: Monolayer formation after seeding single cells on membranes. (A) Single cells just after seeding on membranes. On average, (B) the monolayer is around 50% confluent 1-3 days after seeding, (C) ~90% confluent at day 3-5, and (D) the complete monolayer has formed around day 4-7. Scale bars = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62074/62074fig4v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/62074/62074fig5v2.jpg" /> 
Figure 5: Enrichment of specific cell types in the monolayer. (A) Monolayer after 8 days in IEM. (B) Monolayer enriched with enterocytes after 4 days in IEM and another 4 days in eDM. (C) Monolayer enriched with goblet cells and other cell types after 4 days in IEM and another 4 days in cDM. Scale bars = 100 &#181;m. Abbreviations: IEM = intestinal organoid expansion medium; eDM = enterocyte differentiation medium; cDM = combination differentiation medium. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62074/62074fig5v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/62074/62074fig6v2.jpg" /> 
Figure 6: A variety of possible readouts using epithelial organoid monolayers. (A) Electrode in the membrane insert to measure TEER. (B) TEER values increase in time with a value of ~100 &#8486;&#183;cm2 when the monolayer reaches confluence. After enriching monolayers with enterocytes or a combination of different epithelial cells, TEER increases to 1000 &#8486;&#183;cm2 or higher. (C) Monolayers in all medium conditions (IEM + 4 days IEM/eDM/cDM) are impermeable to Lucifer Yellow. (D) Expression of lysozyme is higher in ileum monolayers when grown in expansion medium than in either type of differentiation medium (IEM + 4 days IEM/eDM/cDM). (E) Colon monolayers show different morphologies when exposed to different medium conditions (IEM + 4 days IEM/eDM/cDM) as visualized by H&#38;E, Ki67, Alcian Blue, and MUC2 stains. As expected, monolayers cultured in expansion medium are very proliferative, as shown by Ki67 staining. Monolayers differentiated with eDM show a columnar epithelium without proliferative cells. Monolayers exposed to cDM are also not proliferative and develop more goblet cells. Scale bar = 100 &#181;m. (F) Stem cell (LGR5), goblet cell (MUC2), and enterocyte (ALPI) marker gene expression in colon monolayers by qRT-PCR. Abbreviations: TEER = transepithelial electrical resistance; IEM = intestinal organoid expansion medium; eDM = enterocyte differentiation medium; cDM = combination differentiation medium; Papp = apparent permeability coefficient; LGR5 = leucine-rich repeat-containing G-protein-coupled receptor 5; H&#38;E = hematoxylin and eosin; AB = Alcian Blue; MUC2 = mucin-2; ALPI = intestinal alkaline phosphatase; qRT-PCR = quantitative reverse-transcription polymerase chain reaction. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62074/62074fig6v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="2">Membrane inserts</td>
		</tr>
		<tr>
			<td></td>
			<td>24-well plates</td>
			<td>96-well plates</td>
		</tr>
		<tr>
			<td>Membrane surface (cm2)</td>
			<td>0.33</td>
			<td>0.143</td>
		</tr>
		<tr>
			<td>Apical volume (&#181;L)</td>
			<td>150</td>
			<td>100</td>
		</tr>
		<tr>
			<td>Basolateral volume (&#181;L)</td>
			<td>800</td>
			<td>300</td>
		</tr>
		<tr>
			<td># Cells to seed per well</td>
			<td>450,000</td>
			<td>200,000</td>
		</tr>
		<tr>
			<td>HTS plates with membrane inserts</td>
			<td>PET</td>
			<td>PET</td>
		</tr>
		<tr>
			<td>Plates with separate inserts</td>
			<td>PET</td>
			<td>NA</td>
		</tr>
		<tr>
			<td>Light-tight plates with membrane inserts</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Electrodes are different for the two formats</td>
			<td colspan="2">Refer to the Table of Materials</td>
		</tr>
	</tbody>
</table>
Table 1

Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations ...

organoid-derived-epithelial-monolayer-clinically-relevant-vitro-model

Nanyang Technological University

Research

JoVE Journal

Biology

5.8K Views.  Foundation Hubrecht Organoid Technology (HUB). Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

Video: Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Described here is a rapid and effective procedure for functional reconstitution of purified wild-type and mutant CFTR protein that preserves activity for this chloride channel, which is defective in Cystic Fibrosis. Iodide efflux from reconstituted proteoliposomes mediated by CFTR allows studies of channel activity and the effects of small molecules.

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

A Protocol for Lentiviral Transduction and Downstream Analysis of Intestinal Organoids

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth factors. Since organoids are highly similar to the original tissue in terms of homeostatic stem cell differentiation, cell polarity and presence of all terminally differentiated cell types known to the adult intestinal epithelium, they serve as an essential resource in experimental research on the epithelium. The possibility to express transgenes or interfering RNA using lentiviral or retroviral vectors in organoids has increased opportunities for functional analysis of the intestinal epithelium and intestinal stem cells, surpassing traditional mouse transgenics in speed and cost. In the current video protocol we show how to utilize transduction of small intestinal organoids with lentiviral vectors illustrated by use of doxycylin inducible transgenes, or IPTG inducible short hairpin RNA for overexpression or gene knockdown. Furthermore, considering organoid culture yields minute cell counts that may even be reduced by experimental treatment, we explain how to process organoids for downstream analysis aimed at quantitative RT-PCR, RNA-microarray and immunohistochemistry. Techniques that enable transgene expression and gene knock down in intestinal organoids contribute to the research potential that these intestinal epithelial structures hold, establishing organoid culture as a new standard in cell culture.

In this video protocol we give a step by step explanation of lentiviral transduction in organoids of primary intestinal epithelium and of processing and downstream analysis of these cultures by quantitative RT-PCR, RNA-microarray and immunohistochemistry.

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...

A Mouse Model of Intestinal Partial Obstruction

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including tumorous growths. However, the cellular remodeling mechanisms involved in, and caused by, intestinal obstructions are poorly understood. Several animal models of intestinal obstructions have been developed, but the mouse model is the most cost/time effective. The mouse model uses the surgical implantation of an intestinal partial obstruction (PO) that has a high mortality rate if it is not performed correctly. In addition, mice receiving PO surgery fail to develop hypertrophy if an appropriate blockade is not used or not properly placed. Here, we describe a detailed protocol for PO surgery which produces reliable and reproducible intestinal obstructions with a very low mortality rate. This protocol utilizes a surgically placed silicone ring that surrounds the ileum which partially blocks digestive movement in the small intestine. The partial blockage makes the intestine become dilated due to the halt of digestive movement. The dilation of the intestine induces smooth muscle hypertrophy on the oral side of the ring that progressively develops over 2 weeks until it causes death. The surgical PO mouse model offers an in vivo model of hypertrophic intestinal tissue useful for studying pathological changes of intestinal cells including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), PDGFR&#945;+, and neuronal cells during the development of intestinal obstruction.

Intestinal obstructions are a partial or complete blockage of the intestine that can cause severe abdominal pain, nausea, vomiting, and preventing the passage of stool. This procedure for creating intestinal partial obsructions in mice is reliable in studying the mechanisms underlying pathological cell growth and death in the intestine.

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A)

Studying the structure and the dynamics of kinetochores and centromeres is important in understanding chromosomal instability (CIN) and cancer progression. How the chromosomal location and function of a centromere (i.e., centromere identity) are determined and participate in accurate chromosome segregation is a fundamental question. CENP-A is proposed to be the non-DNA indicator (epigenetic mark) of centromere identity, and CENP-A ubiquitylation is required for CENP-A deposition at the centromere, inherited through dimerization between cell division, and indispensable to cell viability.
Here we describe mass spectrometry analysis to identify ubiquitylation of EYFP-CENP-A K124R mutant suggesting that ubiquitylation at a different lysine is induced because of the EYFP tagging in the CENP-A K124R mutant protein. Lysine 306 (K306) ubiquitylation in EYFP-CENP-A K124R was successfully identified, which corresponds to lysine 56 (K56) in CENP-A through mass spectrometry analysis. A caveat is discussed in the use of GFP/EYFP or the tagging of high molecular weight protein as a tool to analyze the function of a protein. Current technical limit is also discussed for the detection of ubiquitylated bands, identification of site-specific ubiquitylation(s), and visualization of ubiquitylation in living cells or a specific single cell during the whole cell cycle.
The method of mass spectrometry analysis presented here can be applied to human CENP-A protein with different tags and other centromere-kinetochore proteins. These combinatory methods consisting of several assays/analyses could be recommended for researchers who are interested in identifying functional roles of ubiquitylation.

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A EYFP-CENP-A

CENP-A ubiquitylation is an important requirement for CENP-A deposition at the centromere, inherited through dimerization between cell division, and indispensable to cell viability. Here we describe mass spectrometry analysis to identify ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A) protein.

Studying the structure and the dynamics of kinetochores and centromeres is important in understanding chromosomal instability (CIN) and cancer ...

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been conducted to investigate the effect of gut microbes as a whole; however, different microbes could exert distinct effects toward the host. This article provides the methodology to study the effect of each specific mosquito gut microbe and the potential mechanism.
This protocol contains two parts. The first part introduces how to dissect the mosquito midgut, isolate cultivable bacteria colonies, and identify bacteria species. The second part provides the procedure to generate antibiotic-treated mosquitoes and reintroduce one specific bacteria species.

This article presents a protocol to investigate the effect of individual mosquito gut bacteria, including isolation and identification of mosquito midgut cultivable microbes, antibiotic depletion of mosquito gut bacteria, and reintroduce one specific bacteria species.

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been ...

Generation of Murine Primary Colon Epithelial Monolayers from Intestinal Crypts

The intestinal epithelium is comprised of a single layer of cells that act as a barrier between the gut lumen and the interior of the body. Disruption in the continuity of this barrier can result in inflammatory disorders such as inflammatory bowel disease. One of the limitations in the study of intestinal epithelial biology has been the lack of primary cell culture models, which has obliged researchers to use model cell lines derived from carcinomas. The advent of three dimensional (3D) enteroids has given epithelial biologists a powerful tool to generate primary cell cultures, nevertheless, these structures are embedded in extracellular matrix and lack the maturity characteristic of differentiated intestinal epithelial cells. Several techniques to generate intestinal epithelial monolayers have been published, but most are derived from established 3D enteroids making the process laborious and expensive. Here we describe a protocol to generate primary epithelial colon monolayers directly from murine intestinal crypts. We also detail experimental approaches that can be used with this model such as the generation of confluent cultures on permeable filters, confluent monolayer for scratch wound healing studies and sparse and confluent monolayers for immunofluorescence analysis.

In this protocol, we describe how to generate murine primary epithelial colon monolayers directly from intestinal crypts. We provide experimental approaches to generate confluent monolayers on permeable filters, confluent monolayers for scratch wound healing and biochemical studies, and sparse and confluent monolayers for immunofluorescence analysis.

The intestinal epithelium is comprised of a single layer of cells that act as a barrier between the gut lumen and the interior of the body. Disruption in ...

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Summary

Explore More Videos

Chapters in this video

Chromatin Isolation by RNA Purification (ChIRP)

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

A Protocol for Lentiviral Transduction and Downstream Analysis of Intestinal Organoids

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

A Mouse Model of Intestinal Partial Obstruction

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A)

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

Generation of Murine Primary Colon Epithelial Monolayers from Intestinal Crypts