VirWaTest was a research project funded by the HIF (Humanitarian Innovation Funds) program of ELHRA (Enhancing Learning &#38; Research for Humanitarian Assistance). The authors acknowledge the WASH teams who kindly collaborated in this study. The analysis of samples in Ecuador was funded by Oxfam Ecuador and Direcci&#243;n de Investigaciones de la Universidad de las Americas (AMB.BRT.17.01). S. Bofill-Mas is a Serra-Hunter fellow at the University of Barcelona.

1. Preparation and packaging
NOTE: The materials/equipment to be packed is listed in Table 1. Use gloves to handle the reagents required for the process control, the concentration reagents, the nucleic acid extraction reagents&#160;and the&#160;detection reagents. Wear protective glasses to handle the reagents required for nucleic acid extraction.
<ol>
	<li>Process control
	<ol>
		<li>Prepare MS2 bacteriophage stock culture (American Type Culture Collection [ATCC] 15597-B1) containing 1 x 1010 PFU/mL in the laboratory by following the ISO procedure 10705-1:199514.</li>
		<li>Then, aliquot 10 &#181;L of the suspension per tube containing 1 x 108 PFU into 10 mL tubes and let the water evaporate at 37 &#176;C. Use one tube per water sample.</li>
		<li>Additionally, prepare one tube containing 10 mL of sterile distilled water per collected sample.</li>
	</ol>
	</li>
	<li>Concentration reagents
	<ol>
		<li>For the preflocculated skimmed milk solution (PSM), use the following amounts to concentrate five 10 L water samples.
		<ol>
			<li>Prepare a plastic tube containing 5 g of skimmed milk.</li>
			<li>Prepare a zipper plastic bag containing 16.66 g of sea salts.</li>
			<li>Prepare a plastic bottle containing 500 mL of distilled water.</li>
		</ol>
		</li>
		<li>Prepare the reagents required for pH adjustment. Use the following amounts to adjust the pH of the PSM and of five 10 L water samples.
		<ol>
			<li>Add 5 g of citric acid 1-hydrate to a 10 mL plastic tube. 
			CAUTION: Citric acid causes serious irritation when it comes in contact with eyes. If this occurs, rinse the eye cautiously with water for several minutes. If irritation persists, seek medical advice.</li>
			<li>Put 2 g of sodium hydroxide into a 10 mL plastic tube. 
			CAUTION: Sodium hydroxide can cause severe skin burns and eye damage. If swallowed, rinse the mouth. Do not induce vomiting. If it comes in contact with the eyes, rinse cautiously with water for several minutes. Then, seek medical advice.</li>
			<li>Put 25 mL of sterile distilled water into a plastic container.</li>
			<li>Put 50 mL of sterile distilled water into a plastic container.</li>
		</ol>
		</li>
		<li>Prepare the sample conditioning sachet used for the flocculation, the preservative solution used to preserve the nucleic acids, and the neutralizing sachet to neutralize the discarded water and materials. Use the following amounts for each 10 L water sample to be tested.
		<ol>
			<li>Put 15 g of sea salts and 8 g of citric acid 1-hydrate into a zipper plastic bag for the conditioning sachet.</li>
			<li>Add 2 mL of lysis buffer (Table of Materials) and 0.3 mL of nucleic acid preserving agent (Table of Materials) to a 5 mL tube. 
			CAUTION: Lysis buffer contains guanidine thiocyanate and Triton X-100. Contact with acid liberates toxic gas, and it is harmful if swallowed, inhaled, or comes in contact with the skin. If swallowed, rinse the mouth. Do not induce vomiting. If it comes in contact with the skin, wash with plenty of water. Then, seek medical advice. Nucleic acid preserving agent causes skin and eye irritation and is harmful if swallowed. If it comes in contact with the skin or the eyes, rinse with abundant water for several minutes. In any case, especially if swallowed and feeling unwell, seek medical advice.</li>
			<li>Put 40 g of detergent powder into four zipper plastic bags. 
			CAUTION: Powder detergent causes eye irritation. If it comes in contact with the eyes, rinse with abundant water for several minutes. If irritation persists or if swallowed, seek medical advice.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Nucleic acid extraction reagents
	<ol>
		<li>Put 50 &#181;L of magnetic particles (Table of Materials) and 1 mL of ethanol 96% into a 5 mL tube which constitute the Binding Buffer. 
		CAUTION: The magnetic particles buffer contains sodium azide, which forms a toxic gas when it comes in contact with acids or heavy metal ions and is toxic if ingested or when it comes in contact with skin. If ingested or in contact with skin, rinse the mouth or the skin with abundant water and seek medical advice. Ethanol is a highly flammable liquid and vapor and causes serious eye irritation. Keep away from heat, hot surfaces, sparks, and any other ignition source. If it comes in contact with the skin or the eyes, rinse with abundant water. In case of ingestion of large amounts of water and/or if inhaled, go outside into the fresh air. In any case, seek medical advice.</li>
		<li>Add 500 &#181;L, 600 &#181;L, and 200 &#181;L of washing buffers 1, 2, and 3, respectively (Table of Materials), to three 2 mL tubes. 
		CAUTION: Washing buffers contain guanidinium thiocyanate and guanidinium chloride, which are harmful if inhaled or swallowed and irritate the skin and eyes. Contact with acids releases very toxic gas. If they come in contact with the skin or eyes, rinse with abundant water. If swallowed, rinse the mouth with abundant water. Do not induce vomiting. Always seek medical advice.</li>
		<li>Add 120 &#181;L of elution buffer (Table of Materials) to a 0.5 mL tube.</li>
	</ol>
	</li>
	<li>HAdV and MS2 detection reagents 
	NOTE: Two different nucleic acid extraction reactions may be analyzed simultaneously in each PCR assay if an 8-well thermocycler is used. For all PCR assays, prepare molecular biology water aliquoted into 1.5 mL tubes.
	<ol>
		<li>HAdV detection
		<ol>
			<li>Prepare a mix containing 10 &#181;L of 22.5 &#181;M AdF forward primer, 10 &#181;L of 22.5 &#181;M AdR reverse primer, and 5 &#181;L of 11.25 &#181;M AdP probe (Table 2).</li>
			<li>Add 2.5 &#181;L of the mix to tubes 1 to 8 of a tube strip. Let it dry at room temperature, close the tubes, and keep them protected from the light.</li>
			<li>Cut the strip dividing it into two strips: tubes 1-5 and tubes 6-8.</li>
			<li>Prepare a serial dilution of DNA suspensions containing the nucleotide sequence of the amplified HAdV region. Air-dry 1 &#181;L of suspensions containing 1 x 105, 1 x 107, and 1 x 109 GC/mL into tubes 6-8. 
			NOTE: Keep the tubes containing the primers, probe, and the air-dried suspensions protected from light.</li>
		</ol>
		</li>
		<li>MS2 detection
		<ol>
			<li>Prepare a mix containing 10 &#181;L of 25 &#181;M pecson-2F forward primer, 10 &#181;L of 25 &#181;M pecson-2R reverse primer, and 2.5 &#181;L of 25 &#181;M PecP-2 probe (Table 2).</li>
			<li>Add 2.25 &#181;L of the mix to tubes 1 to 8 of a tube strip. Let it dry at room temperature, close the tubes, and keep them protected from the light.</li>
			<li>Cut the strip dividing it into two strips: tubes 1-5 and tubes 6-8.</li>
			<li>Proceed as in step 1.4.1.4 but use a standard suspension designed for MS2 instead.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Viral concentration
NOTE: Use gloves at all times during the sample collection, reagent preparation, flocculation, flocs collection, and waste disposal procedures. Wear protective glasses during the reagent preparation procedure.
<ol>
	<li>Sample collection
	<ol>
		<li>Collect a 10 L water sample in a flat bottom bucket with a lid. Collect a minimum of two replicates for each sample. 
		NOTE: It is important to use clear buckets to visualize the pellet. If the water sample contains suspended material (e.g., sand, algae), let it sediment and, then, collect the water supernatant in a new bucket.</li>
		<li>Register the collected volume, as well as the location and collection date, for each water sample.</li>
		<li>Put a magnetic stirrer connected to a battery under a bucket support and place the bucket containing the water sample on its support. 
		NOTE: Look for a flat surface in a fresh place and keep the buckets containing the water samples from direct sunlight.</li>
	</ol>
	</li>
	<li>Reagents preparation
	<ol>
		<li>pH adjustment reagents
		<ol>
			<li>Pour the citric acid powder and the sodium hydroxide pellets into the pots containing 25 and 50 mL of distilled water, respectively.</li>
			<li>Gently shake by hand until the citric acid and the sodium hydroxide are completely dissolved. 
			CAUTION: Do not pour the water over the sodium hydroxide pellets. Instead, pour the sodium hydroxide pellets over the water.</li>
		</ol>
		</li>
		<li>Preflocculated skimmed milk
		<ol>
			<li>Place a stand-up bag on a magnetic stirrer and pour 500 mL of distilled water in it. Drop a stirring magnet inside the bag and turn on the magnetic stirrer.</li>
			<li>Pour the contents of a sea salt sachet and of a skimmed milk tube into the stand-up bag and stir for 5 min at medium speed to dissolve them.</li>
			<li>Add 3 mL of citric acid to the PSM solution using a Pasteur pipette to make sure the pH lies between 3.4 and 3.6. Measure the pH of the PSM solution using pH indicator strips. Add smaller amounts of citric acid and sodium hydroxide as the pH gets closer to 3.5.</li>
			<li>Turn off the magnetic stirrer and make sure the flocs are visible. Use a flashlight to help to visualize the flocs.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Flocculation
	<ol>
		<li>Drop a stirring magnet into the water, set the magnetic stirrer at maximum speed, and turn it on. Make sure the stirring magnet starts spinning.</li>
		<li>Add 10 mL of distilled water to a process control tube. Invert the tube a few times to rehydrate the viral stock and pour the solution into the water.</li>
		<li>Pour the contents of one sample conditioning sachet into the water and stir for 5 min.</li>
		<li>Measure the pH of the water sample using pH indicator strips. Add a few drops of citric acid or sodium hydroxide to the water sample to make sure the pH lies between 3.4 and 3.6. Add smaller amounts of citric acid and sodium hydroxide as the pH gets closer to 3.5.</li>
		<li>Add 100 mL of the PSM solution using a 100 mL container.</li>
		<li>Seal the bucket with the lid, set the magnetic stirrer at minimum speed, and leave the water stirring for 8 h.</li>
		<li>Turn off the magnetic stirrer and let the water still for at least 5 h to allow the flocs to settle.</li>
	</ol>
	</li>
	<li>Floc&#160;collection
	<ol>
		<li>Build a siphoning system composed of a pipette controller, two pipettes, and a plastic tube, to aspirate the water supernatant for discharging the water on the flocs.
		<ol>
			<li>Attach a 10 mL tape-end pipette to the pipette controller. Then, attach the tip of the pipette to the plastic tube.</li>
			<li>Remove the filter of a 10 mL open-tip pipette using tweezers and attach the pipette to the plastic tube.</li>
		</ol>
		</li>
		<li>Place an empty bucket on the floor.</li>
		<li>Immerse the tip of the open-tip pipette in the water. Make sure to keep it close to the water surface to avoid disturbing the flocs. Aspirate the water supernatant until it reaches the tape-end pipette.</li>
		<li>Pinch the plastic tube by the end attached to the tape-end pipette and detach it from the pipette.</li>
		<li>Place the tube in an empty bucket. Release the pressure on the tube to let the water flow into the empty bucket.</li>
		<li>Pinch the plastic tube to stop the water flow when the water level is about to reach the stirring magnet and move the pipette away from the bucket.</li>
		<li>Shake the bucket to resuspend the flocs and pour them into a 500 mL stand-up plastic bag. Allow the flocs to settle for 1 h more.</li>
		<li>Carefully aspirate the water supernatant using a 50 mL pipette and a manual pipette controller, avoiding disturbing the flocs.</li>
		<li>Aspirate the flocs using a 100 mL pipette and transfer them to a 50 mL graduated centrifuge tube. Note down the final volume of sample concentrate and transfer 1 mL of it to a 5 mL tube containing the preservative solution, using a Pasteur pipette. 
		NOTE: It is important that the centrifuge tube is graduated so the final volume of the concentrated sample can be measured as accurately as possible and registered.</li>
		<li>Perform the nucleic acid extraction in the field. Alternatively, store the preservative solution containing the viruses at 20-30 &#176;C for up to 15 days or ship them to a reference laboratory for further analysis.</li>
	</ol>
	</li>
	<li>Waste disposal and material reuse
	<ol>
		<li>Add the contents of a neutralizing agent sachet to the bucket containing the discarded water. Mix the water, and then, leave it still for 30 min.</li>
		<li>Dispose of the treated water as general waste.</li>
		<li>Place the pipettes and the plastic tube inside the bucket. Fill the bucket with water and pour in the contents of one neutralizing agent sachet.</li>
		<li>Wash them for at least 30 min to sterilize them and rinse them with abundant clean water to remove any remaining neutralizing agent.</li>
	</ol>
	</li>
</ol>
3. Nucleic acid extraction
NOTE: Use gloves and always wear protective glasses during the nucleic acid extraction procedure.
<ol>
	<li>Magnetic pipette operation
	<ol>
		<li>Get familiarized with the operation of the magnetic pipette before performing the extraction.</li>
	</ol>
	</li>
	<li>Nucleic acid extraction
	<ol>
		<li>Arrange the tubes containing the reagents required for the extraction in a rack, from left to right: binding buffer, washing buffers, and elution buffer. Set the appropriate number of tubes according to the number of samples or replicates being analyzed.</li>
		<li>Transfer 1 mL of sample concentrate to the tube containing the binding buffer, using a disposable Pasteur pipette. Invert the tube 8x to 10x to homogenize the solution.</li>
		<li>Incubate the solution at room temperature for 10 min while continuously mixing, either using a solar-powered orbital or manually.</li>
		<li>Collect the magnetic particles using the magnetic pipette and a clean tip, which can be reused for the three washing buffers.</li>
		<li>Release the magnetic particles into the tube containing 500 &#181;L of washing buffer 1. Wash them by gently shaking the solution with the tip for 30 s and collect them.</li>
		<li>Transfer the magnetic particles to the tube containing 600 &#181;L of washing buffer 2. Wash them by gently shaking the solution with the tip for 30 s and collect them.</li>
		<li>Transfer the magnetic particles to the tube containing 200 &#181;L of washing buffer 3. Wash them by gently shaking the solution with the tip for 30 s and collect them.</li>
		<li>Release the magnetic particles into the tube containing the elution buffer and discard the tip.</li>
		<li>Incubate the solution at room temperature for 5 min while continuously mixing, using the solar-powered orbital. 
		NOTE: Mixing the magnetic particles in the elution buffer is a crucial step. In case of lacking an orbital, continuously mix by hand during the incubation time.</li>
		<li>Replace the tip on the magnetic pipette by a new one and collect the magnetic particles from the elution buffer. Make sure to completely remove the magnetic particles from the elution buffer since they can interfere with molecular detection methods.</li>
		<li>Discard the tip with the particles attached to it. Proceed with the PCR analysis, ship the elution buffer to a reference laboratory, or store the elution buffer in at 4 &#730;C for further analysis.</li>
	</ol>
	</li>
</ol>
4. Viral detection with a battery-operated eight-tube real-time thermocycler
NOTE: Use gloves and always wear protective glasses during the nucleic acid detection procedure. Replace the gloves for new ones when performing a new PCR experiment to avoid cross-contamination.
<ol>
	<li>HAdV quantitative PCR
	<ol>
		<li>Add 14 &#181;L of nuclease-free water to tubes 2, 4, and 5.</li>
		<li>Add 4 &#181;L of PCR mix to tubes 1-5.</li>
		<li>Add 14 &#181;L of nucleic acid extraction from sample A to tube 1 and 14 &#181;L from sample B to tube 3.</li>
		<li>Add 2 &#181;L of extracted nucleic acids from sample A to tube 2 and 2 &#181;L from sample B to tube 4. Close the five-tube strip.</li>
		<li>Add 14 &#181;L of nuclease-free water to tubes 6, 7, and 8.</li>
		<li>Add 4 &#181;L of this mix to tubes 6, 7, and 8, and close them.</li>
		<li>Put both strips in the thermocycler and select the appropriate run (Table 3).</li>
		<li>Discard the water tube and keep the extracted nucleic acid in the freezer, if possible, or, if not, in a fresh place protected from light in case a second test needs to be performed.</li>
		<li>Clean the micropipettes, the rack, the working material, and all material properly with a nucleic acid cleaner, and discard the plastic bag containing the used tip, gloves, and tubes. 
		CAUTION: Nucleic acid remover is a very flammable liquid and steam. Do not breathe in the spray mist and avoid any contact of the liquid with the eyes or the skin. Otherwise, immediately rinse with abundant water and seek medical advice.</li>
		<li>Collect the results and analyze the obtained data.</li>
	</ol>
	</li>
	<li>MS2 quantitative PCR
	<ol>
		<li>Add 14 &#181;L of nuclease-free water to tubes 2, 4, and 5.</li>
		<li>Add 4 &#181;L of PCR mix and 0.5 &#181;L of reverse transcriptase enzyme to tubes 1-5.</li>
		<li>Add 14 &#181;L of nucleic acid extraction from sample A to tube 1 and 14 &#181;L from sample B to tube 3.</li>
		<li>Add 1 &#181;L of extracted nucleic acids from sample A to tube 2 and 1 &#181;L from sample B to tube 4. Close the five-tube strip.</li>
		<li>Add 15.5 &#181;L of nuclease-free water to tubes 5, 6, 7, and 8, and close them.</li>
		<li>Add 4 &#181;L of PCR mix and 0.5 &#181;L of reverse transcriptase enzyme to tubes 6, 7, and 8.</li>
		<li>Put both strips in the thermocycler and select the appropriate run (Table 3).</li>
		<li>Proceed as described in steps 4.1.8 to 4.1.10.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>The Sphere Project. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Sphere Project: Humanitarian Charter and Minimum Standards in Humanitarian Response. , (2011).</li><li>Bartram, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Water Safety Plan Manual:Step-by-step risk management for drinking-water suppliers. , (2009).</li><li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guidelines for Drinking-water Quality. , (2011).</li><li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 25 Years Progress on Sanitation and Drinking Water. , (2015).</li><li>Girones, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+detection+of+pathogens+in+water+-+The+pros+and+cons+of+molecular+techniques.">Molecular detection of pathogens in water - The pros and cons of molecular techniques.</a> Water Research. 44 (15), 4325-4339 (2010).</li><li>Rodriguez-Manzano, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Standard+and+new+fecal+indicators+and+pathogens+in+sewage+treatment+plants,+microbiological+parameters+for+improving+the+control+of+reclaimed+water.">Standard and new fecal indicators and pathogens in sewage treatment plants, microbiological parameters for improving the control of reclaimed water.</a> Water Science and Technology. 66 (12), 2517-2523 (2012).</li><li>Puig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+adenoviruses+and+enteroviruses+in+polluted+waters+by+nested+PCR+amplification.">Detection of adenoviruses and enteroviruses in polluted waters by nested PCR amplification.</a> Applied and Environmental Microbiology. 60 (8), 2963-2970 (1994).</li><li>Carter, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterically+infecting+viruses:+Pathogenicity,+transmission+and+significance+for+food+and+waterborne+infection.">Enterically infecting viruses: Pathogenicity, transmission and significance for food and waterborne infection.</a> Journal of Applied Microbiology. 98 (6), 1354-1380 (2005).</li><li>Bofill-Mas, S., Pina, S., Girones, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Documenting+the+epidemiologic+patterns+of+polyomaviruses+in+human+populations+by+studying+their+presence+in+urban+sewage.">Documenting the epidemiologic patterns of polyomaviruses in human populations by studying their presence in urban sewage.</a> Applied and Environmental Microbiology. 66 (1), 238-245 (2000).</li><li>Bofill-Mas, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+and+stability+of+human+adenoviruses+and+polyomavirus+JCPyV+in+wastewater+matrices.">Quantification and stability of human adenoviruses and polyomavirus JCPyV in wastewater matrices.</a> Applied and Environmental Microbiology. 72 (12), 7894-7896 (2006).</li><li>Rames, E., Roiko, A., Stratton, H., Macdonald, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+aspects+of+using+human+adenovirus+as+a+viral+water+quality+indicator.">Technical aspects of using human adenovirus as a viral water quality indicator.</a> Water Research. 96, 308-326 (2016).</li><li>Calgua, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+one-step+low+cost+procedure+to+concentrate+viruses+from+seawater+samples.">Development and application of a one-step low cost procedure to concentrate viruses from seawater samples.</a> Journal of Virological Methods. 153 (2), 79-83 (2008).</li><li>Bofill-Mas, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cost-effective+method+for+microbial+source+tracking+using+specific+human+and+animal+viruses.">Cost-effective method for microbial source tracking using specific human and animal viruses.</a> Journal of Visualized Experiments. 58, 5-9 (2011).</li><li>International Organization for Standardization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> ISO 10705-1:1995: Water quality - Detection and enumeration of bacteriophages - Part 1: Enumeration of F-specific RNA bacteriophages. , (1995).</li><li>Hernroth, B. E., Conden-Hansson, A. C., Rehnstam-Holm, A. S., Girones, R., Allard, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+factors+influencing+human+viral+pathogens+and+their+potential+indicator+organisms+in+the+blue+mussel,+Mytilus+edulis:+the+first+Scandinavian+report.">Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: the first Scandinavian report.</a> Applied and Environmental Microbiology. 68 (9), 4523-4533 (2002).</li><li>Pecson, B. M., Martin, L. V., Kohn, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+PCR+for+determining+the+infectivity+of+bacteriophage+MS2+upon+inactivation+by+heat,+UV-B+radiation,+and+singlet+oxygen:+Advantages+and+limitations+of+an+enzymatic+treatment+to+reduce+false-positive+results.">Quantitative PCR for determining the infectivity of bacteriophage MS2 upon inactivation by heat, UV-B radiation, and singlet oxygen: Advantages and limitations of an enzymatic treatment to reduce false-positive results.</a> Applied and Environmental Microbiology. 75 (17), 5544-5554 (2009).</li><li>Calgua, B., Barardi, C. R. M., Bofill-Mas, S., Rodriguez-Manzano, J., Girones, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+quantitation+of+infectious+human+adenoviruses+and+JC+polyomaviruses+in+water+by+immunofluorescence+assay.">Detection and quantitation of infectious human adenoviruses and JC polyomaviruses in water by immunofluorescence assay.</a> Journal of Virological Methods. 171 (1), 1-7 (2011).</li><li>Bofill-Mas, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cost-effective+method+for+microbial+source+tracking+using+specific+human+and+animal+viruses.">Cost-effective method for microbial source tracking using specific human and animal viruses.</a> Journal of Visualized Experiments. (58), e2820 (2011).</li><li>Gonzales-Gustavson, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+efficiency+and+uncertainty+of+skimmed+milk+flocculation+for+the+simultaneous+concentration+and+quantification+of+water-borne+viruses,+bacteria+and+protozoa.">Characterization of the efficiency and uncertainty of skimmed milk flocculation for the simultaneous concentration and quantification of water-borne viruses, bacteria and protozoa.</a> Journal of Microbiological Methods. 134, 46-53 (2017).</li></ol>

The authors have nothing to disclose.

The VirWaTest method enables the concentration of viruses and nucleic acid extraction from water samples at the point of use by non-experienced users. It is an affordable, rapid, and simple protocol. The concentration is based on the principle of organic flocculation using skimmed milk, by which the low pH and high conductivity conditions make skimmed milk proteins aggregate into flocs the viruses adsorb to. When the flocs sediment, it is easy to collect them, making it possible to concentrate 10 L of water, whereas traditional ultracentrifugation cannot deal with big water volumes.
The method has been modified for being practicable at the point of sampling without using any electric equipment except for a battery-operated magnetic stirrer. Some other approaches based on water filtration have been adapted to the concentration of viruses and can also be performed at the point of use. However, suspended material present in water samples often clogs the filters; thus, the small volume that may be concentrated with these systems is a serious limitation.
This is the first description of a method for concentrating viruses from water samples at the point of use, regardless of the turbidity of the sample. The VirWaTest concentration method allows several samples to be processed simultaneously if the appropriate material is available. Moreover, skimmed milk flocculation has been shown to be useful for bacteria and parasite concentration19.
The preparation of the appropriate material is crucial for performing the procedure properly. Consider the number of water samples to be analysed and prepare the reagents and material before moving to the place where the test is needed&#160;for the preparation of the reagents and material. Several samples can be processed at the same time if the appropriate amount of material is available.
Before starting the concentration of a water sample, a known concentration of a viral stock will be used to spike the sample as process control. This method uses a dried viral stock which is rehydrated with distilled water before being added to the water sample at the point of use. This is useful to rule out false-negative results at the end of the procedure and gives an indication of the performance of the method.
Viral concentrates obtained with the VirWaTest may be further tested in the field applying the VirWaTest nucleic acid extraction and detection methods or, alternatively, concentrates may be sent to a reference laboratory at room temperature. The preservative solution added to the concentrate enables viruses to remain stable for up to 2 weeks (unpublished results).
VirWaTest nucleic acid extraction is a magnetic particle-based method. It is easy and fast and allows several samples to be processed at the same time and shows equivalent and even better recovery efficiency than methods currently used for viral nucleic acid extractions. The nucleic acids may be sent to reference labs at room temperature or, if users are confident in performing molecular detection, a quantitative PCR assay can be performed at the point of use of the original water sample.
Also, if a small laboratory facility is available, the VirWaTest concentration protocol may be coupled to standard nucleic acid extraction kits that depend on a centrifuge and standard PCR-based methods that require a freezer to maintain the reagents but that use standard thermocyclers, which are less expensive than battery-operated ones.
However, since a power supply is sometimes not available, we have optimized detection assays for MS2 bacteriophages as process control and HAdV as a viral fecal indicator, and the methodology can be customized for any other virus of interest, such as hepatitis viruses, RoV, NoV, or others, to be run in the field without needing a freezer for maintenance of the reagents, nor conventional thermocyclers but only a battery-operated one. Several battery-operated thermocyclers are commercially available. Alternatively, if a power supply is available, other conventional qPCR equipment may be used. If an eight-tube thermocycler is used, up to two nucleic acid extractions (two different samples or two replicates from the same sample) can be tested in the same PCR assay. For each nucleic acid extraction, two different quantities will be tested to rule out enzymatic inhibition originated by the sample. The adaptation is based on the previous preparation of PCR tubes by air-drying primers, probes, and standard suspensions. Several lyophilized commercial qPCR solutions exist that could be used by applying the same procedure as described here. We have described one possibility that we considered to be easy to perform.
Comparison assays performed during the development of the method showed that the VirWaTest methods of concentration, extraction, and detection are efficient for the quantification of viruses in water samples.
The limit of detection (LOD) of the described procedure is variable since the volume collected after concentration is variable. Also, the LOD can be slightly different for different viruses. If a volume of approximately 10 L is collected, the LOD for HAdV would be around 1 x 102 viral GC/L. So, relatively small concentrations of HAdV can be detected by the VirWaTest method. In Pedernales (Ecuador), six out of the six samples tested presented HAdV, in concentrations close to the LOD, ranging from 3.27 x 101 to 1.80 x 102 GC/L. In Banghi (RCA), HAdV were detected in one out of the five samples analyzed, at a concentration of 3.46 x 102 GC/L. The presence of HAdV, as well as the presence of MS2 as the control process in the tested samples, shows the method is useful for the recovery of viral particles from water samples, even when performed by nonexperienced users.
Feedback obtained until now indicates that viral concentration is an easy procedure to perform, with no major problems when applied at the point of use of the samples, although 8 h and 5 h steps are required. It is important to note that these steps occur without any human assistance. Moreover, a faster method based on filtration is being developed as an alternative for nonturbid waters. However, flocculation seems to be, until now, the unique method that allows the concentration of samples presenting high turbidity. Viral concentrates may be then sent to any laboratory around the world at room temperature, which also makes it easier to test viruses since sampling areas do not always have good transportation services providing cooling conditions. Alternatively, the extraction and detection protocols presented here allow testing for viral detection at the point of use of the samples.
As far as we know, this is the first method reported to be useful for the concentration and testing for the presence of viruses in water samples in the field. Further efforts should be conducted to apply the procedure to the evaluation of the presence of human viral pathogens of interest in several other humanitarian crisis scenarios. Also, the user&#39;s feedback will be necessary to provide insights into the potential implementation to make the procedure friendlier.

During the first phases of any humanitarian emergency, access to clean water supplies, sanitation, and hygiene are critical for the survival of those affected. Therefore, monitoring water quality is a priority to prevent waterborne outbreaks. It is well-known that contaminated water is frequently the origin of diseases, but it is often difficult to determine the sources of viral outbreaks such as Hepatitis E virus (HEV), even with the availability of conventional laboratory methods. The control of water quality is based on the quantification of FIB1,2,3,4. However, it has been extensively documented that there is no correlation between the absence of FIB and the presence of viral waterborne pathogens such as rotavirus (RoV), norovirus (NoV), or HEV5,6. Thus, using the water quality criteria based on FIB might result in an underestimation of risks associated with the presence of waterborne viral pathogens. The surveillance of indicator viruses, such as human adenoviruses (HAdV), or specific pathogens would be helpful in defining the exposure to viral pathogens and identifying the potential source of human infection7,8,9,10 and in validating the efficacy of sanitation measures11.
Until now, the detection of viruses in these scenarios relied on skilled staff and complex logistics. VirWaTest (virwatest.org) is aimed at the development of a simple, affordable, and portable method for the concentration and subsequent detection of viruses from water samples at the point of use.
The virus concentration is based on the principle of organic flocculation of 10 L water samples, by which viruses are recovered in smaller volumes12,13. The flocs are collected and added to a buffer that lyses the viruses and prevents the nucleic acids from degradation when they stored at room temperature for not more than 2 weeks.
The nucleic acid extraction method is based on the use of magnetic particles to which the nucleic acids get adsorbed. They can be transferred from one washing buffer to another and finally into the elution buffer by using a magnetic pipette to which the particles attach. Viral nucleic acid suspensions obtained can be shipped to a reference laboratory where the detection can be performed using molecular methods based on PCR. For each nucleic acid extraction, two different quantities are tested to rule out enzymatic inhibition originated by the sample. Alternatively, with minimum equipment availability, PCR tests can be run at the point of use. The entire process is designed to be performed independently of a power supply (Figure 1).
A quantitative PCR assay to detect HAdV, excreted by humans and found in wastewater samples in high concentrations, has been adapted to be run at the point of use. HAdV are used as human fecal viral indicators. A PCR for the quantification of MS2 bacteriophage has been also adapted since MS2 is used in VirWaTest as process control. The method can be customized for the detection of any virus of interest.
After development, the VirWaTest method has been applied by the users in two different settings in the Republic of Central Africa (RCA) and Ecuador, providing feedback on the application of the protocol in real situations.
To our knowledge, this is the first procedure that allows the concentration and detection of viruses at the point of use, independent of any power supply, large equipment, and freezing/cooling conditions. It is recommended to collect two replicates of each water sample in order to obtain robust results.

<table border="0" cellpadding="0" cellspacing="0" style="width:1677px;" width="1677">
	<tbody>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">5x HOT FIREPol Probe qPCR Mix Plus (ROX)</td>
			<td style="width:195px;">Solis BioDyne</td>
			<td style="width:123px;">08-14-00001</td>
			<td style="width:989px;">Includes Solis Biodyne&#39;s 5x HOT FIREPol Probe qPCR Mix Plus (qPCR Mix), 50 Reactions</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">8-Microtube Strips with Caps</td>
			<td style="width:195px;">dD Biolab</td>
			<td style="width:123px;">840637</td>
			<td>Low Profile, Thin Walls, Adapted for Quantitative and Qualitative PCR</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Aquagenx CBT E. coli Kit</td>
			<td style="width:195px;">Aquagenx, LLC</td>
			<td style="width:123px;">ECCBT10</td>
			<td>10 Tests per Kit</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Batteries and Power Adapters for Magnetic Stirrer</td>
			<td style="width:195px;">GenIUL</td>
			<td style="width:123px;">900011674</td>
			<td>Includes 12V car power adapter</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Bucket Support</td>
			<td style="width:195px;">GenIUL</td>
			<td style="width:123px;">900011648</td>
			<td>Aluminium support</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Bucket, 10 L</td>
			<td style="width:195px;">Cater4You</td>
			<td style="width:123px;">10LTR</td>
			<td>Polypropilene, Tamperproof, Clear color</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Centrifuge Tube, 50 mL</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">CTSP-E50-050</td>
			<td>Polypropylene, Sterile, Graduated, With Skirt</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Citric Acid 1-Hydrate, 500 g</td>
			<td style="width:195px;">PanReac AppliChem</td>
			<td style="width:123px;">1410181211</td>
			<td>Pure, Pharma Grade, 1 Kilogram</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Clear PET Bottle</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">FPET-500-088</td>
			<td style="width:989px;">Clear Color, PET, Cap Not Included</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Difco Skim Milk, 500 g</td>
			<td style="width:195px;">Becton Dickinson</td>
			<td style="width:123px;">232100</td>
			<td>Dehydrated</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">DNA/RNA Shield, 250 mL</td>
			<td style="width:195px;">Zymo Research</td>
			<td style="width:123px;">R1100-250</td>
			<td>DNA/RNA Preservation Medium, 250 mL</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Easy9 Pipette Controller</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">EAS9-001-001</td>
			<td>0.3 &#956;m filter, Pipettes from 0.1 to 100 mL, Autoclavable silicone pipette holder</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Eppendorf Tube, 0.5 mL</td>
			<td style="width:195px;">Eppendorf</td>
			<td style="width:123px;">0030121023</td>
			<td>Polypropilene, Safe-Lock</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Eppendorf Tube, 2 mL</td>
			<td style="width:195px;">Eppendorf</td>
			<td style="width:123px;">0030120094</td>
			<td>Polypropilene, Safe-Lock</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Eppendorf Tube, 5 mL</td>
			<td style="width:195px;">dD Biolab</td>
			<td style="width:123px;">999542</td>
			<td>Polypropylene, Sterile, Graduated</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Ethanol 96% V/V, 1 L</td>
			<td style="width:195px;">Panreac AppliChem</td>
			<td style="width:123px;">361085-1611</td>
			<td>For UV, IR&#160; and HPLC</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Laboratory Tweezers</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">FORS-007-002</td>
			<td>Thin, Curved End, L= 120 mm</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Magnetic Stirrer</td>
			<td style="width:195px;">GenIUL</td>
			<td style="width:123px;">900017000</td>
			<td>Battery-powered</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Marker</td>
			<td style="width:195px;">dD Biolab</td>
			<td style="width:123px;">929203</td>
			<td style="width:989px;">Black, Extra fine Tip, Water Resistant, Fast Drying, For Plastic and Glassware</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Micro Rota-Rack for Microtubes</td>
			<td style="width:195px;">dD Biolab</td>
			<td style="width:123px;">37782</td>
			<td>4 Modules, L x W x H= 208 x 100 x 100 mm</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Mini8 Real-Time PCR Cycler</td>
			<td style="width:195px;">Coyote Biosciences, China</td>
			<td style="width:123px;">Mini-8</td>
			<td>Portable, Works with 12V Power Supplies or External Batteries, Two channels, Capacity for 8 Tubes</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">NucliSens Lysis Buffer</td>
			<td style="width:195px;">Biomerieux</td>
			<td style="width:123px;">200292</td>
			<td>Reagents for up to 48 Isolations, Store at Ambient Temperature</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Open Tip Serological Pipette, 10 mL</td>
			<td style="width:195px;">Deltalab</td>
			<td style="width:123px;">900136N</td>
			<td>Sterile, Individually Wrapped (Paper/Plastic)</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">PE Screw Cap PP28</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">TP28-004-020</td>
			<td style="width:989px;">For PET Bottles</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">pH Indicator Strip</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">WSPH-001-001</td>
			<td>Range pH 2.8 to pH 4.4, 50 Strips per Pack</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Plastic Test Tube</td>
			<td style="width:195px;">Quimikals</td>
			<td style="width:123px;">300913</td>
			<td>Includes Cap</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Polyethylene Pasteur Pipette</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">PIPP-003-500</td>
			<td>Graduated, 7 mL Overall Volume, Non-Sterile</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Polypropylene Screw Flask With Screw Cap, 150 mL</td>
			<td style="width:195px;">Deltalab</td>
			<td style="width:123px;">409726</td>
			<td>Screw cap, Sterile, graduated up to 100 mL</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Polypropylene Screw Flask With Screw Cap, 60 mL</td>
			<td style="width:195px;">Deltalab</td>
			<td style="width:123px;">409526G</td>
			<td>Screw cap, Sterile, Graduated up to 50 mL</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Powder Powder Detergent</td>
			<td style="width:195px;">-</td>
			<td style="width:123px;">-</td>
			<td>Regular Powder Soap for washing clothes</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Power Cables for Magnetic Stirrer</td>
			<td style="width:195px;">GenIUL</td>
			<td style="width:123px;">900011692</td>
			<td>Connection between batteries and magnetic stirrers</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">QuickPick Magnetic Tool</td>
			<td style="width:195px;">BioNobile</td>
			<td style="width:123px;">24001</td>
			<td>Hand-held tool for magnetic particles</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">QuickPick Tips in Box</td>
			<td style="width:195px;">BioNobile</td>
			<td style="width:123px;">24296</td>
			<td>RNase-Free, Autoclaved, 96 Units</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">QuickPick XL gDNA Magnetic Particles</td>
			<td style="width:195px;">BioNobile</td>
			<td style="width:123px;">SN51100</td>
			<td>3.2 mL</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Sea Salts</td>
			<td style="width:195px;">Sigma-Aldrich</td>
			<td style="width:123px;">S9883-500G</td>
			<td>An artificial salt mixture closely resembling the composition of the dissolved salts of ocean water</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Silicone Tubing</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">SILT-006-005</td>
			<td>Roll of 5 Meters, Inner&#160; &#248; x Outer&#160; &#248;= 6 x 10 mm</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Sodium Hydroxide Pellets, 98.5 - 100.5%</td>
			<td style="width:195px;">VWR Chemicals</td>
			<td style="width:123px;">28244295</td>
			<td>Pellets, 1 Kg</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Solar Rotary Platform</td>
			<td style="width:195px;">SOL-EXPERT Group</td>
			<td style="width:123px;">70020</td>
			<td>Acrylic Plate, 10 RPM, Supports up to 300 Grams</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">SOLIScript 1-step Probe Kit</td>
			<td style="width:195px;">Solis BioDyne</td>
			<td style="width:123px;">08-57-00250</td>
			<td>Includes Solis Biodyne&#39;s 5x One-Step Probe Mix (qPCR Mix) and 40x One-Step SOLIScript Mix (Reverse Transcriptase Enzyme), 250 Reactions</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">SPEEDTOOLS RNA Virus Extraction Kit</td>
			<td style="width:195px;">BioTools</td>
			<td style="width:123px;">21.141-4197</td>
			<td>Includes BioTools&#39;s BAW Buffer (Washing Buffer 1), BAV3 Buffer (Washing Buffer 2 and 3) and BRE Buffer (Elution Buffer).</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">SpinBar Octhaedral Stirring Magnet</td>
			<td style="width:195px;">dD Biolab</td>
			<td style="width:123px;">045926</td>
			<td>Pivot Ring, L x&#160; &#248; = 38 x 8 mm, Blue</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Tape-End Serological Pipette, 10 mL</td>
			<td style="width:195px;">Deltalab</td>
			<td style="width:123px;">PN10E1</td>
			<td>Sterile, Individually Wrapped (Paper/Plastic)</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Tape-End Serological Pipette, 50 mL</td>
			<td style="width:195px;">Deltalab</td>
			<td style="width:123px;">900043</td>
			<td>Sterile, Individually Wrapped (Paper/Plastic)</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Termi-DNA-Tor - Nucleic Acid Remover</td>
			<td style="width:195px;">BioTools</td>
			<td style="width:123px;">22001-4291</td>
			<td>Remover of nucleic acids, bacteria, fungi and mycoplasma from material and surfaces, 450 mL</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Water Molecular Biology Reagent, 1L</td>
			<td style="width:195px;">Sigma-Aldrich</td>
			<td style="width:123px;">W4502-1L</td>
			<td>Nuclease and Protease Free, 0.1 &#956;m Filtered</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Whirl-Pak Bag, 540 mL</td>
			<td style="width:195px;">Deltalab</td>
			<td style="width:123px;">200361</td>
			<td>Stable bottom</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:371px;">Zip Lock Plain Bag</td>
			<td style="width:195px;">LabBox</td>
			<td style="width:123px;">BZIP-080-100</td>
			<td>Polyethylene, L x W= 120 x 80 mm</td>
		</tr>
	</tbody>
</table>

virwatest, a point-of-use method for the detection of viruses in water samples

Viruses excreted by humans and animals may contaminate water sources and pose a risk to human health when this water is used for drinking, food irrigation, washing, etc. The classical fecal bacteria indicator does not always check for the presence of viral pathogens so the detection of viral pathogens and viral indicators is relevant in order to adopt measures of risk mitigation, especially in humanitarian scenarios and in areas where water-borne viral outbreaks are frequent.
At present, several commercial tests allowing the quantification of fecal indicator bacteria (FIB) are available for testing at the point of use. However, such commercial tests are not available for the detection of viruses. The detection of viruses in environmental water samples requires concentrating several liters into smaller volumes. Moreover, once concentrated, the detection of viruses relies on methods such as nucleic acid extraction and molecular detection (e.g., polymerase chain reaction [PCR]-based assays) of the viral genomes.
The method described here allows the concentration of viruses from 10 L water samples, as well as the extraction of viral nucleic acids at the point of use, with simple and portable equipment. This allows the testing of water samples at the point of use for several viruses and is useful in humanitarian scenarios, as well as at any context where an equipped laboratory is not available. Alternatively, the method allows concentrating viruses present in water samples and the shipping of the concentrate to a laboratory at room temperature for further analysis.

Method development 
This procedure has been developed in the Laboratory of Viruses Contaminants of Water and Food with the collaboration of GenIUL and Oxfam Interm&#243;n. It comprises of three different steps. The first one, the viral particle concentration, is an adaptation of a skimmed milk flocculation method previously described12,17,18. The original method was modified as to be independent of a power supply, simpler, and without centrifugation steps.
The recovery of the VirWaTest concentration method was tested in HAdV and MS2 bacteriophage-spiked groundwater samples. The viral recovery of the VirWaTest concentration and extraction method was estimated to be 3.01% to 18.02% for MS2 and 17.52% to 44.22% for HAdV. These recoveries were calculated from the values obtained by quantitative PCR during the development of the method compared to the initial concentrations of HAdV and MS2 in the water samples after spiking them with known concentrations of these viral stocks.
The VirWaTest magnetic nucleic acid extraction was compared to a commercial RNA mini kit (e.g., QIAamp Viral RNA Mini Kit), a column-based extraction method used in the laboratory, by testing 33 river and groundwater samples spiked with HAdV and MS2 and concentrated by skimmed milk flocculation. The comparison results showed that the VirWaTest method recovery was higher in 23/33 cases for HAdV, as well as for MS2 (Table 4). A Wilcoxon test showed p-values of 0.0005569 for HAdV and 0.02791 for MS2. VirWaTest nucleic acid extraction provides significantly higher viral recoveries than the commercial one.
Detection of HAdV in environmental water samples concentrated by the VirWaTest method
To test the developed method for viral concentration in the field, the Oxfam Water, Sanitation and Hygiene (WASH) team, located in Banghi (RCA) in March 2017, collected and concentrated viruses from five well water samples.
Also, in the area of Pedernales (Ecuador), which was affected by earthquakes in 2016 and 2017, six well water samples were collected by an Oxfam WASH team in February 2017, and its viruses were concentrated by the VirWaTest concentration method. Viral concentrates from both settings were sent to the laboratory in Barcelona for VirWaTest nucleic acid extraction and viral quantification.
In Ecuador, naturally occurring HAdV were detected in six out of the six samples analyzed, with concentration values ranging from 3.27 x 101 to 1.80 x 102 GC/L, whereas one out of the five samples collected and concentrated in Banghi (RCA) tested positive for HAdV, at a concentration of 3.46 x 102 GC/L (Table 5).
MS2, added to all tested samples as internal process control, was detected in all samples tested, showing that the method was correctly performed from concentration to detection.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59463/59463fig1.jpg" /> 
Figure 1: VirWaTest method. Overview of the steps the VirWaTest method is composed of. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59463/59463fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Materials</td>
			<td>Concentration</td>
			<td>Nucleic Acid Extraction</td>
			<td>Detection</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td>Magnetic Stirrer (2 Units) 
			Battery (2 Units) 
			Battery/Stirrer Connectors (2 Units) 
			Power Adapters (2 Units) 
			Bucket Support (2 Units) 
			Rope (1 Unit) 
			Stirring Magnet (3 Units) 
			Tweezers (1 Unit) 
			Silicon Tubing (1 Unit) 
			Pipette Controller (1 Unit) 
			Marker (1 Unit)</td>
			<td>Magnetic Pipette (1 Unit) 
			Solar Rotary Platform (1 Unit) 
			Multi-Size Tube Rack (1 Unit) 
			Timer (1 Unit)</td>
			<td>Thermocycler (1 Unit) 
			Battery (1 Unit) 
			Computer 
			Tube Rack (1 Unit) 
			0.5 &#956;L - 10 &#956;L Micropipette (1 Unit) 
			2 &#956;L - 20 &#956;L Micropipette (1 Unit)</td>
		</tr>
		<tr>
			<td>Consumables and Reagents (for every 2 water samples/replicates)</td>
			<td>Bucket (3 Units) 
			pH Indicator Strips 
			Tape-End 10 mL Pipette (2 Units) 
			Open-Tip 10 mL Pipette (2 Units) 
			Tape-End 50 mL Pipette (2 Units) 
			Tape-End 100 mL Pipette (2 Units) 
			Pasteur Pipette (4 Units) 
			Stand-Up Plastic Bag (4 Units) 
			Plastic Container with 25 mL of distilled water (1 Unit) 
			Plastic Container with 50 mL of distilled water (1 Unit) 
			100 mL Empty Container (1 Unit) 
			Gloves (6 Pairs) 
			Process Control (2 Tubes) 
			Tube with 10 mL of distilled water (2 Units) 
			Citric Acid (1 Tube) 
			Sodium Hydroxide (1 Tube) 
			Skimmed Milk (1 Tube)&#160; 
			Citric Acid Sachet (1 Unit) 
			Distilled Water (1 500 mL Bottle) 
			Sample Conditioning (2 Sachets) 
			Preservative Solution (2 Tubes) 
			Neutralizing Agent (4 Sachets)</td>
			<td>Magnetic Pipette Tips (2 Units) 
			Pasteur Pipette (2 Units) 
			Binding Buffer (2 Tubes) 
			Washing Buffer 1 (2 Tubes) 
			Washing Buffer 2 (2 Tubes) 
			Washing Buffer 3 (2 Tubes) 
			Elution Buffer (2 Tubes) 
			Gloves (6 Pairs)</td>
			<td>10 &#956;L Micropipette Tips (1 box) 
			20 &#956;L Micropipette Tips (1 box) 
			DNA qPCR Mix (1 Tube) 
			RNA qPCR Mix (1 Tube) 
			Reverse Transcriptase Enzyme (1 Tube) 
			Molecular Biology Water (1 Tube) 
			HAdV Tube Strip with primers, probe and standard (1 Unit) 
			MS2 Tube Strip with primers, probe and standard (1 Unit) 
			Nucleic Acid Remover 
			Gloves (6 Pairs)</td>
		</tr>
	</tbody>
</table>
Table 1: VirWaTest contents. Equipment, consumables, and reagents that have to be prepared for the concentration, extraction, and detection of viruses in two water samples/replicates.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Virus</td>
			<td>Primers</td>
			<td>Genbank Accession No.</td>
			<td>Position</td>
			<td colspan="3">Sequence (5&#8217;&#8210;3&#8217;)</td>
			<td>Length</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td rowspan="3">Human Adenovirus (HAdV)</td>
			<td>AdF</td>
			<td rowspan="3">J01917.1</td>
			<td>18869&#8210;18887</td>
			<td colspan="3">CWTACATGCACATCKCSGG</td>
			<td>19</td>
			<td rowspan="3">Hernroth et al., 200215</td>
		</tr>
		<tr>
			<td>AdR</td>
			<td>18919&#8210;18937</td>
			<td colspan="3">CRCGGGCRAAYTGCACCAG</td>
			<td>19</td>
		</tr>
		<tr>
			<td>AdP1</td>
			<td>18890&#8210;18916</td>
			<td colspan="3">6-FAM-CCGGGCTCAGGTACTCCGAGGCGTCCT-BMN-Q535</td>
			<td>27</td>
		</tr>
		<tr>
			<td rowspan="3">MS2 Bacteriophage (MS2)&#160;</td>
			<td>pecson-2F</td>
			<td rowspan="3">NC_001417.2</td>
			<td>344&#8210;363</td>
			<td colspan="3">AAGGTGCCTACAAGCGAAGT</td>
			<td>20</td>
			<td rowspan="3">Pecson et al., 200916</td>
		</tr>
		<tr>
			<td>pecson-2R</td>
			<td>659&#8210;678</td>
			<td colspan="3">TTCGTTTAGGGCAAGGTAGC</td>
			<td>20</td>
		</tr>
		<tr>
			<td>PecP-2</td>
			<td>369&#8210;388</td>
			<td colspan="3">6-FAM-ATCGTGGGGTCGCCCGTACG-BHQ-1</td>
			<td>20</td>
		</tr>
	</tbody>
</table>
Table 2: Oligonucleotides for quantitative PCR experiments. Primers and probe designed to bind to nucleic acid sequences of HAdV and MS2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td rowspan="2">95 &#176;C</td>
			<td rowspan="2">12 min</td>
			<td rowspan="2">1</td>
			<td>55 &#176;C</td>
			<td>15 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>15 s</td>
			<td rowspan="2">40</td>
			<td>95 &#176;C</td>
			<td>15 s</td>
			<td rowspan="2">40</td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>1 min</td>
			<td>60 &#176;C</td>
			<td>1 min</td>
		</tr>
	</tbody>
</table>
Table 3: Thermal conditions for quantitative PCR experiments. Temperature, time, and cycles used for HAdV and MS2 amplification.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>QIAgen</td>
			<td>VirWaTest</td>
			<td rowspan="4"></td>
			<td>QIAgen</td>
			<td>VirWaTest</td>
		</tr>
		<tr>
			<td>Median</td>
			<td>2.53 x 103</td>
			<td>2.43 x 103</td>
			<td>4.74 x 104</td>
			<td>5.13 x 104</td>
		</tr>
		<tr>
			<td>Mean</td>
			<td>1.74 x 104</td>
			<td>3.12 x 104</td>
			<td>4.24 x 104</td>
			<td>5.97 x 104</td>
		</tr>
		<tr>
			<td>SD</td>
			<td>5.66 x 105</td>
			<td>2.23 x 106</td>
			<td>4.49 x 104</td>
			<td>1.63 x 105</td>
		</tr>
		<tr>
			<td rowspan="2"></td>
			<td colspan="5">p-value (Wilcoxon) for HAdV: 0.0005569</td>
		</tr>
		<tr>
			<td colspan="5">p-value (Wilcoxon) for MS2: 0.02791</td>
		</tr>
		<tr>
			<td>Virus tested&#160;</td>
			<td>Samples Tested&#160;</td>
			<td>QIAgen&#160;</td>
			<td>VirWa Test</td>
			<td colspan="2" rowspan="3"></td>
		</tr>
		<tr>
			<td>HAdv</td>
			<td>33</td>
			<td>10</td>
			<td>23</td>
		</tr>
		<tr>
			<td>MS2</td>
			<td>33</td>
			<td>10</td>
			<td>23</td>
		</tr>
	</tbody>
</table>
Table 4: VirWaTest nucleic acid extraction development. Median, mean, and SD values obtained when comparing the Qiagen and VirWaTest extraction methods in 33 groundwater samples for HAdV and MS2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Country</td>
			<td>Site</td>
			<td>Sample</td>
			<td>HAdV GC/L</td>
		</tr>
		<tr>
			<td rowspan="5">RCA</td>
			<td>Eau de la SODECA</td>
			<td>1</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Ile Bongossoua, Village 1</td>
			<td>2</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Ile Bongossoua, Village 3</td>
			<td>3</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Bangui, Puits Quartier Fondo</td>
			<td>4</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Bangui, Puits Quartier Yambassa</td>
			<td>5</td>
			<td>3.64 x 102</td>
		</tr>
		<tr>
			<td rowspan="6">Ecuador</td>
			<td>Borehole A</td>
			<td>6</td>
			<td>7.96 x 101</td>
		</tr>
		<tr>
			<td>Borehole B</td>
			<td>7</td>
			<td>1.80 x 102</td>
		</tr>
		<tr>
			<td>Borehole C</td>
			<td>8</td>
			<td>8.88 x 101</td>
		</tr>
		<tr>
			<td>Well water A</td>
			<td>9</td>
			<td>6.06 x 101</td>
		</tr>
		<tr>
			<td>Well water B</td>
			<td>10</td>
			<td>1.12 x 102</td>
		</tr>
		<tr>
			<td>Well water C</td>
			<td>11</td>
			<td>3.27 x 101</td>
		</tr>
	</tbody>
</table>
Table 5: Quantification of HAdV using the VirWaTest Method. Quantitative PCR results, expressed in GC/liter, for HAdV quantified in water samples collected and concentrated from RCA and Ecuador.

Watch this Scientific Journal Video about VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples at JoVE.com

VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples

Here we present VirWaTest, which is a simple, affordable and portable method for the concentration and detection of viruses from water samples at the point of use.

Viruses excreted by humans and animals may contaminate water sources and pose a risk to human health when this water is used for drinking, food ...

virwatest-point-use-method-for-detection-viruses-water

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.4K Views.  University of Barcelona. Here we present VirWaTest, which is a simple, affordable and portable method for the concentration and detection of viruses from water samples at the point of use.

Video: VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples

Use of Fluorescent Immuno-Chemistry for the detection of Edwardsiella ictaluri in channel catfish (I. punctatus) samples

While Edwardsiella ictaluri is a major pathogen of channel catfish Ictalurus punctatus and has been discovered nearly 
three decades ago 1,2, so far, to the best of these authors' knowledge, no method has been developed to allow for the in situ visualization of the 
bacteria in histological sections.
While bacterial localization has been determined in vivo in previous studies using plate counts 3, radiometric labeled 4, 
or bioluminescent bacteria 5, most of these studies have only been performed at the gross organ level, with one exception 6. This limitation 
is of particular concern because E. ictaluri has a complex infection cycle 1,7, and it has a variety of virulence factors 8,9. 
The complex interaction of E. ictaluri with its host is similar in many respects to Salmonella typhi 10, which is in the same taxonomic family.
Here we describe a technique allowing for the detection of bacteria using indirect immuno-histochemistry using the monoclonal Ed9 antibody described by Ainsworth et al.11.
Briefly, a blocking serum is applied to paraffin embedded histological sections to prevent non-specific biding. Then, the 
sections are incubated with the primary antibody: E. ictaluri specific monoclonal antibody Ed9. Excess antibodies are rinsed away and the FitC 
labeled secondary antibodies are added. After rinsing, the sections are mounted with a fluorescent specific mounting medium. 
This allowed for the detection of E. ictaluri in situ in histological sections of channel catfish tissues.

Use of Fluorescent Immuno-Chemistry for the detection of Edwardsiella ictaluri in channel catfish I. punctatus samples

Here we describe a procedure allowing the labeling of Edwardsiella ictaluri in situ in histological sections from channel catfish Ictalurus punctatus using indirect immunohistochemistry with monoclonal antibodies Ed9 as a primary, and fluorescent FitC labeled antibodies as a secondary. This allowed for the detection of the bacterium using fluorescent microscopy.

While Edwardsiella ictaluri is a major pathogen of channel catfish Ictalurus punctatus and has been discovered nearly 
three decades ago 1,2, so far, to ...

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

High-throughput Detection Method for Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, precise diagnosis of the infecting strain and rapid high-throughput screening of vast numbers of clinical samples is paramount to control the spread of pandemic infections. Current clinical diagnoses of influenza infections are based on serologic testing, polymerase chain reaction, direct specimen immunofluorescence and cell culture 1,2.
Here, we report the development of a novel diagnostic technique used to detect live influenza viruses. We used the mouse-adapted human A/PR/8/34 (PR8, H1N1) virus 3 to test the efficacy of this technique using MDCK cells 4. MDCK cells (104 or 5 x 103 per well) were cultured in 96- or 384-well plates, infected with PR8 and viral proteins were detected using anti-M2 followed by an IR dye-conjugated secondary antibody. M2 5 and hemagglutinin 1 are two major marker proteins used in many different diagnostic assays. Employing IR-dye-conjugated secondary antibodies minimized the autofluorescence associated with other fluorescent dyes. The use of anti-M2 antibody allowed us to use the antigen-specific fluorescence intensity as a direct metric of viral quantity. To enumerate the fluorescence intensity, we used the LI-COR Odyssey-based IR scanner. This system uses two channel laser-based IR detections to identify fluorophores and differentiate them from background noise. The first channel excites at 680 nm and emits at 700 nm to help quantify the background. The second channel detects fluorophores that excite at 780 nm and emit at 800 nm. Scanning of PR8-infected MDCK cells in the IR scanner indicated a viral titer-dependent bright fluorescence. A positive correlation of fluorescence intensity to virus titer starting from 102-105 PFU could be consistently observed. Minimal but detectable positivity consistently seen with 102-103 PFU PR8 viral titers demonstrated the high sensitivity of the near-IR dyes. The signal-to-noise ratio was determined by comparing the mock-infected or isotype antibody-treated MDCK cells.
Using the fluorescence intensities from 96- or 384-well plate formats, we constructed standard titration curves. In these calculations, the first variable is the viral titer while the second variable is the fluorescence intensity. Therefore, we used the exponential distribution to generate a curve-fit to determine the polynomial relationship between the viral titers and fluorescence intensities. Collectively, we conclude that IR dye-based protein detection system can help diagnose infecting viral strains and precisely enumerate the titer of the infecting pathogens.

This method describes the use of Infrared dye based imaging system for detection of H1N1 in bronchioalveolar lavage (BAL) fluid of infected mice at a high sensitivity. This methodology can be performed in a 96- or 384-well plate, requires &lt;10 &mu;l volume of test material and has the potential for concurrent screening of multiple pathogens.

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Glass Wool Filters for Concentrating Waterborne Viruses and Agricultural Zoonotic Pathogens

The key first step in evaluating pathogen levels in suspected contaminated water is concentration. Concentration methods tend to be specific for a particular pathogen group, for example US Environmental Protection Agency Method 1623 for Giardia and Cryptosporidium1, which means multiple methods are required if the sampling program is targeting more than one pathogen group. Another drawback of current methods is the equipment can be complicated and expensive, for example the VIRADEL method with the 1MDS cartridge filter for concentrating viruses2. In this article we describe how to construct glass wool filters for concentrating waterborne pathogens. After filter elution, the concentrate is amenable to a second concentration step, such as centrifugation, followed by pathogen detection and enumeration by cultural or molecular methods. The filters have several advantages. Construction is easy and the filters can be built to any size for meeting specific sampling requirements. The filter parts are inexpensive, making it possible to collect a large number of samples without severely impacting a project budget. Large sample volumes (100s to 1,000s L) can be concentrated depending on the rate of clogging from sample turbidity. The filters are highly portable and with minimal equipment, such as a pump and flow meter, they can be implemented in the field for sampling finished drinking water, surface water, groundwater, and agricultural runoff. Lastly, glass wool filtration is effective for concentrating a variety of pathogen types so only one method is necessary. Here we report on filter effectiveness in concentrating waterborne human enterovirus, Salmonella enterica, Cryptosporidium parvum, and avian influenza virus.

Glass wool filters have been used to concentrate waterborne viruses by a number of research groups around the world. Here we show a simple approach for constructing glass wool filters and demonstrate the filters are also effective in concentrating waterborne viral, bacterial and protozoan pathogens.

The key first step in evaluating pathogen levels in suspected contaminated water is concentration.  Concentration methods tend to be specific for a ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

Rapid Molecular Detection and Differentiation of Influenza Viruses A and B

Influenza is a contagious respiratory illness caused by influenza viruses A and B in humans and causes a significant amount of morbidity and mortality every year. The Influenza A and B assay was the first CLIA-waived molecular rapid flu test available. The Influenza A and B test works by employing isothermal amplification with influenza-specific primers followed by target detection with molecular beacon probes. Here, the performance of the Influenza A and B assay on frozen, archived nasopharyngeal swab (NPS) specimens stored in viral transport medium (VTM) were compared to a respiratory panel assay.
The performance of the Influenza A and B assay was evaluated by comparing the results to the respiratory panel reference method. The sensitivity for total influenza virus A was 67.5% (95% CI (CI), 56.6-78.5) and the specificity was 86.9% (CI, 71.0-100). For influenza virus B testing, the sensitivity and specificity were 90.2% (CI, 68.5-100) and 98.8% (CI, 68.5-100), respectively.
This system has the advantage of a significantly shorter test time than any other currently available molecular assay and the simple, pipette-free procedure runs on a fully integrated, closed, small-footprint system. Overall, the Influenza A and B assay evaluated in this study has the potential to serve as a point-of-care rapid influenza diagnostic test.

We describe a rapid, molecular-based Influenza A and B assay. The Influenza assay detects each target within 15 min by employing isothermal amplification with influenza-specific primers followed by target detection with molecular beacon probes. The Influenza A and B assay is user-friendly and required minimal hands-on time to perform.

Influenza is a contagious respiratory illness caused by influenza viruses A and B in humans and causes a significant amount of morbidity and mortality ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...