Support for this project came from the BGSU Graduate College, and the BGSU Office of Sponsored Programs and Research.

1. Generation of the E. coli Double Knock Out Mutant with P1 Transduction
<ol>
	<li>Obtain the E. coli single-knockout mutant strains &#916;PotE and &#916;CadB from the E. coli Genetic Stock Center (<a href="http://cgsc.biology.yale.edu" target="_blank">http://cgsc.biology.yale.edu</a>). 
	NOTE: The &#916;PotE strain is kanamycin resistant26 and the &#916;CadB strain is tetracycline resistant27.</li>
	<li>Construct the PotE/CadB double knockout (DKO) strain using the P1 transduction protocol28.
	<ol>
		<li>Lysate preparation
		<ol>
			<li>Dilute an overnight culture of &#916;PotE in fresh LB (1:100) supplemented with 10-25 mM MgCl2, 5 mM CaCl2, and 0.1-0.2% glucose.</li>
			<li>Grow at 37 &#176;C for 1-2 h.</li>
			<li>Add 40 &#181;L of P1 phage lysate to the culture, and continue growing at 37 &#176;C. Monitor for 1-3 h until the culture has lysed 
			NOTE: When the culture is lysed, cellular debris will be visible in the tube and the culture will have a significant loss of turbidity.</li>
			<li>Add several drops of chloroform (50-100 &#181;L) to the lysate and vortex. Centrifuge at 12,000 x g for 2 min to remove cellular debris and transfer the supernatant to a fresh tube.</li>
		</ol>
		</li>
		<li>Transduction
		<ol>
			<li>Grow &#916;CadB strain overnight in LB medium.</li>
			<li>Harvest the cells by centrifugation at 4,000 x g for 2 min and resuspend in 1/5-1/3 the harvested culture volume in fresh LB supplemented with 100 mM MgSO4 and 5 mM CaCl2.</li>
			<li>Add the &#916;CadB cell suspension to the tube with phage from step 1.2.1.4 and mix rapidly.</li>
			<li>Add 200 &#181;L of 1 M Na-Citrate (pH5.5), then add 1 mL of LB. Incubate at 37 &#176;C for 1 h to allow the expression of the antibiotic resistant marker.</li>
			<li>Spin cells at 4000 x g for 5 min.</li>
			<li>Resuspend in 100 &#181;L LB supplemeted with 100 mM Na-Citrate (pH 5.5) and vortex well to disperse cells.</li>
			<li>Select the recombinant strains on LB agar plates with 50 &#181;g/mL kanamycin and 10 &#181;g/mL tetracycline and then confirm by Polymerase Chain Reaction (PCR) with appropriate primers26,27.</li>
			<li>Verify the PCR fragments by sequencing.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Expression of the Target Gene (AtBAT1) in E. coli Mutant
<ol>
	<li>Amplify the full-length sequence of the target gene by PCR and insert into the Gateway entry vector pENTR/D-TOPO29. 
	NOTE: In this case ATBAT1.1 was amplified using forward primer 5&#39;CGGCGATCAATCCTTTGTT and reverse primer 5&#39;GCTAAGAATGTTGGAGATGG, an initial denaturation at 98 &#176;C for 2 min and then 30 cycles of denaturation at 98 &#176;C for 0.1 min, annealing at 59 &#176;C for 0.3 min, extension at 72 &#176;C for 0.40 min and final extension at 72 &#176;C for 10 min. The PCR product was purified using a PCR cleanup kit, quantified using a spectrometer. Insertion of the PCR product into the Gateway vector was done following the manufactrurers directions.
	<ol>
		<li>Transform the entry vector into competent Top10 E. coli cells by heatshock and select for successful recombinants on LB media with 50 &#181;g/mL kanamycin following standard molecular cloning protocols30.</li>
		<li>Extract plasmid DNA using a plasmid extraction kit, following the manufacturer&#39;s directions, and sequence to confirm the correct insertion.</li>
	</ol>
	</li>
	<li>Transfer the target gene into the E. coli destination vector, pBAD-DEST49 by Gateway LR cloning to create an expression vector29.
	<ol>
		<li>Transform the expression vector into competent Top10 E. coli cells by heatshock for 30 s and select successful recombinants on LB media with 100 &#181;g/mL ampicillin30.</li>
		<li>Extract plasmid DNA30 and sequence to confirm the correct insertion.</li>
	</ol>
	</li>
	<li>Transform expression vector into E. coli &#916;potE740(del)::kan, &#916;cadB2231::Tn10 and select on LB plates with ampicillin, kanamycin, and tetracycline30.</li>
	<li>In order to determine the optimal concentration of arabinose for induction, express the target gene under the control of the araBAD promoter in LB media with gradient concentrations of arabinose as described29.</li>
	<li>Collect the cell pellets and assess protein expression by SDS-PAGE and visualization of protein bands as described in the product manual29. 
	NOTE: The E. coli &#916;potE740(del)::kan, &#916;cadB2231::Tn10 was used as the control sample without BAT1 expression. E.coli double knock out mutant cells with the empty pBAD-DEST49 vector was not used as a control due to the presence of the ccdB gene in the vector.</li>
</ol>
3. Generation of Inside-out Membrane Vesicles
<ol>
	<li>Culture the E. coli mutant cells expressing the target protein by growing a single colony overnight in 5 mL of polyamine-free media (2% glycerol, 6 g of K2HPO4, 3 g of KH2PO4, 0.5 g of NaCl, NH4Cl, 50 mg of thiamine, 0.79 g yeast complete synthetic media adenine hemisulfate (10 mg/L), L-Arginine (50 mg/L), L-Aspartic acid (80 mg/L), L-Histidine hydrochloride monohydrate (20 mg/L), L-Leucine (100 mg/L), L-Lysine hydrochloride (50 mg/L), L-Methionine (20 mg/L), L-Phenylalanine (50 mg/L), L-Threonine (100 mg/L), L-Tryptophan (50 mg/L), L-Tyrosine (50 mg/L), L-Valine (140 mg/L), Uracil (20 mg/L)). Transfer this culture to 500 mL of polyamine-free media supplemented with 0.0002% arabinose and grow until the cell culture reaches an OD600 of 0.6-0.8 (usually ~5 h).</li>
	<li>Collect the cell pellet by centrifugation at 2,000 x g for 15 min at 4 &#176;C. Resuspend the pellet and wash three times with 0.1 M potassium phosphate buffer, pH 6.6, containing 10 mM EDTA (Buffer 1). The final volume of cells in Buffer 1 after the third spin should be 10 mL.</li>
	<li>Generate inside-out membrane vesicles by French Press treatment (10,000 p.s.i.) of the intact cells using a 35 mL French pressure Cell.</li>
	<li>Prior to loading the sample into the standard French pressure cell, lubricate the piston and O-rings to make it easier to insert into the cell. 
	NOTE: These instructions are specific for the use of the standard pressure cell31.
	<ol>
		<li>Carefully screw the closure plug into the lower end of the cell. Ensure that the cell is right-side up based on the lettering on the side of the cell. Insert the piston into the cell and move it into the cell, until the max fill line on the piston reach the top of the piston. Flip the unit over and place on the provided stand between the three posts.</li>
		<li>Pour the cell suspension into the body of the cell. 
		NOTE: We have been using only 10 mL, so there will be plenty of room left in the French pressure cell chamber, which has a capacity of 35 mL.</li>
		<li>Mount the standard pressure cell on the French pressure cell unit.
		<ol>
			<li>First check that the power is off. On the left side of the panel is the Ratio Selector switch. It has three positions: Down at the end of the run, Low for using a smaller pressure cell, and High for use with the standard French pressure cell. If the French press was previously used with the smaller cell the piston may not be fully retracted. Set this switch to Down.</li>
		</ol>
		</li>
		<li>Turn the machine on with the switch on the RHS at the back of the unit and turn the Pause-Run switch to the Run position. This will result in the piston being fully retracted. Move the switch back to Pause, and shut the machine off.</li>
		<li>Loosen the thumb screws and move the safety clamp that spans to two stainless steel columns to the side. It will swing out to the right. With one hand holding the base of the closure plug in place, pick the French pressure cell up with both hands, and rotate it 180&#176;, so the piston is now in the upright position. Set it onto the platform, and move the safety clamp back in place so that this clamp holds the French pressure cell in position.</li>
		<li>Note the Flow Valve assembly on the closure plug needs to be accessible to the operater and positioned so that the valve can be turned freely. Open the the flow valve assembly with a few counter clockwise turns. Position the the arms of the piston so that they are oriented in a two o&#39;clock and eight o&#39;clock position. Tighten the thumbs screws so that the standard pressure cell is held in place.</li>
		<li>Insert the Sample outlet tube into the closure plug, and connect a short piece of flexible tubing so that the broken cell debris can be collected in a falcon tube. We usually use an 300 mL ice-filled beaker to hold the falcon tube upright, and to keep the cell debris chilled.</li>
		<li>Make sure the Pause-Run switch is set to Pause, and the valve assembly is in the open position. Turn the machine back to on, adust the Ratio Selector switch to High, and turn the Pressure Increase Valve on the front panel to the right about a half turn.</li>
		<li>The piston will begin to rise from the base to displace the air in chamber. Direct the air coming out of the Tygon tubing attached to the sample outlet tube to the tube in the beaker.</li>
		<li>When the first drops of liquid come out, close the the flow valve assembly by turning it clockwise. This creates a metal to metal seal, with the pressure cell, so do not overtighten.</li>
		<li>The front of the French Press has a chart on the front panel to generate the proper pressure on the biological cells inside the pressure cell. In this case, increase the pressure by turning the Pressure Increase Valve clockwise, until the Gauge reaches 640 psi. This will create an internal pressure of 10,000 psi.</li>
		<li>Once the cell has reached target pressure open the flow valve assembly slightly by turning it counter clockwise. Adjust the the opening of the valve to allow a flow rate of only about 10 drops per min.</li>
		<li>When the stop line on the piston body reaches the top of the flow cell. Switch the Pause-Run Switch to Pause. This is critical because having the piston inserted farther into the cell will damage the unit. Open the flow valve assembly and collect the remaining drops.</li>
		<li>Turn Ratio Selector switch to Down, and then set the Pause Run switch to Run. When the bottom plate is fully retracted set the Run switch to Pause, and turn the machine off.</li>
		<li>Remove the French pressure cell from the French press, and disassemble for cleaning. Store all parts dry with a light covering of glycerol. Remove and replace any gaskets or seals with signs of wear.</li>
	</ol>
	</li>
	<li>Remove unbroken cells and cell debris of the French press eluent by centrifugation at 10,000 x g for 15 min at 4 &#176;C. Discard the pellet, and transfer supernatant to ultracentrifuge tubes.</li>
	<li>Pellet membrane vesicles from the resulting supernatant by ultracentrifugationat 150,000 g for 1 h at 4 &#176;C.</li>
	<li>Wash the membrane vesicles once, without resuspension, in 1 mM Tris-maleate, pH 5.2 containing 0.14 M KCl, 2 mM 2-mercaptoethanol and 10% glycerol and resuspend in the same buffer (Buffer 2)23 using a Dounce tissue grinder. Typically the membrane fraction from 500 mL of culture would be suspended in 5 mL of buffer, and a concentration of 5-10 mg of membrane protein/mL using the Biochinic Acid assay32.</li>
	<li>Store 100 &#181;L aliquots of membrane preparations at -80 &#176;C in 1.5 mL microcentrifuge tubes.</li>
</ol>
4. Western Blot and Orientation of Transporter Assay
<ol>
	<li>Wash and resuspend vesicles from step 3.7 in 30 mM Tris pH 7.8 + 0.1 mM CoCl2.</li>
	<li>To 100 &#181;L samples, add 1 &#181;L of 2 mg/mL carboxypeptidase A in 0.1 M NaCl, 30 mM Tris, 0.2 mM CoCl2 pH 7.8.</li>
	<li>Inculate for 20 min at 20 &#176;C. Stop digestion by adding 5 &#181;L of 0.5 M NaEDTA, 0.5 M 2-mercaptoethanol pH 7.5.</li>
	<li>To fully inactivate the enzyme, incubate the solution for 1 h at room temperature. 
	NOTE: Vesicles without the catboxypeptidase A treatment were used as a control.</li>
	<li>Analyze samples by electrophoresis in the presence of lithium dodecyl sulfate. Add 5-10 &#181;L of 150 mg/mL lithium dodecyl sulfate, 450 mg/mL glycerol, 0.1 mg/mL bromophenol blue, 0.4 M Tris pH 7.5 to 100 &#181;L of sample.</li>
	<li>Perform immunoblotting by laying a nitrocellulose filter moistened with 25 mM sodium-hydrogen phosphate pH 7.5 upon the polyacrylamide gel. Place these between two moistened cellulose filters and finally between two moistened plastic scouring pads. Place this assemblage between the electrodes of a chamber containing 25 mM sodium-hydrogen phosphate pH 7.5 at 2-4 &#176;C.</li>
	<li>Allow electrotransfer of proteins to proceed for 3 h at 20 V and 2-3 A.</li>
	<li>Block the nitrocellulose membrane overnight at 2 &#176;C in a blocking buffer of 0.15 M NaCl, 10 mM Tris, pH 7.5 and 0.5 mg/mL Tween 2033.</li>
	<li>Incubate the nitrocellulose filter for 2 h with a 1:5000 dilution of Anti-His (C terminal)-HRP antibody in the blocking buffer (20 mL) and wash twice with 50 mL of buffer for a total of 60 min.</li>
	<li>To visualize the immunoblot, dissolve 6 mg of 4-chloro-1-naphthol in 20 mL of denatured alcohol and add 80 mL of 15 mM Tris pH 7.5 and 50 &#181;L of 30% H2O2. Bathe the filter paper in the substrate solution for 20 min. The reagent will react with the antibody to form a blue precipitate on the nitrocellulose membrane. When sufficient color has developed, rinse the membrane with water, and allow to dry.</li>
</ol>
5. Transport Assay
<ol>
	<li>Incubate 100 &#956;L aliquots of membrane vesicles at 12 &#176;C for 5 min.</li>
	<li>Initiate transport by adding radiolabeled polyamines to the membrane vesicles at a final concentration of 50 &#181;M (unless otherwise stated). Make 3H-substrate (spermidine or putrescine) solutions in an assay buffer consisting of 10 mM Tris-HCl, 10 mM potassium phosphate, pH 8.0 and 0.14 M KCl23 (Buffer 3) with modifications depending on the assay.</li>
	<li>Conduct transport assays for 1 min at 12 &#176;C in 1.5 mL microfuge tubes.</li>
	<li>After 1 min, transfer the reaction mixtures to filtration manifold and filter through a 0.45 &#181;m nitrocellulose membrane filter.
	<ol>
		<li>Add 3 mL of ice-cold assay buffer containing a 10-fold higher concentration of unlabeled polyamines followed by 3 mL of assay buffer without the polyamines to reduce nonspecific binding.</li>
		<li>Transfer the washed filters to 20 mL disposable scintillation vials containing 10 mL of scintillation liquid and determine radioactivity by using a liquid scintillation counter. The scintillation counter measures the radioactivity in the sample and reports it as disintegrations per min (dpm).</li>
	</ol>
	</li>
	<li>Calculate the net polyamine uptake as the difference between the uptake at 1 min by vesicles incubated at 12 &#176;C and uptake at 0 min by vesicles incubated on ice. 
	NOTE: The mass of substrate imported into the vesicles is calculated as follows. If the sample volume in the microfuge tube is 0.2 &#181;L and the starting concentration of substrate is 100 &#181;M, then the total mass of substrate in the microfuge tube is 20 x 10-12 M. Because of the very high specific activity of commercially labelled substrates (often 2.22 x 109 dpm/mM) the mass of the isotope added can be ignored in the calculation. So if the total amount of isotope that was added to the microfuge tube was 100 x 106 dpm and the vesicles had a net uptake of 1,000 dpm, then the total mass of substrate taken up by the vesicles was 1% of the total number of moles of substrate or 2 x 10-13 M.
	<ol>
		<li>Determine Km for the substrate by measuring the uptake of 10, 25, 50, 250 and 500 &#956;M radiolabeled substrate into vesicles expressing the target protein. Calculate Michaelis-Menten kinetics using a nonlinear regression method using the Michaelis Menton model of the statistical software package34.</li>
	</ol>
	</li>
	<li>For the competition experiments, add 100 &#956;M, 500 &#956;M, 1 mM, 1.5 mM or 2 mM nonlabelled competitive substrate made in the assay buffer to the 1.5 mL microcentrifuge tube containing 100 &#181;L of vesicles at 12 &#176;C.
	<ol>
		<li>Add radiolabeled polyamine (50 &#181;M) to the microcentrifuge tube simultaneously.</li>
		<li>Measure radioactivity trapped inside vesicles as mentioned above by repeating steps 5 through 5.4.2.</li>
		<li>Determine apparent Km (Km,app) for the competitive substrates by measuring the uptake of 10, 25, 50, 250 and 500 &#956;M radiolabeled polyamines in the presence of 100 &#956;M or higher nonlabelled substrate and using a nonlinear regression method to plot the curve.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Haferkamp, I., Linka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+expression+and+characterisation+of+membrane+transport+proteins.">Functional expression and characterisation of membrane transport proteins.</a> Plant Biology (Stuttgart). 14 (5), 675-690 (2012).</li><li>Sauer, N., Caspari, T., Klebl, F., Tanner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+expression+of+the+Chlorella+hexose+transporter+in+Schizosaccharomyces+pombe.">Functional expression of the Chlorella hexose transporter in Schizosaccharomyces pombe.</a> Proceedings of the National Academy of Sciences of the United States of America. 87 (20), 7949-7952 (1990).</li><li>Sauer, N., Stolz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUC1+and+SUC2:+two+sucrose+transporters+from+Arabidopsis+thaliana;+expression+and+characterization+in+baker's+yeast+and+identification+of+the+histidine-tagged+protein.">SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein.</a> The Plant Journal. 6 (1), 67-77 (1994).</li><li>Weber, H., Borisjuk, L., Heim, U., Sauer, N., Wobus, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+role+for+sugar+transporters+during+seed+development:+molecular+characterization+of+a+hexose+and+a+sucrose+carrier+in+fava+bean+seeds.">A role for sugar transporters during seed development: molecular characterization of a hexose and a sucrose carrier in fava bean seeds.</a> Plant Cell. 9 (6), 895-908 (1997).</li><li>Huang, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GhDREB1+enhances+abiotic+stress+tolerance,+delays+GA-mediated+development+and+represses+cytokinin+signalling+in+transgenic+Arabidopsis.">GhDREB1 enhances abiotic stress tolerance, delays GA-mediated development and represses cytokinin signalling in transgenic Arabidopsis.</a> Plant, Cell &amp; Environment. 32 (8), 1132-1145 (2009).</li><li>Bassham, D. C., Raikhel, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+cells+are+not+just+green+yeast.">Plant cells are not just green yeast.</a> Plant Physiology. 122 (4), 999-1001 (2000).</li><li>Garcia-Mata, R., Bebok, Z., Sorscher, E. J., Sztul, E. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+dynamics+of+aggresome+formation+by+a+cytosolic+GFP-chimera.">Characterization and dynamics of aggresome formation by a cytosolic GFP-chimera.</a> Journal of Cell Biology. 146 (6), 1239-1254 (1999).</li><li>Liu, J., Sitaram, A., Burd, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+copper-dependent+endocytosis+and+vacuolar+degradation+of+the+yeast+copper+transporter,+Ctr1p,+by+the+Rsp5+ubiquitin+ligase.">Regulation of copper-dependent endocytosis and vacuolar degradation of the yeast copper transporter, Ctr1p, by the Rsp5 ubiquitin ligase.</a> Traffic. 8 (10), 1375-1384 (2007).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nature Protocols. 3 (5), 784-798 (2008).</li><li>Schachtman, D. P., Schroeder, J. I., Lucas, W. J., Anderson, J. A., Gaber, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+an+inward-rectifying+potassium+channel+by+the+Arabidopsis+KAT1+cDNA.">Expression of an inward-rectifying potassium channel by the Arabidopsis KAT1 cDNA.</a> Science. 258 (5088), 1654-1658 (1992).</li><li>Boorer, K. J., Forde, B. G., Leigh, R. A., Miller, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+expression+of+a+plant+plasma+membrane+transporter+in+Xenopus+oocytes.">Functional expression of a plant plasma membrane transporter in Xenopus oocytes.</a> FEBS Letters. 302 (2), 166-168 (1992).</li><li>Miller, A. J., Zhou, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+oocytes+as+an+expression+system+for+plant+transporters.">Xenopus oocytes as an expression system for plant transporters.</a> Biochimica et Biophysica Acta. 1465 (1-2), 343-358 (2000).</li><li>Reinders, A., Sivitz, A. B., Starker, C. G., Gantt, J. S., Ward, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+LjSUT4,+a+vacuolar+sucrose+transporter+from+Lotus+japonicus.">Functional analysis of LjSUT4, a vacuolar sucrose transporter from Lotus japonicus.</a> Plant Molecular Biology. 68 (3), 289-299 (2008).</li><li>Kovermann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Arabidopsis+vacuolar+malate+channel+is+a+member+of+the+ALMT+family.">The Arabidopsis vacuolar malate channel is a member of the ALMT family.</a> The Plant Journal. 52 (6), 1169-1180 (2007).</li><li>Blattner, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+genome+sequence+of+Escherichia+coli+K-12.">The complete genome sequence of Escherichia coli K-12.</a> Science. 277 (5331), 1453-1462 (1997).</li><li>Terpe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+bacterial+expression+systems+for+heterologous+protein+production:+from+molecular+and+biochemical+fundamentals+to+commercial+systems.">Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems.</a> Applied Microbiology and Biotechnology. 72 (2), 211-222 (2006).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> Journal of Molecular Biology. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Consequences+of+membrane+protein+overexpression+in+Escherichia+coli.">Consequences of membrane protein overexpression in Escherichia coli.</a> Molecular &amp; Cellular Proteomics. 6 (9), 1527-1550 (2007).</li><li>Bernaudat, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+expression+of+membrane+proteins:+choosing+the+appropriate+host.">Heterologous expression of membrane proteins: choosing the appropriate host.</a> PLoS One. 6 (12), e29191 (2011).</li><li>Takabatake, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+cDNAs+encoding+mitochondrial+phosphate+transporters+in+soybean,+maize,+rice,+and+Arabidopis.">Isolation and characterization of cDNAs encoding mitochondrial phosphate transporters in soybean, maize, rice, and Arabidopis.</a> Plant Molecular Biology. 40 (3), 479-486 (1999).</li><li>Picault, N., Palmieri, L., Pisano, I., Hodges, M., Palmieri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+novel+transporter+for+dicarboxylates+and+tricarboxylates+in+plant+mitochondria.+Bacterial+expression,+reconstitution,+functional+characterization,+and+tissue+distribution.">Identification of a novel transporter for dicarboxylates and tricarboxylates in plant mitochondria. Bacterial expression, reconstitution, functional characterization, and tissue distribution.</a> Journal of Biological Chemistry. 277 (27), 24204-24211 (2002).</li><li>Snowden, C. J., Thomas, B., Baxter, C. J., Smith, J. A., Sweetlove, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tonoplast+Glu/Asp/GABA+exchanger+that+affects+tomato+fruit+amino+acid+composition.">A tonoplast Glu/Asp/GABA exchanger that affects tomato fruit amino acid composition.</a> The Plant Journal. 81 (5), (2015).</li><li>Kashiwagi, K., Igarashi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+assays+of+polyamine+transport+systems+in+Escherichia+coli+and+Saccharomyces+cerevisiae.">Identification and assays of polyamine transport systems in Escherichia coli and Saccharomyces cerevisiae.</a> Methods in Molecular Biology. 720, 295-308 (2011).</li><li>Kashiwagi, K., Miyamoto, S., Suzuki, F., Kobayashi, H., Igarashi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excretion+of+putrescine+by+the+putrescine-ornithine+antiporter+encoded+by+the+potE+gene+of+Escherichia+coli.">Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli.</a> Proceedings of the National Academy of Sciences of the United States of America. 89 (10), 4529-4533 (1992).</li><li>Tsuchiya, T., Rosen, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+transport+driven+by+a+proton+gradient+and+inverted+membrane+vesicles+of+Escherichia+coli.">Calcium transport driven by a proton gradient and inverted membrane vesicles of Escherichia coli.</a> Journal of Biological Chemistry. 251 (4), 962-967 (1976).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular Systems Biology. 2, (2006).</li><li>Nichols, B. P., Shafiq, O., Meiners, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+analysis+of+Tn10+insertion+sites+in+a+collection+of+Escherichia+coli+strains+used+for+genetic+mapping+and+strain+construction.">Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction.</a> Journal of Bacteriology. 180 (23), 6408-6411 (1998).</li><li>. P1vir phage transduction Available from: <a target="_blank" href="https://openwetware.org/wiki/Sauer:P1vir_phage_transduction">https://openwetware.org/wiki/Sauer:P1vir_phage_transduction</a> (2011)</li><li>. pBAD-DEST49 Gateway Destination Vector Available from: <a target="_blank" href="https://www.thermofisher.com/order/catalog/product/12283016">https://www.thermofisher.com/order/catalog/product/12283016</a> (2010)</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: a laboratory Manual. , (2012).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+biochinic+acid.">Measurement of protein using biochinic acid.</a> Analytical Biochemistry. 150, 76-85 (1985).</li><li>Wright, J. K., Overath, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+the+lactose:+H++carrier+of+Escherichia+coli+and+characterization+of+galactoside+binding+and+transport.">Purification of the lactose: H+ carrier of Escherichia coli and characterization of galactoside binding and transport.</a> European Journal of Biochemistry. 138 (3), 497-508 (1984).</li><li>. GaphPad Software Available from: <a target="_blank" href="https://www.graphpad.com/data-analysis-resource-center/">https://www.graphpad.com/data-analysis-resource-center/</a> (2019)</li><li>Kirchberger, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+and+biochemical+analysis+of+the+plastidic+ADP-glucose+transporter+(ZmBT1)+from+Zea+mays.">Molecular and biochemical analysis of the plastidic ADP-glucose transporter (ZmBT1) from Zea mays.</a> Journal of Biological Chemistry. 282 (31), 22481-22491 (2007).</li><li>Deniaud, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+chloroplast+ATP/ADP+transporter+in+E.+coli+membranes:+behind+the+Mistic+strategy.">Expression of a chloroplast ATP/ADP transporter in E. coli membranes: behind the Mistic strategy.</a> Biochimica et Biophysica Acta. 1808 (8), 2059-2066 (2011).</li><li>Sze, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H+-Translocating+ATPases:+Advances+Using+Membrane+Vesicles.">H+-Translocating ATPases: Advances Using Membrane Vesicles.</a> Annual Review of Plant Physiology. 36, 175-208 (1985).</li><li>Bush, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proton-coupled+sugar+and+amino+acid+transporters+in+plants.">Proton-coupled sugar and amino acid transporters in plants.</a> Annual Review of Plant Physiology Plant Molecular Biology. 44, 513-542 (1993).</li><li>Futai, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Orientation+of+membrane+vesicle+from+Escherichea+coli+prepared+by+different+procedures.">Orientation of membrane vesicle from Escherichea coli prepared by different procedures.</a> Journal of Membrane Biology. 115, 15-28 (1974).</li><li>Seckler, R., Wright, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sideness+of+native+membrane+vesicles+of+Escherichea+coli+and+orientation+of+the+reconstituted+lactose:+H++carrier.">Sideness of native membrane vesicles of Escherichea coli and orientation of the reconstituted lactose: H+ carrier.</a> European Journal of Biochemistry. 142 (2), 269-279 (1984).</li><li>LaVallie, E. R., Lu, Z., Diblasio-Smith, E. A., Collins-Racie, L. A., McCoy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thioredoxin+as+a+fusion+partner+for+production+of+soluble+recombinant+proteins+in+Escherichia+coli.">Thioredoxin as a fusion partner for production of soluble recombinant proteins in Escherichia coli.</a> Methods in Enzymology. 326, 322-340 (2000).</li><li>Goodman, D. B., Church, G. M., Kosuri, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Causes+and+effects+of+N-terminal+codon+bias+in+bacterial+genes.">Causes and effects of N-terminal codon bias in bacterial genes.</a> Science. 342 (6157), 475-479 (2013).</li><li>Wacker, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-linked+glycosylation+in+Campylobacter+jejuni+and+its+functional+transfer+into+E.+coli.">N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli.</a> Science. 298 (5599), 1790-1793 (2002).</li></ol>

The authors have nothing to disclose.

In the present study, we outline a method for the characterization of an antiporter by first expressing the protein in E. coli and then generating membrane vesicles, so that the heterologously-expressed protein can be assayed in a cell-free system. In addition to equipment found in most molecular biology labs, this strategy requires the use of a French press, an ultracentrifuge, and access to a facility to conduct radioisotope assays.
A basic requirement of this technique is that the heterologous protein is correctly targeted to the plasma membrane of E. coli. This strategy may also be useful for functional analysis of organellar transporters since the plastid ADP glucose transporter was successfully localized to the E. coli cell membrane and functionally characterized35. The vector (pBAD-DEST49) used in these experiments contains an N-terminal thioredoxin protein to increase the solubility of the translated product. N-terminal fusions of a small B. subtilus protein mystic, have been found to enable more efficient targeting of membrane transporters to the cytoplasmic membrane36. However, misfolding events, and the failure of the proteins to be properly integrated into the cytoplasmic membrane are potential problems that preclude the use of bacterial expression systems for many types of transporters1.
Membrane vesicles have also been used to characterize plant transporters37,38. As the vesicles lack the essential energy sources such as ATP and enzymes, the interference from active transporters and other metabolic activity is minimal. Thus, this system is ideal for the analysis of passive translocations such as metabolite exchangers. The everted membrane vesicles, in particular, can be applied to the characterization of exporters and antiporters since the composition of the internal solution can be manipulated by changing the composition of buffer 1. Furthermore, using French press or ultrasound sonication is fairly efficient in generating inside-out membrane vesicles from intact E. coli cells. 95% of the vesicles generated by ultrasound sonication or French press have everted membranes39,40. PotE, the E. coli antiporter of putrescine and ornithine, was the first polyamine antiporter that was characterized using inside-out membrane vesicles23. We used P1 transduction to create a specific mutant strain for the characterization of a polyamine antiporter, and this strain may be useful for the characterization of other animal, fungal or plant polyamine exchangers. We also envision that other E. coli strains with two or more gene deletions might be useful for the characterization of other plant and animal exchange transporters using membrane vesicles.
The most critical step in this protocol is the expression of the protein in the E. coli mutant system. An E. coli expression vector with an inducible promoter is utilized to promote tight, dose dependent regulation of the heterologous gene expression. The presence of N terminal and C terminal tags such as His-patch Thioredoxin, V5 epitope or 6xHis in the vector is useful for detection and purification of the protein. In addition, the presence of a thioredoxin fusion protein which is a component of the pBAD49 vector, can increase translation efficiency and, in some cases, solubility of eukaryotic proteins expressed in E. coli41. The different codon choices in Arabidopsis and E. coli could challenge protein expression in E. coli. It is known that codon optimization can impressively increase heterozygous proteins expression in E. coli42. In the vesicle assay, codon optimized AtBAT1.2 showed a higher exchange activity than non-codon optimized AtBAT1.1 in E. coli cells (data not shown), demonstrating that codon optimization was helpful to enhance the expression and function of heterologously expressed proteins in bacterial cells. The production of membrane vesicles by careful adjustment of the valve to maintain a slow even drip of lysed cells is also a key step in the procedure. After ultracentrifugation, we have found that resuspension of membrane vesicles in a Dounce homogenizer minimizes sample to sample variation between aliquots of membrane vesicles that are prepared and subsequently stored at -80 &#176;C.
A limitation of E. coli expression systems is that they are incapable of post-translational modifications such as N-glycosylation or acetylation. Absence of these protein modifications might impact protein activity1. However, mutants capable of performing these modifications have been identified and can be used as a tool to express proteins that require such modifications43. The generation of sufficient amounts of the expressed protein could be a challenge due to unfolding and aggregation as inclusion bodies, failure of the protein to be properly integrated in to the cytoplasmic membrane, mistargeting and mis-regulation due to lack of post translational modifications.
A minor limitation of this technique is that it does not provide evidence for the natural orientation of the transporter. This can be accomplished by taking advantage of the N or C terminal tags and immunological methods. The accessibility of a particular terminus of the protein in vesicles can be achieved by the digestion of all accessible, and therefore, presumably external termini of the carrier, electrophoresis of the protein in the presence of sodium dodecyl sulfate, transfer to nitrocellulose filters and detection of the remaining, internal termini with antibodies40.

Proteins involved in the trafficking of metabolites constitute an essential level of physiological regulation, but the vast majority of plant membrane transporters have not yet been functionally characterized. Several strategies have been implemented to characterize novel transport proteins. Heterologous expression in model organisms such as E. coli and eukaryotic cells such as yeast, Xenopus oocytes, mammalian cells, insect cells and plant cells have all been used to determine their transport activity1. Eukaryotic cells are favored for the expression of eukaryotic proteins, because the basic cellular composition, signal transducing pathways, transcription and translation machineries are compatible with the native conditions.
Yeast has been an important model organism for the characterization of novel transport proteins in plants. The first plant transport protein that was successfully expressed in yeast (Saccharomyces pombe) was the hexose transporter HUP1 from Chlorella2. Since then, many plant transport proteins have been functionally characterized using a yeast expression system. These include, plant sugar transporters (SUC1 and SUC23, VfSUT1 and VfSTP14) and the auxin transporters (AUX1 and PIN5). Disadvantages of utilizing yeast to express plant proteins can include impaired activity of plastid-localized proteins because yeast lacks this organelle, mistargeting6, and formation of misfolded aggregates and activation of stress responses in yeast due to overexpression of membrane proteins7,8,9.
Heterologous expression of transport proteins in Xenopus oocytes have been widely used for the electrophysiological characterization of transporters10. The first plant transport proteins characterized using heterologous expression in Xenopus oocytes were the Arabidopsis potassium channel KAT110 and the Arabidopsis hexose transporter STP111. Since then, Xenopus oocytes have been employed to characterize many plant transport proteins such as plasma membrane transporters12, vacuolar sucrose transporter SUT413 and vacuolar malate transporter ALMT914. An important limitation of Xenopus oocytes for transport assays is that the concentration of intracellular metabolites cannot be manipulated1. Moreover, professional knowledge is required to prepare Xenopus oocytes and the variability of the oocyte batches is difficult to control.
Heterologous expression in the model organism E. coli is an ideal system in terms of characterization of novel plant transport proteins. With a fully sequenced genome15, the molecular and physiological characteristics of E. coli are well known. Molecular tools and techniques are well established16. In addition, different expression vectors, non-pathogenic strains and mutants are available17,18,19. Furthermore, E. coli has a high growth rate and can be easily grown under laboratory conditions. Many proteins can be easily expressed and purified at high amounts in E. coli9. When proteins cannot be assayed directly in cellular systems, reconstitution of proteins into liposomes has also been a successful, albeit challenging innovation for the characterization of purified membrane proteins. Functional characterization of the plant mitochondrial transport proteins including solute transporters such as phosphate transporters in soybean, maize, rice and Arabidopsis, dicarboxylate-tricarboxylate carrier in Arabidopsis have been accomplished by using this model system20,21. However, recombinant proteins of the tomato protein SICAT9 were found to be nonfunctional in reconstitution experiments, and other members of the CAT transporter family were found to be nonfunctional in Xenopus oocyte assays22. Thus, additional molecular tools are needed for the characterization of membrane transporters.
Five polyamine transport systems are found in E. coli23. They include two ABC transporters mediating the uptake of spermidine and putrescine, a putrescine/ornithine exchanger, a cadaverine/lysine exchanger, a spermidine exporter and a putrescine importer. The putrescine exchanger PotE was originally characterized using a vesicle assay, where inside out vesicles were prepared by lysing cells with a French press and measuring the uptake of radiolabeled putrescine into the vesicles in exchange for ornithine24. Vesicle assays were also used to characterize a calcium transporter, which mediated the transport of calcium in response to a proton gradient25. These experiments prompted us to develop a strategy for the characterization of other polyamine exchangers. We first created a strain of E. coli deficient in PotE and CadB exchangers. Here, we demonstrate the functional characterization of a plant polyamine antiporter by heterlogous expression in the modified E. coli strain, generation of membrane vesicles using a French press, and radiolabeled assays.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>3H-putrescine</td>
			<td>PerkinElmer</td>
			<td>NET185001MC</td>
			<td></td>
		</tr>
		<tr>
			<td>3H-spermidine</td>
			<td>PerkinElmer</td>
			<td>NET522001MC</td>
			<td></td>
		</tr>
		<tr>
			<td>4-chloro-1-naphthol</td>
			<td>Sigma-Aldrich</td>
			<td>C8890</td>
			<td></td>
		</tr>
		<tr>
			<td>14C arginine</td>
			<td>Moravek Inc.</td>
			<td>MC137</td>
			<td></td>
		</tr>
		<tr>
			<td>Arginine</td>
			<td>Sigma-Aldrich</td>
			<td>A-5006</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-His (C-term)-HRP antibody</td>
			<td>ThermoFisher</td>
			<td>R931-25</td>
			<td>Detects the C-terminal polyhistidine (6xHis) tag, requires the free carboxyl 
			group for detection</td>
		</tr>
		<tr>
			<td>Arabinose</td>
			<td>Sigma-Aldrich</td>
			<td>A3256</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA protein assay kit</td>
			<td>ThermoFisher</td>
			<td>23227</td>
			<td>Pierce BCA protein asay kit.</td>
		</tr>
		<tr>
			<td>Bromophenol blue</td>
			<td>Bio-Rad</td>
			<td>161-0404</td>
			<td></td>
		</tr>
		<tr>
			<td>Carboxypeptidase B</td>
			<td>Sigma-Aldrich</td>
			<td>C9584-1mg</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Sorvall</td>
			<td></td>
			<td>SS-34 fixed angle rotor and GA-6 fixed angle rotor</td>
		</tr>
		<tr>
			<td>Dounce tissue grinder</td>
			<td>LabGenome</td>
			<td>7777-7</td>
			<td>Corning 7777-7 pyrex homogenizer with pour spout.</td>
		</tr>
		<tr>
			<td>Ecoscint-H</td>
			<td>National Diagnostics</td>
			<td>LS275</td>
			<td>scintillation cocktail</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Filtration manifold</td>
			<td>Hoefer</td>
			<td>FH225V</td>
			<td></td>
		</tr>
		<tr>
			<td>French Pressure Cell</td>
			<td>Glen Mills</td>
			<td>FA-080A120</td>
			<td></td>
		</tr>
		<tr>
			<td>GABA</td>
			<td>Sigma-Aldrich</td>
			<td>A2129</td>
			<td></td>
		</tr>
		<tr>
			<td>Glutamate</td>
			<td>Sigma-Aldrich</td>
			<td>G6904</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>GraphPad Prism software</td>
			<td></td>
			<td></td>
			<td><a href="http://www.graphpad.com/prism/Prism.htm" target="_blank">http://www.graphpad.com/prism/Prism.htm</a></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide</td>
			<td>KROGER</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>J.T. Baker</td>
			<td>3040-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Liquid scintillation counter</td>
			<td>Beckman</td>
			<td>LS-6500</td>
			<td></td>
		</tr>
		<tr>
			<td>Maleate</td>
			<td>Sigma-Aldrich</td>
			<td>M0375</td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop</td>
			<td>ThermoFisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose membrane filters</td>
			<td>Merck Millipore</td>
			<td>hawp02500</td>
			<td>0.45 &#181;M</td>
		</tr>
		<tr>
			<td>PCR clean up kit</td>
			<td>Genscript</td>
			<td></td>
			<td>QuickClean II</td>
		</tr>
		<tr>
			<td>Potassium Phosphate dibasic</td>
			<td>ThermoFisher</td>
			<td>P290-500</td>
			<td></td>
		</tr>
		<tr>
			<td>putrescine</td>
			<td>fluka</td>
			<td>32810</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Phosphate monobasic</td>
			<td>J.T.Baker</td>
			<td>4008</td>
			<td></td>
		</tr>
		<tr>
			<td>Spermidine</td>
			<td>Sigma-aldrich</td>
			<td>S2501</td>
			<td></td>
		</tr>
		<tr>
			<td>Strains :E. coli &#916;potE740(del)::kan, &#916;cadB2231::Tn10</td>
			<td>This manuscript</td>
			<td>Available upon request.</td>
			<td>Strain is deficient in the PotE and CadB polyamine exchangers.</td>
		</tr>
		<tr>
			<td>Tris-base</td>
			<td>Research Products</td>
			<td>T60040-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>Sorvall MTX 150</td>
			<td>46960</td>
			<td>Thermo Fisher S150-AT fixed angle rotor</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tubes</td>
			<td>ThermoFisher</td>
			<td>45237</td>
			<td>Centrifuge tubes for S150-AT rotor</td>
		</tr>
		<tr>
			<td>Vector: pBAD-DEST49</td>
			<td>ThermoFisher</td>
			<td></td>
			<td>Gateway expression vector for E. coli</td>
		</tr>
	</tbody>
</table>

characterization of membrane transporters by heterologous expression in e. coli and production of membrane vesicles

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine exchangers in plants have not been identified. Here, we outline a method to characterize polyamine antiporters using membrane vesicles generated from the lysis of Escherichia coli cells heterologously expressing a plant antiporter. First, we heterologously expressed AtBAT1 in an E. coli strain deficient in polyamine and arginine exchange transporters. Vesicles were produced using a French press, purified by ultracentrifugation and utilized in a membrane filtration assay of labeled substrates to demonstrate the substrate specificity of the transporter. These assays demonstrated that AtBAT1 is a proton-mediated transporter of arginine, &#947;-aminobutyric acid (GABA), putrescine and spermidine. The mutant strain that was developed for the assay of AtBAT1 may be useful for the functional analysis of other families of plant and animal polyamine exchangers. We also hypothesize that this approach can be used to characterize many other types of antiporters, as long as these proteins can be expressed in the bacterial cell membrane. E. coli is a good system for the characterization of novel transporters, since there are multiple methods that can be employed to mutagenize native transporters.

The major steps in this protocol are summarized pictorially in Figure 1. Briefly, E. coli cells deficient in all polyamine exchangers and expressing AtBAT1 are cultured, centrifuged, washed with a buffer and subjected to cell lysis using a French press. Lysis tends to produce vesicles that are mostly inside-out and trap the buffer outside the cells. Cell debris is removed by centrifugation, and a second ultracentifugation step is used to collect a membrane pellet. The membrane pellet is resuspended in Tris-Maleate buffer pH 5.2 and stored at -80 &#176;C. Transport assays are done at 12 &#176;C, which was found to be optimal for maintaining membrane stability. Assays are initiated by the addition of radiolabeled substrate and a shift in the pH of the buffer suspension of vesicles to pH 8.0. After 1 min, ice-cold assay buffer with unlabeled substrates is added to stop the uptake of the radiolabel into the vesicles. Radiolabelled vesicles are trapped by filtration through nitrocellulose membranes. Membranes are transferred to scintillation vials and radiolabel on the membranes is determined by liquid scintillation counting.
A western blot is used to verify that AtBAT1 is translocated to vesicles (Figure 2). Probing the blot with an Anti-His C-terminal antibody revealed a fusion construct protein of approximately 72.3 kDa (Figure 2, Lane 2). Digestion of the vesicles prior to SDS-PAGE resulted in a dimunition, but not a complete loss of the probe signal (Figure 2, lane 3). The decrease in the probe signal as a consequence of carboxypeptidase A suggests that most of the C-terminal residues are on the outside of the vesicles.
In this assay system, vesicles are suspended in a buffer at pH 5.2 so that the pH inside the vesicles equilibrates with the buffer. Transport of the radiolabeled substrate into the vesicles at pH 5.2 is initiated by suspending the vesicles in a pH 8.0 buffer, thus creating a pH gradient of pH 2.8 across the membrane. At 12 &#176;C, uptake of radiolabeled spermidine by the vesicles was highest at 1 min, and remained linear over 3 min (Figure 3A). Therefore, the incubation time for the transport assay was fixed at 1 min. To account for non-specific binding of radiolabel, the vesicles were incubated at 0 &#176;C in the presence of radiolabeled substrate for one minute, and these counts were subtracted from uptake of ladiolabel at higher temperatures.
Figure 3B shows the uptake of radiolabeled spermidine into the vesicles after one minute. There was no net uptake of isotope by membrane vesicles that were prepared and stored at pH 8.0, as there was no proton gradient across the vesicle membrane. To demonstrate the effect of dissipation of the artificial proton gradient, the membrane vesicles were incubated in pH 8.0 buffer for 10 min prior to the addition of labelled substrate25. Under these conditions, a minimal uptake of radiolabeled substrate was shown. Uptake of radiolabeled spermidine was also minimal in vesicles prepared with E. coli cells deficient in the polyamine exchangers CadB and PotE. Taken together, these results indicate that the proton driven uptake of spermidine was due to the BAT1 protein (Figure 3A,B).
To determine the substrate specificity of the protein, Km values were calculated by measuring the uptake of radiolabeled substrate at 10, 25, 50, 100, 250 and 500 &#956;M concentrations. The Km for spermidine, putrescine and arginine were 55 &#177; 12 &#956;M, 85 &#177; 20 &#956;M and 1.4 &#177; 0.5 mM, respectively, indicating that this protein is a high affinity polyamine and arginine exchanger (Figure 4).
Affinity of the transporter for a particular substrate can also be determined indirectly by using competition assays. Here, we have utilized two methods to evaluate the competition between two substrates. In the first method, the uptake of 50 &#956;M radiolabeled spermidine was measured in the presence of increasing concentrations of the nonlabelled competing substrate (Figure 5A). In the second method, the apparent Km for spermidine was calculated by measuring the uptake of increasing concentrations of radiolabeled spermidine in the presence of 100 &#956;M nonlabelled competing substrate (Figure 5B). Competition assays revealed that GABA is a competitive inhibitor of spermidine with a Km,app of 164 &#177; 15 &#956;M (Figure 5A,B). Furthermore, measuring the uptake of 50 &#956;M radiolabeled spermidine in the presence of varying concentrations of different amino acids revealed that AtBAT1 is also capable of transporting glutamate and alanine at mM concentrations (Figure 6).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60009/60009fig1a.jpg" /> 
Figure 1: Schematic representation of the method. (A) Schematic representation outlining key steps in the preparation and purification of membrane vesicles from E. coli. (B) Schematic representation outlining key steps in transport assay of membrane vesicle preparations using radiolabeled substrates. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60009/60009fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60009/60009fig2a.jpg" /> 
Figure 2: Western blot showing expression of AtBAt1 in purified vesicles. Bands were visualized using horseradish peroxidase conjugated anti-His (C-term)-HRP antibody. Lane 1, Prestained protein ladder. Lane 2, Purified vesicles expressing AtBAT1.1 showing a band of the expected size of the fusion protein. Lane 3, purified vesicles expressing AtBAT1.1 were pretreated with carboxypeptidase A prior to SDS electrophoresis and western blotting. Equivalent amounts of vesicles (protein) were added to each lane. Decreased staining indicates that the C-terminal of the protein in most vesicles is degraded by by protease digestion. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60009/60009fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60009/60009fig3a.jpg" /> 
Figure 3: Transport activity of vesicles showing the effect of BAT1 protein expression and the importance of a pH gradient. (A) Time dependent uptake of 3H labeled spermidine in vesicles expressing BAT1 with an internal pH of 5.2 and introduced to a buffer at pH 8.0. In the control assay, the vesicles were added to the assay buffer at pH 8.0, 10 min prior to the addition of 3H labeled spermidine to enable dissipation of the proton gradient. Then uptake of radiolabel into the vesicles was assessed over a 1 min interval. (B) Uptake of 3H labeled spermidine in the presence of a proton gradient (internal pH of 5.2), in the absence of a proton gradient (internal pH of 8), in vesicles added to the assay solution 10 min prior to the addition of radiolabeled spermidine and in vesicles made from E. coli mutant cells not expressing BAT1. Uptake into vesicles was monitored for 1 min. All values are presented as mean &#177; SE of five replicates. Data analysis was performed using a student&#39;s t-test and * indicates a significant difference from the control (p value &#60; 0.05). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60009/60009fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60009/60009fig4a.jpg" /> 
Figure 4: In vitro assays of polyamine and arginine transport activity of BAT1. (A) The Km values for spermidine and putrescine uptake are 55 &#177; 12 &#956;M and 85 &#177; 32 &#956;M respectively. (B)The Km for arginine uptake is 1.4 &#177; 0.5 mM. All values are presented as mean &#177; SE of five replicates. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60009/60009fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/60009/60009fig5a.jpg" /> 
Figure 5: GABA is a competitive inhibitor of Spermidine transport by BAT1. (A) Uptake of 3H labeled spermidine by vesicles expressing AtBAT1.1 was significantly reduced in the presence of 100 &#956;M or 500 &#956;M GABA. (B) Apparent Km for spermidine uptake by BAT1.1 was increased to 164 &#177; 20 &#956;M in the presence of 100 &#956;M GABA. All values are presented as mean &#177; SE of five replicates. Data analysis was performed using a student&#39;s t-test and * indicates a significant difference from the control (p value &#60; 0.05). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60009/60009fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/60009/60009fig6a.jpg" /> 
Figure 6: Glutamate and alanine are competitive inhibitors of spermidine transportby BAT1. Spermidine uptake was significantly reduced in the presence of 1 mM non-labeled glutamate and 1.5 mM non-labeled alanine. All values are presented as mean &#177; SE of five replicates. Data analysis was performed using a student&#39;s t-test and * indicates a significant difference from the control (p value &#60; 0.05). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60009/60009fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles at JoVE.com

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

We describe a method for the characterization of proton-driven membrane transporters in membrane vesicle preparations produced by heterologous expression in E. coli and lysis of cells using a French press.

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine ...

characterization-membrane-transporters-heterologous-expression-e-coli

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biochemistry

Cell Biology

Anatomy and Physiology

Unit 1

Cell Membrane Structure and Functions

Membrane Structure and Components

SCIENTISTS IN ACTION

9.2K Views.  Bowling Green State University. We describe a method for the characterization of proton-driven membrane transporters in membrane vesicle preparations produced by heterologous expression in E. coli and lysis of cells using a French press.

Video: Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Using Scaffold Liposomes to Reconstitute Lipid-proximal Protein-protein Interactions In Vitro

Studies of integral membrane proteins in vitro are frequently complicated by the presence of a hydrophobic transmembrane domain. Further complicating these studies, reincorporation of detergent-solubilized membrane proteins into liposomes is a stochastic process where protein topology is impossible to enforce. This paper offers an alternative method to these challenging techniques that utilizes a liposome-based scaffold. Protein solubility is enhanced by deletion of the transmembrane domain, and these amino acids are replaced with a tethering moiety, such as a His-tag. This tether interacts with an anchoring group (Ni2+ coordinated by nitrilotriacetic acid (NTA(Ni2+)) for His-tagged proteins), which enforces a uniform protein topology at the surface of the liposome. An example is presented wherein the interaction between Dynamin-related protein 1 (Drp1) with an integral membrane protein, Mitochondrial Fission Factor (Mff), was investigated using this scaffold liposome method. In this work, we have demonstrated the ability of Mff to efficiently recruit soluble Drp1 to the surface of liposomes, which stimulated its GTPase activity. Moreover, Drp1 was able to tubulate the Mff-decorated lipid template in the presence of specific lipids. This example demonstrates the effectiveness of scaffold liposomes using structural and functional assays and highlights the role of Mff in regulating Drp1 activity.

Using Scaffold Liposomes to Reconstitute Lipid-proximal Protein-protein Interactions In Vitro

This paper describes a method for assessing the interactions and assemblies of integral membrane proteins in vitro with various partner factors in a lipid-proximal environment.

Studies of integral membrane proteins in vitro are frequently complicated by the presence of a hydrophobic transmembrane domain. Further complicating ...

Method to Visualize and Analyze Membrane Interacting Proteins by Transmission Electron Microscopy

Monotopic proteins exert their function when attached to a membrane surface, and such interactions depend on the specific lipid composition and on the availability of enough area to perform the function. Nanodiscs are used to provide a membrane surface of controlled size and lipid content. In the absence of bound extrinsic proteins, sodium phosphotungstate-stained nanodiscs appear as stacks of coins when viewed from the side by transmission electron microscopy (TEM). This protocol is therefore designed to intentionally promote stacking; consequently, the prevention of stacking can be interpreted as the binding of the membrane-binding protein to the nanodisc. In a further step, the TEM images of the protein-nanodisc complexes can be processed with standard single-particle methods to yield low-resolution structures as a basis for higher resolution cryoEM work. Furthermore, the nanodiscs provide samples suitable for either TEM or non-denaturing gel electrophoresis. To illustrate the method, Ca2+-induced binding of 5-lipoxygenase on nanodiscs is presented.

Many proteins perform their function when attached to membrane surfaces. The binding of extrinsic proteins on nanodisc membranes can be indirectly imaged by transmission electron microscopy. We show that the characteristic stacking (rouleau) of nanodiscs induced by the negative stain sodium phosphotungstate is prevented by the binding of extrinsic protein.

Monotopic proteins exert their function when attached to a membrane surface, and such interactions depend on the specific lipid composition and on the ...

High Precision FRET at Single-molecule Level for Biomolecule Structure Determination

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule level in multiparameter fluorescence detection (MFD) mode is presented here. MFD maximizes the usage of all &#34;dimensions&#34; of fluorescence to reduce photophysical and experimental artifacts and allows for the measurement of interdye distance with an accuracy up to ~1 &#197; in rigid biomolecules. This method was used to identify three conformational states of the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor to explain the activation of the receptor upon ligand binding. When comparing the known crystallographic structures with experimental measurements, they agreed within less than 3 &#197; for more dynamic biomolecules. Gathering a set of distance restraints that covers the entire dimensionality of the biomolecules would make it possible to provide a structural model of dynamic biomolecules.

A protocol for high-precision FRET experiments at the single molecule level is presented here. Additionally, this methodology can be used to identify three conformational states in the ligand-binding domain of the N-methyl-D-aspartate (NMDA) receptor. Determining precise distances is the first step towards building structural models based on FRET experiments.

A protocol on how to perform high-precision interdye distance measurements using F&#246;rster resonance energy transfer (FRET) at the single-molecule ...

Measuring Trans-Plasma Membrane Electron Transport by C2C12 Myotubes

Trans-plasma membrane electron transport (tPMET) plays a role in protection of cells from intracellular reductive stress as well as protection from damage by extracellular oxidants. This process of transporting electrons from intracellular reductants to extracellular oxidants is not well defined. Here we present spectrophotometric assays by C2C12 myotubes to monitor tPMET utilizing the extracellular electron acceptors: water-soluble tetrazolium salt-1 (WST-1) and 2,6-dichlorophenolindophenol (DPIP or DCIP). Through reduction of these electron acceptors, we are able to monitor this process in a real-time analysis. With the addition of enzymes such as ascorbate oxidase (AO) and superoxide dismutase (SOD) to the assays, we can determine which portion of tPMET is due to ascorbate export or superoxide production, respectively. While WST-1 was shown to produce stable results with low background, DPIP was able to be re-oxidized after the addition of AO and SOD, which was demonstrated with spectrophotometric analysis. This method demonstrates a real-time, multi-well, quick spectrophotometric assay with advantages over other methods used to monitor tPMET, such as ferricyanide (FeCN) and ferricytochrome c reduction.

The goal of this protocol is to spectrophotometrically monitor trans-plasma membrane electron transport utilizing extracellular electron acceptors and to analyze enzymatic interactions that may occur with these extracellular electron acceptors.

Trans-plasma membrane electron transport (tPMET) plays a role in protection of cells from intracellular reductive stress as well as protection from damage ...

Characterization of Glycoproteins with the Immunoglobulin Fold by X-Ray Crystallography and Biophysical Techniques

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of these glycoproteins possess immunoglobulin (Ig) folds and are central to immune recognition and regulation. Here, we present a platform for the design, expression and biophysical characterization of the extracellular domain of human B cell receptor CD22. We propose that these approaches are broadly applicable to the characterization of mammalian glycoprotein ectodomains containing Ig domains. Two suspension human embryonic kidney (HEK) cell lines, HEK293F and HEK293S, are used to express glycoproteins harbouring complex and high-mannose glycans, respectively. These recombinant glycoproteins with different glycoforms allow investigating the effect of glycan size and composition on ligand binding. We discuss protocols for studying the kinetics and thermodynamics of glycoprotein binding to biologically relevant ligands and therapeutic antibody candidates. Recombinant glycoproteins produced in HEK293S cells are amenable to crystallization due to glycan homogeneity, reduced flexibility and susceptibility to endoglycosidase H treatment. We present methods for soaking glycoprotein crystals with heavy atoms and small molecules for phase determination and analysis of ligand binding, respectively. The experimental protocols discussed here hold promise for the characterization of mammalian glycoproteins to give insight into their function and investigate the mechanism of action of therapeutics.

We present approaches for the biophysical and structural characterization of glycoproteins with the immunoglobulin fold by biolayer interferometry, isothermal titration calorimetry, and X-ray crystallography.

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of ...

Analysis of Thylakoid Membrane Protein Complexes by Blue Native Gel Electrophoresis

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded in the thylakoid membrane harvest solar energy to drive electrons from water to NADP+ via two photosystems, and use the created proton gradient for production of ATP. Photosystem PSII, PSI, cytochrome b6f (Cyt b6f) and ATPase are all multiprotein complexes with distinct orientation and dynamics in the thylakoid membrane. Valuable information about the composition and interactions of the protein complexes in the thylakoid membrane can be obtained by solubilizing the complexes from the membrane integrity by mild detergents followed by native gel electrophoretic separation of the complexes. Blue native polyacrylamide gel electrophoresis (BN-PAGE) is an analytical method used for the separation of protein complexes in their native and functional form. The method can be used for protein complex purification for more detailed structural analysis, but it also provides a tool to dissect the dynamic interactions between the protein complexes. The method was developed for the analysis of mitochondrial respiratory protein complexes, but has since been optimized and improved for the dissection of the thylakoid protein complexes. Here, we provide a detailed up-to-date protocol for analysis of labile photosynthetic protein complexes and their interactions in Arabidopsis thaliana.

A protocol for the elucidation of plant thylakoid protein complex organization and composition with blue native polyacrylamide gel electrophoresis (BN-PAGE) and 2D-SDS-PAGE is described. The protocol is optimized for Arabidopsis thaliana, but can be used for other plant species with minor modifications.

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded ...

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Expression, Solubilization, and Purification of Eukaryotic Borate Transporters

The Solute Carrier 4 (SLC4) family of proteins is called the bicarbonate transporters and includes the archetypal protein Anion Exchanger 1 (AE1, also known as Band 3), the most abundant membrane protein in the red blood cells. The SLC4 family is homologous with borate transporters, which have been characterized in plants and fungi. It remains a significant technical challenge to express and purify membrane transport proteins to homogeneity in quantities suitable for&#160;structural or functional studies. Here we describe detailed procedures for the overexpression of borate transporters in Saccharomyces cerevisiae, isolation of yeast membranes, solubilization of protein by detergent, and purification of borate transporter homologs from S. cerevisiae, Arabidopsis thaliana, and Oryza sativa. We also detail a glutaraldehyde cross-linking experiment to assay multimerization of homomeric transporters. Our generalized procedures can be applied to all three proteins and have been optimized for efficacy. Many of the strategies developed here can be utilized for the study of other challenging membrane proteins.

Here we present a protocol to express, solubilize, and purify several eukaryotic borate transporters with homology to the SLC4 transporter family using yeast. We also describe a chemical cross-linking assay to assess the purified homomeric proteins for multimeric assembly. These protocols can be adapted for other challenging membrane proteins.

The Solute Carrier 4 (SLC4) family of proteins is called the bicarbonate transporters and includes the archetypal protein Anion Exchanger 1 (AE1, also ...

Interactions with and Membrane Permeabilization of Brain Mitochondria by Amyloid Fibrils

A growing body of evidence indicates that membrane permeabilization, including internal membranes such as mitochondria, is a common feature and primary mechanism of amyloid aggregate-induced toxicity in neurodegenerative diseases. However, most reports describing the mechanisms of membrane disruption are based on phospholipid model systems, and studies directly targeting events occurring at the level of biological membranes are rare. Described here is a model for studying the mechanisms of amyloid toxicity at the membrane level. For mitochondrial isolation, density gradient medium is used to obtain preparations with minimal myelin contamination. After mitochondrial membrane integrity confirmation, the interaction of amyloid fibrils arising from &#945;-synuclein, bovine insulin, and hen egg white lysozyme (HEWL) with rat brain mitochondria, as an in vitro biological model, is investigated. The results demonstrate that treatment of brain mitochondria with fibrillar assemblies can cause different degrees of membrane permeabilization and ROS content enhancement. This indicates structure-dependent interactions between amyloid fibrils and mitochondrial membrane. It is suggested that biophysical properties of amyloid fibrils and their specific binding to mitochondrial membranes may provide explanations for some of these observations.

Provided here is a protocol for investigating the interactions between native form, prefibrillar, and mature amyloid fibrils of different peptides and proteins with mitochondria isolated from different tissues and various areas of the brain.

A growing body of evidence indicates that membrane permeabilization, including internal membranes such as mitochondria, is a common feature and primary ...