The authors would like to thank Thomas Dresselhaus, Martin Parniske, Noureddine Djella, and Armin Hildebrand for providing lab space and plant material. The original work on the Trojan horse method was supported by a Leopoldina postdoc fellowship and NSF project IOS13-39229. The work presented in this article was supported by SFB924 (projects A14 and B14) of the DFG.

1. Construction of an U. maydis Trojan Horse
NOTE: See Figure 1.
<ol>
	<li>Amplify a gene of interest from maize cDNA using gene-specific primers and a proofreading DNA polymerase. Clone the primary PCR product and transform the construct into E. coli following the plasmid vendor&#39;s instructions. Verify the correct gene of interest sequence by Sanger sequencing prior to use for the next cloning steps. 
	NOTE: PCR specifications need to be optimized due to primer sequence specificities and optimal DNA polymerase reaction conditions.</li>
	<li>Design primers to amplify the maize gene of interest without the sequence encoding a signal peptide (SP).</li>
	<li>Extend the 5&#180; end of the reverse primer with the RSIATA motif and an NcoI cutting site (Table 1).</li>
	<li>Amplify the maize gene of interest with a proofreading DNA polymerase using the PCR construct generated in 1.1 as the PCR template.</li>
	<li>Double-digest the PCR product and the U. maydis transformation plasmid, p123-PUmpit2-SpUmpit2-Zmmac1-mCherry-Ha15, with XbaI and NcoI. Purify the digested PCR product and plasmid.</li>
	<li>Ligate the digested PCR product into the p123-PUmpit2-SpUmpit2-Zmmac1-mCherry-Ha template using T4 DNA ligase following the manufacturer&#180;s instructions. Transform the ligation product into E. coli and verify the correct gene of interest sequence by Sanger sequencing.</li>
	<li>Linearize the p123-PUmpit2-SpUmpit2-Zmgene of interest-mCherry-Ha with the restriction enzyme SspI and transform DNA into the solopathogenic U. maydis strain SG20016. Isolate U. maydis transformants by carboxin selection and confirm isolated transformants by Southern blot analysis16. 
	NOTE: For each protein of interest, at least three independent U. maydis transformants should be isolated and analyzed to estimate any phenotype effects of random background mutations.</li>
</ol>
2. Culture Media
<ol>
	<li>Prepare YEPSlight liquid medium16: 1.0% (w/v) yeast extract, 0.4% (w/v) Bacto-Peptone, and 0.4% (w/v) sucrose. Dissolve all components in ddH2O and autoclave at 121 &#176;C for 15 min; autoclaving at a higher temperature, for a longer period of time or repeatedly would reduce the quality of the medium.</li>
	<li>Prepare potato-dextrose-agar (PD-agar)20: 3.9% (w/v) potato dextrose agar, and 1.0% (w/v) 1 M Tris-HCl pH 8.0 (f.c. 0.01 M). Mix all components directly in the bottle for autoclaving and add ddH2O plus a magnetic stir bar. Autoclave at 121 &#176;C for 15 min; autoclaving at a higher temperature, for a longer period of time or repeatedly would reduce the quality of the medium.</li>
	<li>Prepare PD-Charcoal agar20: 3.9% (w/v) potato dextrose agar, 1% (w/v) charcoal, and 1.0% (v/v) 1 M Tris-HCl pH 8.0 (f.c. 0.01 M). Mix all components directly in the bottle for autoclaving and add ddH2O plus a magnetic stir bar. Autoclave at 121 &#176;C for 15 min; autoclaving at a higher temperature, for a longer period of time or repeatedly would reduce the quality of the medium.</li>
</ol>
3. Plant Infection
<ol>
	<li>Perform analysis of maize cell division in response to Trojan horse delivered protein (e.g., microscopy-based cell counting)&#160;beforehand. U. maydis-induced maize cell proliferation and subsequent tumor formation starts around 4-5 days post infection. Quantitative disease assessments are tissue-dependent and should be performed from 6 to 14 days post infection. 
	NOTE: Distinct maize cultivars show different levels of susceptibility to U. maydis infection. Maize cvs. W23, A188, Gaspe flint, Early Golden Bantam or Va35 show susceptibility towards this pathogen and are thus suitable cultivars for Trojan horse studies.</li>
	<li>Preparation of the U. maydis inoculum
	<ol>
		<li>Include the progenitor strain SG200 as a negative control in all Trojan horse experiments in order to estimate side effects on the infection by the transgenic strain. Here, use an U. maydis strain expressing a non-secreted version of the protein of interest as a negative control. However, for reasons of practicability (e.g., larger screenings), the progenitor strain may be the easier choice of control.</li>
		<li>Before starting the experiment, estimate what amounts of infection culture are needed. Keep in mind that infection of each plant requires 1 - 1.5 mL of U. maydis suspension dependent on the maize tissue type. 
		NOTE: Approximately 1 mL of an overnight culture is sufficient for dilution to an OD600 of 0.2 in 20 mL of YEPSlight medium, and 25 mL of an U. maydis culture with an OD600 of 0.8-1.0 are sufficient for infection of 13-16 plants.</li>
		<li>Scratch U. maydis from a PD agar plate using a sterile Pasteur pipette, inoculate in 5 mL of YEPSlight medium and let the culture grow at 28 &#176;C with constant shaking at 200 rpm for 16 h.</li>
		<li>Prior to infection, examine the U. maydis inoculation culture by standard light microscopy for proper growth and bacterial contamination at 400X magnification. 
		NOTE: In a suitable culture, only the cigar-shaped fungus is visible (Figure 2).</li>
		<li>Mix 900 &#181;L of fresh YEPSlight with 100 &#181;L of the overnight culture and measure the OD600 using YEPSlight medium as a blank in the spectrophotometer analysis.</li>
		<li>Dilute the overnight culture with fresh YEPSlight medium to an OD600 of 0.2 and let the culture grow at 28 &#176;C with constant shaking at 200 rpm until reaching the mid-log growth phase indicated by an OD600 nm of 0.8-1.0. 
		NOTE: U. maydis cells duplicate every 2 h under these conditions, thus the desired OD600 is reached after 4-5 h of cultivation.</li>
		<li>Harvest the cells at OD600 of 0.8-1.0 by spinning at 3,000 x g for 10 min and discard the supernatant.</li>
		<li>Wash the cell pellet one time with ddH2O. For this purpose, add one culture volume of ddH2O, spin with 3000 x g for 10 min and discard the supernatant.</li>
		<li>Resuspend the cell pellet carefully in ddH2O using a 20-mL glass pipette, thereby adjusting the final OD600 to 3.0 (for a Trojan horse assay) or 1.0 (for disease rating).</li>
	</ol>
	</li>
	<li>Verification of the Trojan horse: in planta secretion of the maize fusion protein
	<ol>
		<li>Infect maize seedlings with a Trojan horse strain17.</li>
		<li>Perform microscopic imaging of infected seedlings at 2 - 3 days post infection using a confocal laser-scanning microscope. To this end, excise a rectangular piece of the leaf 1 cm below the point of injection, place the sample onto a microscope slide and add a drop of ddH2O. To visualize mCherry fusion protein, excite specimen at &#955;= 561 nm and record emission at &#955;= 580 - 630 nm.</li>
	</ol>
	</li>
	<li>Infection of adult maize leaves
	<ol>
		<li>Cultivate maize plants to the stage of adult leaves (when at least leaf 7 grows within the stalk). 
		NOTE: This stage is reached after four weeks upon sowing under greenhouse conditions of 14 h, 28 &#176;C day/10 h, 22 &#176;C night rhythm using cv. W23. Duration may vary with the maize cultivar and greenhouse conditions.</li>
		<li>Transfer the U. maydis culture (see 3.2.9) into a 3-mL syringe with a 20G x 1 hypodermic needle.</li>
		<li>Press the stalk carefully to localize the meristem tissue in the stalk. The base of the meristem can be distinguished by a transition from harder stalk to softer tissue.</li>
		<li>Mark the meristem on the stalk using a pen.</li>
		<li>Inject 1.5 mL of U. maydis culture 1 cm above the shoot meristem or inflorescence meristem.</li>
		<li>Rate disease symptoms at 6 and 12 days post infection.</li>
	</ol>
	</li>
	<li>Infection of tassels
	<ol>
		<li>Grow maize plants until reaching the tassel stage. 
		NOTE: A detailed timeline on anther and tassel development in maize cv. W23 was previously described18,19. Tassels containing pre-meiotic anthers are highly susceptible to U. maydis infection; in the maize cv. W23 tassels are the size of 4 - 7 cm.</li>
		<li>Press the stalk carefully to localize the tassel in the stem.</li>
		<li>Mark the tip and the base of the tassel on the stem using a pen.</li>
		<li>Transfer the U. maydis culture (see 3.2.9) into a 3-mL syringe with a 20G x 1 hypodermic needle.</li>
		<li>Inject 1.5 mL of the inoculum around the tassel. To ensure equal distribution of the inoculum, slowly place 0.5 mL each at the tip, the middle part, and the base of the tassel marked with the pen.</li>
		<li>Rate disease symptoms at 10 days post infection.</li>
	</ol>
	</li>
	<li>Infection of ears 
	NOTE: The ear tissue development differs in distinct maize cultivars and greenhouse conditions and must be carefully observed prior to inoculation. Ears starting to outgrow silks are highly susceptible to U. maydis infection.
	<ol>
		<li>Transfer the U. maydis culture (see 3.2.9) into a 3 mL syringe with a 20 G x 1 hypodermic needle.</li>
		<li>Inject the inoculation needle into the space between the husk leaves as deeply as possible without injuring the ear.</li>
		<li>Release 1.5 mL of the inoculum around the ear.</li>
		<li>Remove the syringe plus needle and carefully massage the cob to distribute the U. maydis solution equally.</li>
		<li>Rate disease symptoms at 14 days post infection.</li>
	</ol>
	</li>
	<li>Confirm viability of U. maydis inoculum
	<ol>
		<li>Drop 10 &#181;L of the inoculum on a PD charcoal agar plate and incubate at room temperature for 2 days. 
		NOTE: If the respective U. maydis culture is able to form filaments, fluffy, white mycelium becomes visible (Figure 5)</li>
	</ol>
	</li>
</ol>

<ol>
	<li>K&#228;mper, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+the+genome+of+the+biotrophic+fungal+plant+pathogen+Ustilago+maydis.">Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis.</a> Nature. 444, 97-101 (2006).</li><li>Doehlemann, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+compatibility+in+the+Ustilago+maydis/maize+pathosystem.">Establishment of compatibility in the Ustilago maydis/maize pathosystem.</a> Journal of Plant Physiology. 165, 29-40 (2008).</li><li>Matei, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+a+tumour:+cell+type+specific+dissection+of+Ustilago+maydis-induced+tumour+development+in+maize+leaves.">How to make a tumour: cell type specific dissection of Ustilago maydis-induced tumour development in maize leaves.</a> New Phytologist. , (2018).</li><li>Doehlemann, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+a+maize+plant:+transcriptional+and+metabolic+changes+induced+by+the+fungal+biotroph+Ustilago+maydis.">Reprogramming a maize plant: transcriptional and metabolic changes induced by the fungal biotroph Ustilago maydis.</a> The Plant Journal. 56, 181-195 (2008).</li><li>Doehlemann, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pep1,+a+secreted+effector+protein+of+Ustilago+maydis.,+is+required+for+successful+invasion+of+plant+cells.">Pep1, a secreted effector protein of Ustilago maydis., is required for successful invasion of plant cells.</a> PLOS Pathogens. 5, e1000290 (2009).</li><li>Redkar, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+secreted+effector+protein+of+Ustilago+maydis+guides+maize+leaf+cells+to+form+tumors.">A secreted effector protein of Ustilago maydis guides maize leaf cells to form tumors.</a> The Plant Cell. 27, 1332-1351 (2015).</li><li>Djamei, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+priming+by+a+secreted+fungal+effector.">Metabolic priming by a secreted fungal effector.</a> Nature. 478, 395-398 (2011).</li><li>Tanaka, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+secreted+Ustilago+maydis+effector+promotes+virulence+by+targeting+anthocyanin+biosynthesis+in+maize.">A secreted Ustilago maydis effector promotes virulence by targeting anthocyanin biosynthesis in maize.</a> eLife. 3, e01355 (2014).</li><li>Mueller, A. N., Ziemann, S., Treitschke, S., Assmann, D., Doehlemann, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compatibility+in+the+Ustilago+maydis-maize+interaction+requires+inhibition+of+host+cysteine+proteases+by+the+fungal+effector+Pit2.">Compatibility in the Ustilago maydis-maize interaction requires inhibition of host cysteine proteases by the fungal effector Pit2.</a> PLOS Pathogens. 9, e1003177 (2013).</li><li>Ziemann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+apoplastic+peptide+activates+salicylic+acid+signalling+in+maize.">An apoplastic peptide activates salicylic acid signalling in maize.</a> Nature Plants. 4, 172-180 (2018).</li><li>Ju&#225;rez-Montiel, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+corn+smut+('Huitlacoche')+as+a+new+platform+for+oral+vaccines.">The corn smut ('Huitlacoche') as a new platform for oral vaccines.</a> PLoS One. 10, e0133535 (2015).</li><li>Sarkari, P., Feldbr&#252;gge, M., Schipper, K., Schmoll, M., Dattenb&#246;ck, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene Expression Systems in Fungi: Advancements and Applications. , 183-200 (2016).</li><li>Monreal-Escalante, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+corn+smut-made+cholera+oral+vaccine+is+thermostable+and+induces+long-lasting+immunity+in+mouse.">The corn smut-made cholera oral vaccine is thermostable and induces long-lasting immunity in mouse.</a> Journal of Biotechnology. 234, 1-6 (2016).</li><li>Stock, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applying+unconventional+secretion+of+the+endochitinase+Cts1+to+export+heterologous+proteins+in+Ustilago+maydis.">Applying unconventional secretion of the endochitinase Cts1 to export heterologous proteins in Ustilago maydis.</a> Journal of Biotechnology. 161, 80-91 (2012).</li><li>van der Linde, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+Trojan+horse+delivers+bioactive+host+protein+to+alter+maize+(Zea+mays)+anther+cell+behavior+in+situ.">Pathogen Trojan horse delivers bioactive host protein to alter maize (Zea mays) anther cell behavior in situ.</a> The Plant Cell. 30, 528-542 (2018).</li><li>B&#246;sch, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+plant+pathogen+Ustilago+maydis+to+study+fungal+biology+and+plant+microbe+interactions.">Genetic manipulation of the plant pathogen Ustilago maydis to study fungal biology and plant microbe interactions.</a> Journal of Visualized Experiments. , e54522 (2016).</li><li>Chavan, S., Smith, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+efficient+method+for+assessing+pathogenicity+of+Ustilago+maydis+on+maize+and+teosinte+lines.">A rapid and efficient method for assessing pathogenicity of Ustilago maydis on maize and teosinte lines.</a> Journal of Visualized Experiments. 50712, (2014).</li><li>Kelliher, T., Walbot, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+and+patterning+of+the+five+cell+types+of+the+Zea+mays+anther+locule.">Emergence and patterning of the five cell types of the Zea mays anther locule.</a> Developmental Biology. 350, 32-49 (2011).</li><li>Egger, R. L., Walbot, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+Zea+mays.+tassel+development+and+correlation+with+anther+developmental+stages+as+a+guide+for+experimental+studies.">Quantifying Zea mays. tassel development and correlation with anther developmental stages as a guide for experimental studies.</a> Maydica. 60, M34 (2015).</li><li>Holliday, R., King, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Bacteria, Bacteriophages, and Fungi: Volume 1. , 575-595 (1974).</li><li>Doehlemann, G., Reissmann, S., A&#223;mann, D., Fleckenstein, M., Kahmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+linked+genes+encoding+a+secreted+effector+and+a+membrane+protein+are+essential+for+Ustilago+maydis-induced+tumour+formation.">Two linked genes encoding a secreted effector and a membrane protein are essential for Ustilago maydis-induced tumour formation.</a> Molecular Microbiology. 81, 751-766 (2011).</li><li>Banuett, F., Herskowitz, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+a+alleles+of+Ustilago+maydis+are+necessary+for+maintenance+of+filamentous+growth+but+not+for+meiosis.">Different a alleles of Ustilago maydis are necessary for maintenance of filamentous growth but not for meiosis.</a> Proceedings of the National Academy of Sciences. 86, 5878-5882 (1989).</li><li>Bortfeld, M., Auffarth, K., Kahmann, R., Basse, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Ustilago+maydis+a2+mating-type+locus+genes+lga2+and+rga2+compromise+pathogenicity+in+the+absence+of+the+mitochondrial+p32+family+protein+Mrb1.">The Ustilago maydis a2 mating-type locus genes lga2 and rga2 compromise pathogenicity in the absence of the mitochondrial p32 family protein Mrb1.</a> The Plant Cell. 16, 2233-2248 (2004).</li></ol>

The authors have nothing to disclose.

Modern crop research demands protocols for molecular analysis on genetic and protein levels. Genetic accessibility via transformation is not available or inefficient and time-consuming for most crop species such as maize. Moreover, reliable genetic tools such as promoter reporter systems are scarce, which makes it difficult to study in situ protein function with high spatiotemporal resolution at distinct tissue sites. Apoplastic proteins can be studied by infiltration of heterologously expressed and purified proteins into tissues. However, despite advances in heterologous protein expression, targeted infiltration into crop tissues remains difficult and often inefficient for protein functional analysis. The Trojan horse strategy is an alternative approach that does not require transformation or protein infiltration. By employing the secretion apparatus of the maize pathogen U. maydis, delivery of theoretically any protein of interest into the plant apoplast of infected tissue can be achieved. Regarding the size of a protein of interest, the limits of this technique have yet to be explored. In former assays, the 290 amino acids U. maydis effector Cmu1 fused to mCherry was successfully secreted7. However, the applicability of the Trojan horse method to bigger proteins remains to be tested. If additions of posttranslational modifications to the protein of interest are undesirable, unconventional secretion may be used as an alternative route to classical secretion via SP14.
U. maydis is employed as a standard tool in protein biotechnology because of reliable protein folding, posttranslational modification, and secretion efficiencies11,12,13. Nevertheless, protein secretion for each new Trojan horse strain needs to be carefully analyzed as described in the Step 3. It is recommended to perform an initial testing of every newly generated Trojan horse strain by infecting seedlings that are easy to infect and to inspect by microscopic imaging.
SG200 is a solopathogenic strain that does not require mating prior to the Trojan horse experiments and is thus easier to handle. Although the infection efficiency of compatible strains like FB1 and FB2 is higher23, the efficiency of SG200 is sufficient for Trojan horse experiments. Some U. maydis effector proteins are taken up by host cells, while others remain in the apoplast. The differentiation between both groups seems to be a controlled and specific process; however, the underlying mechanisms remain elusive8 and cannot be taken into account when designing an experiment. Therefore, proteins of interest that have to be integrated into the cell wall or that have to act intracellularly are no suitable candidates for the Trojan horse approach.
Since U. maydis is omnipotent in infecting diverse aerial maize tissues, the Trojan horse method can be applied for multiple proteins, in distinct tissues and at different plant developmental stages, such as seedling leaves, adult leaves, tassels, and ears. To name just a few useful applications, the Trojan horse allows testing local overdosage, offside protein effects, or functional characterization of distinct protein domains.
Maintaining an uncontaminated U. maydis culture is crucial for all described experiments since co-infection with a large amount of bacteria triggers the plant&#39;s immune response and alters its reaction towards the protein of interest, thus rendering any results inconclusive. Trojan horse studies in adult leaves, tassels and ears have to be performed with maximally 1.5 mL infection culture as higher volumes may result in tissue damage. Tassel and ear infections can be trained using food color-stained water instead of Ustilago inoculum.

The biotrophic pathogen Ustilago maydis is the causative agent of the corn smut disease1. It infects all aerial parts of maize resulting in large tumors that contain melanized, black spores. On the global level, U. maydis is estimated to cause an annual loss of around 2% of corn yield, while tumors are appreciated as a gastronomical delicacy in Mexico. Plant infection is initiated by an appressorium that secretes cell-wall lysing enzymes to penetrate the first layer of maize epidermal cells. From a primary infection site, U. maydis grows intracellularly and intercellularly, invading one to two cell layers every day1,2. Successful infection results in plant hypertrophy that turns into visible tumors upon five days post infection1,3,4. During all infection stages, fungal hyphae invaginate the plant cytoplasm membrane without any direct contact to the host cytoplasm1,2. The tight apoplasmic space between the infecting hyphae and the plant plasma membrane is considered to be the host/pathogen interactive site, called the biotrophic interaction zone. In order to overcome the plant innate immune system, U. maydis secretes an array of effector proteins into the biotrophic interaction zone1. Some effectors are taken up by plant cells, while others remain in the biotrophic interaction zone5,6,7,8. One apoplastic effector is UmPit2, which interacts with apoplastic maize proteases to prevent the release of the signaling peptide ZmZIP1 from ZmPROZIP by apoplastic protease activity9,10.
Over the last decades, U. maydis became not only a model for fungal genetics in plant-pathogen interaction, but also a valuable tool in biotechnology due to a well-understood life cycle, easy genetic accessibility and heterologous expression of secreted proteins11,12,13. Signals for both conventional and unconventional protein secretion have been determined allowing the control of posttranslational modifications14. Recently, U. maydis was employed as a Trojan horse tool to study small, secreted maize proteins in situ15. The Trojan horse approach was successfully used to analyze the function of the small, secreted protein ZmMAC1 that is involved in anther development. ZmMAC1 induces the periclinal division of pluripotent cells and cell fate specification of the newly formed cells15. By the same method, the biological function of the maize damage-associated peptide ZmZIP1 was revealed. U. maydis secreting the maize ZmZIP1 resulted in impaired tumor formation10. Thus, the Trojan horse approach represents a valuable alternative route to protein in situ studies with high spatiotemporal resolution that does neither require generation of stable maize transformation lines nor tissue infiltration with heterologously expressed and purified proteins. In particular, the Trojan horse strategy enables the secretion of any heterologous protein into the maize apoplast and direct comparison of infected versus non-infected plant cells within the same tissue.
This protocol illustrates the major steps for generating an U. maydis Trojan horse strain to study a protein of interest. It further includes precise information on infection procedures of three different maize tissue types (adult leaves, tassels and ears) with U. maydis, which is a prerequisite for studying the spatiotemporal infection progression and protein function in these target tissues. No further specifications are given on maize gene amplification and microscopic imaging techniques, since these steps are target-specific and instrument-dependent. Thus, this protocol is addressed to experienced users of standard molecular biology techniques.

<table border="0" cellpadding="0" cellspacing="0" style="width:825px;" width="824">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:307px;">2 mL syringe&#160;</td>
			<td style="width:119px;">B. Braun</td>
			<td style="width:89px;">4606027V</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">23G x 1 1/4 hypodermic needle</td>
			<td style="width:119px;">B. Braun</td>
			<td>4657640</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bacto Peptone&#160;</td>
			<td style="width:119px;">BD</td>
			<td>211677</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">cDNA from maize</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">from maize tissue expressing the gene of interrest</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Charcoal</td>
			<td>Sigma-Aldrich</td>
			<td style="width:89px;">05105</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Confocal laser scanning microscope</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">use locally available equipment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Cuvette (10 x 4 x 45 mm)</td>
			<td style="width:119px;">Sarstedt</td>
			<td style="width:89px;">67742</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Incubator-shaker set to 28 &#176;C, 200 rpm</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">use locally available equipment</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">Light microscope with 400-fold magnification</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">use locally available equipment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Nco I</td>
			<td style="width:119px;">NEB</td>
			<td style="width:89px;">R0193</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="49">
			<td height="49" style="height:49px;">p123-PUmpit2-SpUmpit2-Zmmac1-mCherry-Ha</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">please contact the corresponding author&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Pasteur pipet (glass, long tip)</td>
			<td style="width:119px;">VWR</td>
			<td>14673-043</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">pCR-Blunt-II-TOPO</td>
			<td style="width:119px;">Thermo Fisher Scientific</td>
			<td>K280002</td>
			<td style="width:311px;">can be exchanged for other basic cloning vectors like pENTR or pJET</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Potato Dextrose Agar&#160;</td>
			<td style="width:119px;">VWR</td>
			<td style="width:89px;">90000-745</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:307px;">Sharpie pen</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">use locally available equipment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Spectrophotometer</td>
			<td style="width:119px;"></td>
			<td style="width:89px;"></td>
			<td style="width:311px;">use locally available equipment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Ssp I</td>
			<td style="width:119px;">NEB</td>
			<td style="width:89px;">R0132</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sucrose</td>
			<td>Sigma-Aldrich</td>
			<td style="width:89px;">S0389</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">T4 DNA ligase</td>
			<td style="width:119px;">NEB</td>
			<td style="width:89px;">M0202</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">TRIS</td>
			<td>Sigma-Aldrich</td>
			<td style="width:89px;">TRIS-RO</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Xba I</td>
			<td style="width:119px;">NEB</td>
			<td style="width:89px;">R0145</td>
			<td style="width:311px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast extract&#160;</td>
			<td style="width:119px;">BD</td>
			<td>212750</td>
			<td style="width:311px;"></td>
		</tr>
	</tbody>
</table>

using ustilago maydis as a trojan horse for in situ delivery of maize proteins

Inspired by Homer&#180;s Trojan horse myth, we engineered the maize pathogen Ustilago maydis to deliver secreted proteins into the maize apoplast permitting in vivo phenotypic analysis. This method does not rely on maize transformation but exploits microbial genetics and secretory capabilities of pathogens. Herein, it allows inspection of in vivo delivered secreted proteins with high spatiotemporal resolution at different kinds of infection sites and tissues. The Trojan horse strategy can be utilized to transiently complement maize loss-of-function phenotypes, to functionally characterize protein domains, to analyze off-target protein effects, or to study onside protein overdosage, making it a powerful tool for protein studies in the maize crop system. This work contains a precise protocol on how to generate a Trojan horse strain followed by standardized infection protocols to apply this method to three different maize tissue types.

Constructs for U. maydis Trojan horse experiments are cloned into the plasmid p123-PUmpit2-SpUmpit2-gene of interest-mCherry-Ha. The maize gene of interest is fused to a mCherry fluorescence reporter and an epitope HA-tag. The expression of the fusion protein is under control of the U. maydis Umpit2 promoter which is specifically activated during infection21. To direct secretion of the protein of interest peptide into the biotrophic interaction zone, the coding region is fused to the signal peptide sequence of U. maydis Umpit221&#160;(Figure 1). Upon U. maydis transformation, the transgene is inserted into the SG200 ip-locus by homologous recombination, and targeted genome insertion can be verified by Southern blot analysis. Secretion of the fusion protein is confirmed by confocal laser scanning microscopic imaging in seedling leaves infected with a Trojan horse strain (Figure 3). As an example, seedlings infected with either the U. maydis Trojan horse strain SG200Zmmac1 secreting a ZmMAC1-mCHERRY or a non-Trojan horse control strain expressing noSP-Zmmac1-mCHERRY that lacks the Umpit2-SP, and subsequently does not secret the ZmMAC1-mCHERRY-HA protein, are shown in Figure 315. Hyphae secreting ZmMAC1 are surrounded by fluorescent mCherry signal (Figure 3A). In contrast, non-secreting hyphae only show fluorescence signal in the fungal cytoplasm (Figure 3B).
In particular, tassel infection with U. maydis relies on proper tissue inoculation, as described in step 3.5. Improper tassel localization or unequal distribution of the inoculum can result in non-infected tassel (Figure 4A) or only partial infection of the tassel (Figure 4B). To ensure even distribution, the inoculum needs to be slowly released from the inoculation needle to acquire entire tissue infection (Figure 4C). Viability of the inoculum can be verified by placing a droplet on PD-Charcoal agar. Infectious strains form filaments appearing as write fluff on the plate as shown for the solopathogenic Trojan Horse progenitor strain SG200 (Figure 5A) while the U. maydis strain FB1 requires mating before infectious filament formation (Figure 5B).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Primer addition&#160;</td>
			<td>Sequence (5&#180;&#8594;3&#180;)</td>
		</tr>
		<tr>
			<td>Forward</td>
			<td>XbaI-maize gene</td>
			<td>GCTCTAGA&#8230;</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td>NcoI-RSIATA-maize gene</td>
			<td>CATGCCATGGAGGCGGTGGCGATCGAGCG&#8230;.</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of primer additions to add restriction sides and the RSIATA motif coding sequence to the maize gene of interest.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58746/58746fig1.jpg" /> 
Figure 1: Schematic overview of the U. maydis Trojan horse plasmid cloning strategy.&#160;Zmmac1 (light grey) is released by double digest from p123-PUmpit2-SpUmpit2-Zmmac1-mCherry-Ha. In parallel, the gene of interest (yellow) is amplified by PCR. For cloning purpose, forward and reverse primers are designed which include XbaI and NcoI cloning sites and a RSIATA linker (purple). The PCR product is digested with XbaI and NcoI. After ligation, the Trojan horse plasmid contains the following elements: Driven by the Umpit2 promoter, an Umpit2-SP (blue) is fused N-terminally to a maize gene of interest ORF (yellow). At the C-terminus, a RSIATA linker, a mCHERRY reporter gene (red) and an HA epitope tag (green) are fused followed by a stop codon. Prior to U. maydis transformation, the Trojan horse plasmid is digested with SspI to allow homologous integration into the U. maydisip-locus (grey).&#160;&#160;<a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58746/58746fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58746/58746fig2.jpg" /> 
Figure 2: Light-microscopic examination of U. maydis inoculation culture. Several cigar-shaped U. maydis sporidia are visible, some of which undergo budding (indicated by asterisks). No further cells are present which would indicate a contamination of the culture. Scale bar = 20 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58746/58746fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58746/58746fig3.jpg" /> 
Figure 3: In planta confocal laser scanning microscopic imaging of an Ustilago Trojan horse strain. Imaging of the mCherry-fused maize protein ZmMAC1 after maize seedling infection using the Trojan horse strain SG200Zmmac1&#160;(A) or a non-Trojan horse strain SG200Zmmac1-noSP lacking the Umpit2-SP (B). Secreted ZmMAC1-mCHERRY-HA fusion protein is located on the surface of U. maydis hyphae (A)15, indicated by the arrow heads. In SG200Zmmac1-noSP only cytoplasmic localization of ZmMAC1 is visible (B), indicated by the asterisk 15. Scale bars = 5 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58746/58746fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58746/58746fig4.jpg" /> 
Figure 4: Tassel infection with U. maydis. Unsuccessful infection of tassel with U. maydis (A), partial tassel infection (B) and complete tassel infection (C) 12 days after infection are shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58746/58746fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58746/58746fig5.jpg" /> 
Figure 5: Inoculum viability assay on PD-Charcoal agar. The solopathogenic strain SG2001 was used for Trojan horse generation. SG200 is self-stimulating and forms infectious filaments on a PD-Charcoal agar plate (A). The haploid U. maydis strain FB1 requires mating with a compatible strain prior to filamentous growth (B)22. Scale bars = 2 mm.&#160;&#160;<a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58746/58746fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Using Ustilago maydis as a Trojan Horse for In Situ Delivery of Maize Proteins at JoVE.com

Using Ustilago maydis as a Trojan Horse for In Situ Delivery of Maize Proteins

This work describes the cloning of an Ustilago maydis Trojan horse strain for the in situ delivery of secreted maize proteins into three different types of maize tissues.

Using Ustilago maydis as a Trojan Horse for In Situ Delivery of Maize Proteins

Inspired by Homer&#180;s Trojan horse myth, we engineered the maize pathogen Ustilago maydis to deliver secreted proteins into the maize apoplast ...

using-ustilago-maydis-as-trojan-horse-for-situ-delivery-maize

Nanyang Technological University

Research

JoVE Journal

Genetics

11.3K Views.  Regensburg University. This work describes the cloning of an Ustilago maydis Trojan horse strain for the in situ delivery of secreted maize proteins into three different types of maize tissues.

Video: Using Ustilago maydis as a Trojan Horse for In Situ Delivery of Maize Proteins

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Systemic Delivery of MicroRNA Using Recombinant Adeno-associated Virus Serotype 9 to Treat Neuromuscular Diseases in Rodents

RNA interference via the endogenous miRNA pathway regulates gene expression by controlling protein synthesis through post-transcriptional gene silencing. In recent years, miRNA-mediated gene regulation has shown potential for treatment of neurological disorders caused by a toxic gain of function mechanism. However, efficient delivery to target tissues has limited its application. Here we used a transgenic mouse model for spinal and bulbar muscular atrophy (SBMA), a neuromuscular disease caused by polyglutamine expansion in the androgen receptor (AR), to test gene silencing by a newly identified AR-targeting miRNA, miR-298. We overexpressed miR-298 using a recombinant adeno-associated virus (rAAV) serotype 9 vector to facilitate transduction of non-dividing cells. A single tail-vein injection in SBMA mice induced sustained and widespread overexpression of miR-298 in skeletal muscle and motor neurons and resulted in amelioration of the neuromuscular phenotype in the mice.

Here we describe the delivery of microRNA using a recombinant adeno-associated virus serotype 9 in a mouse model of a neuromuscular disease. A single peripheral administration in mice resulted in sustained miRNA overexpression in muscle and motor neurons, providing an opportunity to study miRNA function and therapeutic potential in vivo.

RNA interference via the endogenous miRNA pathway regulates gene expression by controlling protein synthesis through post-transcriptional gene silencing. ...

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice

Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facilitated broad distribution of injected reagents in the cochlea and vestibular end-organs with minimal damage to hearing and vestibular function. The surgery was successfully implemented in both adult and neonatal mice; indeed, multiple surgeries could be performed if required. In conclusion, canalostomy is an effective and safe approach to drug delivery into the inner ears of adult and neonatal mice and may be used to treat human inner ear diseases in the future.

Here we describe canalostomy procedure which allows local drug delivery into the inner ears of adult and neonatal mice through the semicircular canal with minimum damage to hearing and vestibular function. This method can be used to inoculate viral vectors, pharmaceuticals, and small molecules into the mouse inner ear.

Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) ...

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell type-specific fashion. AS expression patterns are typically analyzed by RT-PCR and RNA-seq using RNA samples isolated from a population of cells. In situ examination of AS expression patterns for a particular biological structure can be carried out by RNA in situ hybridization (ISH) using exon-specific probes. However, this particular use of ISH has been limited because alternative exons are generally too short to design exon-specific probes. In this report, the use of BaseScope, a recently developed technology that employs short antisense oligonucleotides in RNA ISH, is described to analyze AS expression patterns in mouse brain sections. Exon 23a of neurofibromatosis type 1 (Nf1) is used as an example to illustrate that short exon-exon junction probes exhibit robust hybridization signals with high specificity in RNA ISH analysis on mouse brain sections. More importantly, signals detected with exon inclusion- and skipping-specific probes can be used to reliably calculate the percent spliced in values of Nf1 exon 23a expression in different anatomical areas of a mouse brain. The experimental protocol and calculation method for AS analysis are presented. The results indicate that BaseScope provides a powerful new tool to assess AS expression patterns in situ.

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

An in situ hybridization (ISH) protocol that uses short antisense oligonucleotides to detect alternative pre-mRNA splicing patterns in mouse brain sections is described.

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell ...

Tissue-specific miRNA Expression Profiling in Mouse Heart Sections Using In Situ Hybridization

micro-RNAs (miRNAs) are single-stranded RNA transcripts that bind to messenger RNAs (mRNAs) and inhibit their translation or promote their degradation. To date, miRNAs have been implicated in a large number of biological and disease processes, which has signified the need for the reliable detection methods of miRNA transcripts. Here, we describe a detailed protocol for digoxigenin-labeled (DIG) Locked Nucleic Acid (LNA) probe-based miRNA detection, combined with protein immunostaining on mouse heart sections. First, we performed an in situ hybridization technique using the probe to identify miRNA-182 expression in heart sections from control and cardiac hypertrophy mice. Next, we performed immunostaining for cardiac Troponin T (cTnT) protein, on the same sections, to co-localize miRNA-182 with the cardiomyocyte cells. Using this protocol, we were able to detect miRNA-182 through an alkaline phosphatase based colorimetric assay, and cTnT through fluorescent staining. This protocol can be used to detect the expression of any miRNA of interest through DIG-labeled LNA probes, and relevant protein expression on mouse heart tissue sections.

Tissue-specific miRNA Expression Profiling in Mouse Heart Sections Using In Situ Hybridization

micro-RNAs (miRNAs) are short and highly homologous RNA sequences, serving as post-transcriptional regulators of messenger RNAs (mRNAs). Current miRNA detection methods vary in sensitivity and specificity. We describe a protocol that combines in situ hybridization and immunostaining for concurrent detection of miRNA and protein molecules on mouse heart tissue sections.

micro-RNAs (miRNAs) are single-stranded RNA transcripts that bind to messenger RNAs (mRNAs) and inhibit their translation or promote their degradation. To ...