We are grateful to the Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of Bern for their support. This work was funded by the Committee for Academic Promotion of Early Career Researchers and gender equality at the Vetsuisse Faculty, University of Bern by 120% model funding awarded to PN. WS and PR are supported by Center for Advanced Studies for Agriculture and Food, Institute for Advanced Studies, Kasetsart University, Bangkok, Thailand under the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission, Ministry of Education, Thailand. We would like to thank Dr. Kwanrawee Sirikanchana for her narration and Piyawatchara Sikarin for editing the video.

The animal use protocol for this study was approved by the Kasetsart University Animal Ethics Committee under permit number ACKU 59-VET-016.
NOTE: Please refer to the Table of Materials for extended information concerning the reagents and equipment suggested for this protocol.
1. Tissue Sample Collection
<ol>
	<li>Euthanize the fish using an overdose of clove oil (the volume depends&#160;on the size of fish and concentration of products, usually more than 3 mL/L). Immerse one-fourth of the forceps and mayo scissors into 95% (v/v) ethanol followed by burning the equipment using an alcohol burner to sterilize the equipment. 
	NOTE: Tricaine methanesulfonate (MS-222) can be used instead of clove oil.</li>
	<li>Find the liver and cut off a small piece (approximately 20-100 mg) or collect 200 &#181;L of mucus using cover glass or surgical blade to remove mucus from anterior to posterior of the tilapia fish and place the samples into a 1.5 mL microcentrifuge tube.</li>
	<li>Process samples immediately, store in a RNA stabilizing solution or move them to -80 &#176;C until further use. 
	NOTE: The biggest task in working with RNA is preparing intact RNA molecules and keeping them undamaged throughout any subsequent handlings. The RNA backbone is innately more sensitive to damage than DNA. Extraction and isolation of total RNA from tissue cells necessitates careful laboratory technique; take all provisions to prevent RNase contamination by wearing gloves, using RNase free water, reagents, equipment, plastic ware, glassware, working space and by using filter tips for pipetting.</li>
</ol>
2. Guanidium Thiocyanate - Phenol - Chloroform Extraction of RNA
<ol>
	<li>Add 1 mL of monophasic solution containing phenol and guanidine isothiocyanate into a tube containing tissue sample from section 1. 
	CAUTION: This solution is very toxic and must be handled with care in a laminar flow hood with protective equipment and by wearing the proper protective eyewear, clothing and safety gloves.</li>
	<li>Grind the tissue sample using a tissue pestle homogenizer until homogenous. 
	NOTE: Samples can also be homogenized using a power homogenizer combined with ceramic beads. Ensure that the tissue sample is completely homogenized before proceeding to the next step or stop the protocol here and store the fully homogenized samples at -80 &#176;C until further use.</li>
	<li>Add 200 &#181;L of chloroform for phase separation. 
	CAUTION Chloroform is a potential narcotic and is extremely hazardous. It should be handled with care in a laminar flow hood with protective equipment as well as by wearing the proper protective eyewear, clothing and safety gloves. As a less toxic alternative, 1-Bromo-3-chloropropane can also be used. 
	NOTE: Scale the volumes up or down where appropriate. For example, if only 500 &#181;L of monophasic solution containing phenol and guanidine isothiocyanate was used, then only add 100 &#181;L of chloroform at this step.
	<ol>
		<li>Mix samples well by inversion&#160;for 15 s.</li>
		<li>Incubate samples for 3 min at room temperature (RT).</li>
	</ol>
	</li>
	<li>Centrifuge for 15 min at 12,000 &#215; g and 4 &#176;C. 
	NOTE: There should be a clear separation into a lower organic phase, a white interphase and an upper aqueous phase containing RNA. This top phase is normally colorless but depending on the type and amount of homogenized tissue, it can have a light pink appearance.</li>
	<li>Transfer the upper aqueous layer (approximately 500 &#181;L) to a fresh microcentrifuge tube without disturbing the interphase. 
	NOTE: do not try to transfer the entire aqueous phase, leave a small amount to prevent any potential contamination of the RNA containing aqueous phase with the organic or interphase.</li>
	<li>Add 1 volume of 100% isopropanol to precipitate the RNA.
	<ol>
		<li>Optionally, if very small amounts of tissue were used, then add 1 &#181;L (5-10 &#181;g) of RNase-free glycogen to each sample to promote efficient RNA precipitation. This will aid the identification of the RNA pellet in step 2.8. 
		NOTE: The glycogen acts as a carrier of the RNA and will prevent small amounts of RNA from sticking to the side of the tube.</li>
		<li>Mix tubes well by inversion several times.</li>
		<li>Store the samples for 2 h to overnight at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Centrifuge samples for 15 min at 12,000 x g and 4 &#176;C.</li>
	<li>Discard the supernatant, being careful not to dislodge the RNA pellet at the bottom of microcentrifuge tube.</li>
	<li>Add 1 mL of 75% ethanol (v/v) and mix RNA samples by inverting the tube several times.</li>
	<li>Centrifuge for 15 min at 10,000 x g and 4 &#176;C. 
	NOTE: The protocol can be stopped here and the samples comprising the RNA pellet in 75% ethanol can be stored at -20 &#176;C until further use.</li>
	<li>Discard the supernatant, being watchful not to dislodge the RNA pellet at the bottom of microcentrifuge tube.
	<ol>
		<li>Optionally, repeat steps 2.9 - 2.11 using 70% ethanol (v/v). Thoroughly washing the RNA pellet will minimize any salt or contaminant carry-over that may interfere will sensitive downstream applications.</li>
	</ol>
	</li>
	<li>Draw out the remaining ethanol using a pipette and then air-dry the RNA pellet at room temperature for no longer than 5 to 10 min. 
	NOTE: over-dried pellets will be difficult to re-suspend.</li>
	<li>Add 30-60 &#181;L of RNase-free water, pre-warmed to 55-60 &#176;C to solubilize the RNA pellet.</li>
	<li>Place the RNA on ice for immediate use or store at -80 &#176;C for later use.</li>
</ol>
3. Quantify RNA Concentration using a Micro-Volume Spectrophotometer
<ol>
	<li>Switch the settings of the spectrophotometer to RNA.</li>
	<li>Use 1-2 &#181;L of RNase-free water as a blank.</li>
	<li>Use 1-2 &#181;L of each RNA sample to assess the RNA quantity.</li>
	<li>Record the readings at 230 nm, 260 nm and 280 nm for each sample.</li>
	<li>Dilute the RNA to 200 ng/&#181;L using RNase-free water.</li>
</ol>
4. Synthesis of complementary DNA (cDNA) using total RNA
<ol>
	<li>Mix 1 &#181;g of total RNA from protocol 2, 2 &#181;M oligo (dT), 0.5 mM dNTPs mixture and bring the final volume to 10 &#181;L with nuclease-free water. For this, prepare a RT-master-mix according to the number of samples and controls to be tested. 
	NOTE: The controls are a minus-reverse transcriptase sample (-RT) wherein the RT enzyme is replaced with nuclease-free water (see step 4.3) and a no template control (NTC) wherein nuclease-free water is added to the master-mix instead of RNA template.
	<ol>
		<li>Mix the samples well by pipetting followed by a brief centrifugation.</li>
	</ol>
	</li>
	<li>Incubate the samples at&#160;65 &#176;C for 5 min followed by a 2 min incubation on ice.
	<ol>
		<li>Briefly centrifuge the samples to collect all of the liquid in the bottom of the tubes.</li>
	</ol>
	</li>
	<li>Add 1x&#160; reverse transcriptase buffer, 100 U reverse transcriptase and bring&#160;the final volume of each sample to 20 &#181;L using nuclease-free water.
	<ol>
		<li>Mix the samples well by pipetting followed by a brief centrifugation.</li>
	</ol>
	</li>
	<li>Incubate the samples at 42&#160;&#176;C for 60 min followed by 85 &#176;C for 5 min.</li>
	<li>Dilute the synthesized cDNA to a desired concentration by adding an appropriate volume of nuclease-free water and place the cDNA on ice for immediate use or store it at -20&#160;&#176;C for later use.</li>
</ol>
5. TiLV Conventional PCR
<ol>
	<li>Use the cDNA, samples and controls, generated in protocol section 4 as templates for a PCR reaction using any of the established primer pairs detailed in Table 1, along with a DNA polymerase of choice. 
	NOTE: An additional no-template control (NTC) should be included here by substituting cDNA for nuclease-free water in the PCR reaction. A positive control, if available, should also be included comprising previously verified TiLV positive samples or the appropriate TiLV cDNA fragment cloned in to a plasmid.</li>
	<li>Prepare a PCR master-mix according to the guidelines of the DNA polymerase system in use and the number of samples and controls to be tested. This mix should include the forward primer, reverse primer, dNTPs, MgCl2 and the selected DNA polymerase, along with its buffer.</li>
	<li>According to the guidelines of the selected DNA polymerase, combine the designated volume of master-mix with suggested amount of cDNA samples and control samples. 
	NOTE: Preparing a 0.5x reaction excess is often beneficial since some of the master-mix is lost during pipetting.</li>
	<li>Perform PCR cycling conditions according to the guidelines of the utilized DNA polymerase system and using an appropriate annealing temperature for the primers in use (Table 1). Usually, such a program will involve an initial denaturation at 95 &#176;C for 2-5 min, followed by 30-40 cycles of denaturation at 95 &#176;C for 30 s, annealing at the recommended temperature for 30 s and elongation at 72 &#176;C for 30 s, followed by a final elongation at 72 &#176;C for 5-10 min.</li>
	<li>Load 5-15 &#181;L of each PCR reaction and an appropriate DNA ladder in to wells of a 1-2% agarose gel, depending on the expected PCR product size. Separate the amplified DNA by gel electrophoresis and stain the gel by ethidium bromide (EthBr) to facilitate visualisation of DNA bands of the expected size (Table 1) in a gel documentation machine using UV light. 
	CAUTION: EtBr is toxic; it should be handled with care by wearing the proper protective clothing and safety gloves.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target TiLV genome segment</td>
			<td colspan="3">Forward primer 
			5&#39; - 3&#39;</td>
			<td colspan="3">Reverse primer 
			5&#39; - 3&#39;</td>
			<td>PCR product size (bp)</td>
			<td>Tm 
			&#176;C</td>
			<td>Original reference</td>
		</tr>
		<tr>
			<td>1</td>
			<td colspan="3">CCAAACGTTATCTCTTAATTACGCAC</td>
			<td colspan="3">GCAAATATTTCTCTCATTCGCCT</td>
			<td>1641</td>
			<td>50</td>
			<td>Surachetpong&#160; et al., 2017</td>
		</tr>
		<tr>
			<td>1</td>
			<td colspan="3">CCTCATTCCTCGTTGTGTAAGT</td>
			<td colspan="3">AGGAGTTGCTGTTGGGTTATAG</td>
			<td>1000</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>2</td>
			<td colspan="3">ACTCTCTATTACCAAATACATTTACT</td>
			<td colspan="3">TTACCATATATATAGTGAAGGC</td>
			<td>1445</td>
			<td>45</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>2</td>
			<td colspan="3">GTCCAGGGCGGTATGTATTG</td>
			<td colspan="3">CTTACGGCTGACAAGTCTCTAAG</td>
			<td>834</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="3">GTTGGGCACAAGGCATCCTA</td>
			<td colspan="3">TATCACGTGCGTACTCGTTCAGT</td>
			<td>250</td>
			<td>56</td>
			<td>Eyngor et al., 2014</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="3">TATGCAGTACTTTCCCTGCC</td>
			<td colspan="3">TTGCTCTGAGCAAGAGTACC</td>
			<td>491</td>
			<td>57</td>
			<td>Eyngor et al., 2014</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="3">ACCCCTTAATCCTTAATAGACCGTTA</td>
			<td colspan="3">CCCATAATCCTCTATTAGAACGTCGT</td>
			<td>1352</td>
			<td>50</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="3">GTCGAGGCATTCCAGAAGTAAG</td>
			<td colspan="3">GAGCTAAGGGAACGGCTATTG</td>
			<td>834</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>4</td>
			<td colspan="3">AGCAGCAGCAGGAGAAAGAG</td>
			<td colspan="3">ACCGTCCTGTTTCTGAATGG</td>
			<td>358</td>
			<td>60</td>
			<td>Nicholson et al., 2017</td>
		</tr>
		<tr>
			<td>4</td>
			<td colspan="3">CCAAAGTTTACTCCTATTACCCAGA</td>
			<td colspan="3">GCAAATCTTTCTCCAATTACCGTCT</td>
			<td>1250</td>
			<td>50</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>4</td>
			<td colspan="3">GCCCAATGGTTCCCATATCT</td>
			<td colspan="3">GCCCAATGGTTCCCATATCT</td>
			<td>524</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="3">CCAAATGTTTCTCTTATCTCAGACTC</td>
			<td colspan="3">CTTTTTCTCAGTTTACCACTTTATG</td>
			<td>1087</td>
			<td>57</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="3">CAACTCTTAGCCTCCGGAATAC</td>
			<td colspan="3">CGTTCTGCACTGGGTTACA</td>
			<td>696</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>6</td>
			<td colspan="3">CCAAATTTTACCTCTCGCAT</td>
			<td colspan="3">TCAAGCACTTAAAACTGTACC</td>
			<td>1027</td>
			<td>45</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>6</td>
			<td colspan="3">CCCACACGACAGGACATATAG</td>
			<td colspan="3">GAGTTGGCTTAGGGTGATAAGA</td>
			<td>948</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>7</td>
			<td colspan="3">CTCTCTTTGCATTGCATACCGT</td>
			<td colspan="3">GACCAATTATCCCTGCTTTCA</td>
			<td>704</td>
			<td>57</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>7</td>
			<td colspan="3">TCCTTTAGGGATTGGCACTAAC</td>
			<td colspan="3">TTCCATCGACTGCTCCTAGA</td>
			<td>486</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>8</td>
			<td colspan="3">ACCTCATCTACACTAACATTTCCA</td>
			<td colspan="3">TCATCATTACACAAATGGAGTAGCT</td>
			<td>637</td>
			<td>50</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>8</td>
			<td colspan="3">CTTAAGGGCCATCCTGTCATC</td>
			<td colspan="3">TGGCTCAAATCCCAACACTAA</td>
			<td>476</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>9</td>
			<td colspan="3">TTGGTGATGTCACGATGGATA</td>
			<td colspan="3">AGTTCTATCGCCAGCCATGT</td>
			<td>351</td>
			<td>60</td>
			<td>Nicholson et al., 2017</td>
		</tr>
		<tr>
			<td>9</td>
			<td colspan="3">ACAAGTCCGATTACTTTTTCCGC</td>
			<td colspan="3">TCTTTCTCACGTCCTTAAAGTCA</td>
			<td>530</td>
			<td>50</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>9</td>
			<td colspan="3">GATATCCTCCACATGACCCTTC</td>
			<td colspan="3">GTACGTCACTTTGTGCCATTAC</td>
			<td>261</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
		<tr>
			<td>10</td>
			<td colspan="3">AACCCTACTAACACCAAATATAGCT</td>
			<td colspan="3">CTTTCCCTCTGACACCCTGT</td>
			<td>450</td>
			<td>50</td>
			<td>Surachetpong et al., 2017</td>
		</tr>
		<tr>
			<td>10</td>
			<td colspan="3">TCCTCTCTGTCCCTTCTGTT</td>
			<td colspan="3">CAGGATGAGTGTGGCAGATTAT</td>
			<td>276</td>
			<td>62</td>
			<td>Mugimba et al., 2018</td>
		</tr>
	</tbody>
</table>
Table 1. Published primer pairs for the amplification of TiLV cDNA using endpoint PCR. The primer set shown in bold were used to generate the representative results shown in Figure 3A and 3B.
6. TiLV Quantitative Polymerase Chain Reaction (qPCR)
<ol>
	<li>Using a plasmid containing the appropriate TiLV genomic segment 3 cDNA as a standard, such as pTiLV32, prepare a duplicated or triplicated 10-fold serial dilution series.</li>
	<li>Prepare a qPCR master-mix for all samples, standards and controls, taking into account that the reactions should be performed in duplicate or triplicate utilizing 0.4 &#181;L of nuclease-free water, 0.3 &#181;L of forward primer, 0.3 &#181;L of reverse primer and 5 &#181;L of 2x SYBR Green DNA polymerase master-mix per reaction.
	<ol>
		<li>Use the primers at a concentration of 10 &#181;M, and the primer information and the standard pTiLV as follows: 
		Forward primer: TiLV-112F (5&#39;-CTGAGCTAAAGAGGCAATATGGATT-3&#39;) 
		Reverse primer:TiLV-112R (5&#39;-CGTGCGTACTCGTTCAGTATAAGTTCT-3&#39;) 
		Standard pTiLV:10 pg/&#181;L 
		NOTE: If the total number of samples and controls is 10 and will be performed in triplicates, this equates to a qPCR master-mix comprising 12 &#181;L nuclease-free water, 9 &#181;L forward primer, 9 &#181;L reverse primer and 150 &#181;L of SYBR Green DNA polymerase master-mix. Commercially purchased 2x universal SYBR Green DNA polymerase master-mixes contain all the necessary components for the qPCR reaction, namely, the SYBR Green I dye, hot-start Taq DNA polymerase, dNTPs, MgCl2 and passive reference dyes. Protect the SYBR Green master mix from light.</li>
	</ol>
	</li>
	<li>Dispense 6 &#181;L of the qPCR master-mix into qPCR strip tubes or a 96 well plate compatible with the qPCR machine in use.</li>
	<li>Add 4 &#181;L of cDNA template, controls or serially diluted TiLV standards into the tubes or wells of the 96 well plate.</li>
	<li>Close the qPCR tubes or seal the 96 well plate with a compatible plate cover for the qPCR machine in use
	<ol>
		<li>Gently flick the qPCR tubes to mix the solution and spin down the qPCR tubes or 96 well plate using a centrifuge to collect all of the liquid in the bottom of the vessels.</li>
	</ol>
	</li>
	<li>Place the tubes or plate into the real-time thermal cycler.
	<ol>
		<li>Program the qPCR thermocycler to perform an initial denaturation at 95 &#176;C for 3 min, followed by 40 cycles of 95 &#176;C for 10 s and 60 &#176;C for 30 s for primer annealing and elongation, ending with a melting curve step of 65 &#176;C to 95 &#176;C with an increment of 0.5 &#176;C/ 5 s.</li>
		<li>Select SYBR as a fluorophore dye, then select unknown as a sample type and insert a name into a sample name box.</li>
		<li>Open the lid of the RT-qPCR machine and place the qPCR strip into the assigned wells, then close the lid.</li>
	</ol>
	</li>
	<li>Perform the RT-qPCR assay with the selected conditions. The machine will start to run after the lid has reached the desired temperature. Collect the fluorescence of each sample after each extension step to monitor the progress of the reaction. 
	NOTE: The qPCR machine and related software will automatically calculate all parameters of the assay and display the amplification curves in real-time, while the standard curve and melting curve will be generated at the end of qPCR cycle.</li>
	<li>Perform data analysis and acquisition by first ensuring that the melting curves for each sample and standard have one uniform peak at the expected temperature for the amplicon.
	<ol>
		<li>Evaluate the amplification curves of the samples and standards and set the threshold in a region were the amplification rate of the cDNAs is the same in all samples. This is normally performed automatically by the software but should be carefully checked.</li>
		<li>Calculate the number of TiLV copies using the standard curve.</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

TiLV was first reported in 2014 in Israel14 and since then, it has been identified in multiple countries including Egypt, Colombia, India, Malaysia, Uganda, Tanzania and Thailand15,16,18,35,48. Global awareness, particularly, in tilapia producing countries has placed more attention on the virus and various restrictions and control measures from government authorities have been implemented attempting to prevent the spread of TiLV. Here, a detailed protocol for TiLV detection in tilapia tissue, covering sample collection, RNA isolation, cDNA synthesis, PCR and qPCR assays has been explained. There are various aspects to these methods that warrant specific discussion. TiLV has been identified in fish spanning a variety sizes9,12,14,15,49 and species of tilapia so far, including farmed hybrid tilapia (O. niloticus x O. aureus)11,14, Nile tilapia (O. niloticus)9,10,14,15,16,33,35,36,49,50 and red tilapia (Oreochromis sp.)16,33,48,51, as well as in wild Nile tilapia9,12, black tilapia51, T. zilli14,15, S. galilaeus, O. aureus and T. simonis intermedia14 and very recently TiLV was identified in wild carp (Barbonymus schwanenfeldii)52. Tissue samples from internal organs (gill, spleen, liver, heart, head kidney) or mucus37 can be collected from healthy as well as moribund tilapia regardless of age, size or species and processed for RNA isolation. The total RNA extraction protocol outlined here uses a monophasic solution of phenol and guanidinium thiocyanate, which is a chaotropic denaturing agent. The tissues are directly homogenized in this solution followed by the addition of chloroform and centrifugation to achieve phase separation wherein a clear RNA containing upper aqueous phase, an interphase and a lower organic phase is generated. The RNA is isolated from the aqueous phase by isopropanol precipitation, followed by washing of the recovered RNA to get rid of contaminants. Isolation of RNA by this methodology was pioneered by Piotr Chomczynski and Nicoletta Sacchi and was referred to as guanidinium thiocyanate-phenol-chloroform extraction53,54. This type of reagent used for RNA extraction can be commercially purchased or made in the laboratory (see the Table of Materials for further information). This protocol takes slightly longer than column-based methods such as the silica-based purification, but in general, it is more cost effective and yields more RNA.
In this protocol, quantifying RNA using A260 values was outlined whereby spectrophotometry values can indicate RNA quality (A260/A280 = 1.9 - 2.1). While this method will give a good indication of sample purity, it cannot absolutely inform about the quality of the extracted RNA. To properly determine whether the RNA is intact or partially degraded, samples can be separation by agarose gel electrophoresis wherein smearing of the EtBr stained 18S and 28S rRNA bands indicate RNA degradation. Further verification of RNA quality may include using a lab-on-a-chip instrument. Furthermore, it is also important to digest the purified RNA with DNase I to remove contaminating host genomic DNA, which depending on the downstream applications may lead to false results. If host gDNA is still contaminating the RNA sample to a large extent, an additional DNaseI treatment can also be performed at the end of the RNA extraction procedure (see Table of Materials).
Complementary DNA synthesis can greatly affect the overall qPCR results and is an aspect of the method that can introduce variation. The cDNA protocol advocated here comprises of a single component set-up using oligo (dT) and thus only transcribes mRNAs containing polyA tails. It allows the user control of exactly which components to use in the reverse transcription reaction and this mode of cDNA synthesis has proved successful for TiLV detection32.&#160;An alternative to this set-up is a commercially bought master-mix containing all components required for the reverse transcription reaction and is very fast and simple without the usual multi-step, pipetting and multi-temperature protocol. This is advantageous because it minimizes handling and promotes uniformity across all samples. Such master-mixes often include both oligo(dT)&#160;and random primers making it applicable to different RNA templates and generating representative cDNA copies of sequences from the entire length of the RNAs in a population (viral and tilapia host mRNA) and in theory, every desired RNA species can then be measured by conventional PCR or qPCR from such a sample. This versatility is the main advantage of a 2-step RT-PCR approach; it provides a long-term pool that can be used for many different experiments. In the results, a one-step RT-PCR approach has been represented wherein sequence specific primers (Table 1) were used and the RT and PCR were performed in one tube (see material list). In general, sequence specific primers allow for a higher RT efficiency of the specific target RNA than using random priming, but the specific target RNA is the only one that can be quantified in such a cDNA sample which may be the only aim of certain laboratories (see Table of Materials&#160;for cDNA synthesis product suggestions).
While conventional RT-PCR appears to be commonly used so far in the TiLV diagnosis9,13,14,15,16,17,18,33,35,48,55. RT-qPCR has been shown to be a more powerful tool for the detection and quantification of small amounts of TiLV in fish tissues or mucus32,37. In general, qPCR is widely used in clinical virology diagnostic labs due to its high sensitivity, specificity, good reproducibility, wide dynamic range and speed21. While qPCR may be initially more expensive to implement than conventional RT-PCR, it does offer many important advantages over conventional PCR; it has a faster turn-around time from sample to results and it does not require any post-PCR steps. This latter point means that there is minimal risk for laboratory contamination and it can be more easily adapted to high-throughput situations such as in the event of outbreaks. Furthermore, it is inherently more sensitive than conventional RT-PCR, which is of vital importance to detect low viral loads in sub-clinical infections21. This would require a nested PCR approach requiring reverse transcription, two further PCR reactions and then analysis by agarose gel electrophoresis. These many steps take a lot of time and increase the chances of errors or contamination. Nonetheless, due to its high sensitivity, RT-qPCR demands meticulous experimental design and a thorough understanding of quantification techniques for generating precise results56,57.
The DNA binding fluorophore, SYBR Green I has been demonstrated in this protocol. It is a dsDNA unspecific DNA binding dye and thus the specificity of the assay lies entirely in the set of primers, which may generate false positives58. Therefore, while the dsDNA melting curve analysis performed at the end of each PCR is an especially important part of the PCR reaction because it confirms that only one PCR amplicon of the correct Tm is produced (this should also be achieved by gel electrophoresis when new assays are being implemented). The Tm of a DNA fragment is dependent on a variety of features such as its length, GC composition, sequence, strand complementarity, concentration as well as on buffer components and PCR enhancers. The melting curve analyses in the representative results shown from two laboratories did not reveal the presence of primer-dimers or other unwanted PCR products but if this is observed with other samples and/or experimental set-ups, then the assay should be re-optimized. More advanced qPCR technologies do not require such a melting curve step and indeed, since this methods paper was written, a TaqMan based TiLV RT-qPCR has been developed utilizing two primers and a probe making it highly TiLV specific34.
Undoubtedly, the primers designed for RT-qPCR assays are fundamental to the success of assay and the primers here were designed based upon the publicly available TiLV genomic data at the time32. However, RNA viruses are well-known to exhibit high mutation rates and possible strains will escape the current diagnostic tests, as was observed for ISAV59. It will always be difficult for such virus types to generate a universal pan-TiLV RT-qPCR assay and such assays will only be continually improved if more TiLV genomic data from far-reaching locations and time periods become available.
Finally,&#160;it is essential to run duplicate or if possible, triplicate reactions in both intra and inter qPCR assays. If the Ct values are very high, then the use of replicates is especially important to ascertain that the PCR reaction is reliable and reproducible. In general, if data from replicate reactions varies more than 0.5 cycles, the reactions should be repeated and if the Ct values consistently vary &#62; 0.5 cycles in replicates, the assay should be re-optimized. The use of an integrated qPCR pipetting robot helps immensely with this issue, but it is a luxury tool. As with any experiment, the inclusion adequate and appropriate controls are of utmost importance to the development of robust molecular assays, especially in diagnostic laboratories where such assays have to be accredited. Controls should include positive (positive TiLV sample, TiLV plasmid standard) and negative controls (NTC and -RT) samples as well as the detection of endogenous tilapia housekeeping genes. Such controls cannot be underestimated and should be included in each assay to properly understand the quality of each step of the assay and to properly interpret the results.

The global capita fish supply reached a new record of 20 kg in 2014 and this was due to vigorous growth in aquaculture. Aquaculture remains one of the fastest growing animal food producing sectors worldwide and is the only animal food producing sector that is growing faster than the human population1. Tilapiine cichilds comprise the second most important fresh water fish farmed worldwide with a total global production of 6.4 million tons (MT) and an estimated value of 9.8 billion US dollars in 20152. The top ten producers of tilapia are China (1.78 MT), Indonesia (1.12 MT) and Egypt (0.88 MT), followed by Bangladesh, Vietnam, the Philippines, Brazil, Thailand, Colombia and Uganda2. It is expected that global tilapia production will be around 7.3 MT by 20303. Tilapia have become such an important global food source not only because they are an inexpensive source of protein4 but also because they are easy to breed in capacity under a wide range of water and climate conditions5,6. Just a few decades ago, it was believed that there were few commercially significant diseases threatening tilapia farming but this is no longer true. An emerging viral disease called tilapia lake virus disease (TiLVD) is the first ever critical disease epidemic found in tilapia and the entire industry is at risk. This disease has serious socio-economic consequences and is a direct threat on food security for millions of people in Africa7, Asia and South America. At the start of 2018, the World Organization for Animal Health (OIE) reported that the etiological agent of this disease, TiLV, had been officially detected on three continents covering eight countries8 and since this pathogen information card was updated there have been more reports of TiLV in Tanzania, Uganda9, Indonesia10, Taiwan11 and Peru12. TiLV is a novel single-stranded RNA virus described to be an orthomyxo-like virus because it contains a variety of characteristics reminiscent of other orthomyoxoviruses such as Influenza or Infectious salmon anaemia virus (ISAV)13. It was first identified in the aftermath of massive losses of wild and farmed tilapia in the Lake of Galilee, Israel14. Thereafter, similar disease outbreaks referred to as summer mortalities and the one month mortality syndrome associated with TiLV infection were reported in Nile tilapia (Oreochromis niloticus) in Egypt15 and Nile and red hybrid tilapia (Oreochromis spp.) in Thailand16, respectively. Detection of aquatic animal viruses is historically carried out by growth and isolation of viruses in cell culture. Various cell lines have been tested for the propagation and isolation of TiLV including, E-11 cells derived from snakehead fish (Ophiocephalus striatus)17,18, OmB and TmB originating from Oreochromis mossambicus18, and OnlB and OnlL originating from Nile tilapia (O. niloticus)19. While virus culture has the advantage that it provides material for further experiments, it has the disadvantage that it requires at least 4-7 days to observe the formation of cytopathic effects (CPE) and crucially, different piscine viruses, that are more fit to replicate may be propagated and produce similar CPE.
In the last few decades, there has been a move away from traditional, often time-consuming diagnostic methods such as cell culture, serology and antigen detection and replacement with faster and more sensitive nucleic acid based detection tests20,21. This is evident by the fact that many qPCR assays have been developed as important diagnostic methods for a multitude of viral diseases in aquatic animals, such as for ISAV22,23, viral haemorrhagic septicaemia virus (VHSV)24,25, betanodavirus26,27 salmonid alphavirus28, fish iridovirus29, Anguillid herpesvirus 1 (AngHV1)30, and Lymphocystis disease virus (LCDV)31. Robust methods for diagnosis and pathogen surveillance are urgently required to reduce the spread of TiLV. Such methods should allow early detection of infection before clinical signs develop and detection of low virus loads. To date, different PCR protocols including RT-PCR14,32, nested RT-PCR18, semi-nested RT-PCR33, and RT-qPCR32,34 have been developed for the detection of TiLV in fish tissues. A comparison of RT-qPCR and virus isolation in susceptible cell lines for TiLV detection revealed that RT-qPCR was 1,000 times more sensitive than the virus isolation32. Although each published PCR protocol has reported different sensitivities for the detection of TiLV, most assays are highly sensitive with the detection limits of viral copies at 7.5 copies33, 7 copies18 or 2 copies32 per reaction.
The aim of this methods article is to explain, in detail, how to perform TiLV detection assays, starting with tilapia tissue collection, to total RNA extraction, cDNA synthesis and then TiLV specific PCR based assays. Specifically, comprehensive protocols of both conventional RT-PCR and also SYBR green-based RT-qPCR have been described to appeal to a wide range of scientists aiming to detect TiLV. The former is less sensitive but is typically a cheaper detection option. The latter requires more elaborate infrastructure such as a quantitative PCR machine and more expensive reagents, but it has the advantages of being quantitative, fast and highly sensitive, meaning that it can be used for the detection of TiLV in sub-clinically infected fish. The RT-PCR and RT-qPCR protocols were performed in two different laboratories with distinct geographical isolates of TiLV and the included results highlight the sensitivity and reproducibility of the assays described here.

<table><tbody><tr><td>&lt;strong&gt;Tissue collection&lt;/strong&gt;</td><td></td><td></td><td>Step 1</td></tr><tr><td>Tricaine methanesulfonate</td><td>Sigma-Aldrich</td><td>E10521</td><td>An alternative to clove oil.&amp;nbsp;&lt;br/&gt; Step 1.1</td></tr><tr><td>RNAlater stabilization solution</td><td>Thermo Fisher Scientific</td><td>&amp;nbsp; AM7020</td><td>For storing tissues if they cannot be processed immediately&lt;br/&gt; Step 1.3</td></tr><tr><td>&lt;strong&gt;RNA extraction&lt;/strong&gt;</td><td></td><td></td><td>Step 2</td></tr><tr><td>TRIreagent</td><td>Sigma-Aldrich&amp;nbsp;</td><td></td><td>Step 2.1</td></tr><tr><td>TRIzol</td><td>Thermo Fisher Scientific (Invitrogen)</td><td>15596026</td><td>Step 2.1</td></tr><tr><td>GENEzol</td><td>Geneaid</td><td>GZR100</td><td>Step 2.1</td></tr><tr><td>Trisure</td><td>Bioline</td><td>BIO-38032</td><td>Step 2.1</td></tr><tr><td>Homemade solution</td><td>&amp;nbsp;-</td><td>&amp;nbsp;-</td><td>94.53 g/L (800 mM) guanidine thiocyanate&lt;br/&gt; 30.45 g/L&amp;nbsp; (400 mM) ammonium thiocyanate&lt;br/&gt; 8.20 g/L&amp;nbsp; (100 mM) sodium acetate&lt;br/&gt; 380 mL/L&amp;nbsp; (38 % v/v) phenol&lt;br/&gt; 50 mL/L (5 % v/v) glycerol&lt;br/&gt; 1.0 g/L (0.1 % w/v) 8-quinolinol, pH 5.0&lt;br/&gt; Store up to 2 years at 4&lt;sup&gt;o&lt;/sup&gt;C&lt;br/&gt; Step 2.1</td></tr><tr><td>MagNA Lyser Green Beads</td><td>Roche</td><td>3358941001</td><td>An alternative tissue homogenization method used in conjunction with tissue lysing machines detailed below&lt;br/&gt; Step 2.2</td></tr><tr><td>Lysing Matrix D, 2 mL Tube</td><td>MP BIOMEDICALS</td><td>116913050</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>C2432</td><td>Step 2.3</td></tr><tr><td>Chloroform</td><td>RCI Labscan</td><td>AR1027E-G2.5L</td><td>Step 2.3</td></tr><tr><td>1-Bromo-3-chloropropane</td><td>Sigma-Aldrich</td><td>B9673</td><td>A less toxic alternative to chloroform&lt;br/&gt; Step 2.3</td></tr><tr><td>Isopropanol (GC) &amp;ge; 99.8 %</td><td>Sigma-Aldrich</td><td>59300</td><td>Step 2.6</td></tr><tr><td>Isopropanol (ACS, ISO Reag. Ph Eur)</td><td>Merck KGaA (EMSURE)</td><td>1.09634.2500</td><td>Step 2.6</td></tr><tr><td>Glycogen, molecular biology grade (e.g., Sigma, cat. no. G1767)</td><td>Thermo Fisher Scientific (Thermo Scientific)</td><td>R0551</td><td>Useful step if tissue starting material is small to maximise RNA precipitation&lt;br/&gt; optional</td></tr><tr><td>Ethanol (purity (GC) &amp;ge; 99.9 %</td><td>Sigma-Aldrich (EMD Millipore)</td><td>1.00983</td><td>Step 2.9</td></tr><tr><td>Ethanol (ACS, ISO Reag. Ph Eur)</td><td>Merck (EMSURE)</td><td>1.00983.2500</td><td>Step 2.9</td></tr><tr><td>Nuclease-free water</td><td>Promega</td><td>P1193</td><td>Step 2.13</td></tr><tr><td>Nuclease-free water</td><td>Multicell</td><td>809-115-CL</td><td>Step 2.13</td></tr><tr><td>Ambion TURBO DNA-free kit&amp;nbsp;</td><td>Thermo Fisher Scientific (Invitrogen)</td><td>AM1907</td><td>Can be performed at the end of the RNA extraction protocol&lt;br/&gt; optional</td></tr><tr><td>&lt;strong&gt;cDNA synthesis&lt;/strong&gt;</td><td></td><td></td><td>Step 4</td></tr><tr><td>Viva cDNA Synthesis Kit</td><td>Vivantis</td><td>cDSK01</td><td>Step 4.1 &amp;amp; 4.3</td></tr><tr><td>ReverTra Ace qPCR RT MasterMix with gDNA remover</td><td>Toyobo</td><td>A1172K</td><td>An alternative option&amp;nbsp;&lt;br/&gt; see discussion</td></tr><tr><td>ReverTra Ace qPCR RT Kit</td><td>Toyobo</td><td>FSQ-101</td><td>An alternative option&amp;nbsp;&lt;br/&gt; see discussion</td></tr><tr><td>AffinityScript Multiple Temperature Reverse Transcriptase&amp;nbsp;</td><td>Agilent Technologies</td><td>600107</td><td>An alternative option&amp;nbsp;</td></tr><tr><td>&lt;strong&gt;PCR&lt;/strong&gt;</td><td></td><td></td><td>Step 5</td></tr><tr><td>&lt;em&gt;&lt;strong&gt;DNA polymerase systems:&lt;/strong&gt;&lt;/em&gt;</td><td></td><td></td><td>Step 5.2</td></tr><tr><td>&amp;nbsp;&amp;nbsp; - Platinum II Hot-Start Green PCR Master Mix (2X)&amp;nbsp;</td><td>Thermo Fisher Scientific (Invitrogen)&amp;nbsp;</td><td>14001012a</td><td>Step 5.2</td></tr><tr><td>&amp;nbsp;&amp;nbsp; - GoTaq Mastermix</td><td>Promega</td><td>M7122</td><td>Step 5.2</td></tr><tr><td>&lt;em&gt;&lt;strong&gt;Separate PCR mixture components:&lt;/strong&gt;&lt;/em&gt;</td><td></td><td></td><td>Step 5.2</td></tr><tr><td>10mM dNTP Mix</td><td>Vivantis</td><td>NP2409</td><td>Step 5.2</td></tr><tr><td>25mM MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Thermo Fisher Scientific</td><td>R0971</td><td>Step 5.2</td></tr><tr><td>10X Taq Buffer with KCl</td><td>Thermo Fisher Scientific</td><td>00348114</td><td>Step 5.2</td></tr><tr><td>Taq DNA polymerase</td><td>Vivantis</td><td>PL1202</td><td>Step 5.2</td></tr><tr><td>&amp;nbsp;&amp;nbsp; - Verso 1-step RT-PCR ReddyMix with ThermoPrime Taq</td><td>Thermo Fisher Scientific&amp;nbsp;</td><td>AB1454</td><td>One step RT-PCR exemplified in Figure 3B</td></tr><tr><td>&lt;em&gt;&lt;strong&gt;Gel electrophoresis:&lt;/strong&gt;&lt;/em&gt;</td><td></td><td></td><td>For visulation of PCR products from steps 5.1-5.4</td></tr><tr><td>Ethidium Bromide solution (10 mg/mL)</td><td>Thermo Fisher Scientific</td><td>17898</td><td>Step 5.5</td></tr><tr><td>Tris/Acetic/EDTA (TAE) buffer:</td><td></td><td></td><td>Step 5.5</td></tr><tr><td>&amp;nbsp;&amp;nbsp; - Tris</td><td>Vivantis</td><td>PR0612-1KG</td><td>Step 5.5</td></tr><tr><td>&amp;nbsp;&amp;nbsp; - Acetic acid (glacial) (ACS, ISO, Reag. Ph Eur)</td><td>Merck KGaA (EMSURE)</td><td>1.00063.2500</td><td>Step 5.5</td></tr><tr><td>&amp;nbsp;&amp;nbsp; - Ethylenediaminetetraacetic acid (EDTA)</td><td>BIO-RAD</td><td>161-0729</td><td>Step 5.5</td></tr><tr><td>Agarose</td><td>Vivantis</td><td>PC0701-100G</td><td>Step 5.5</td></tr><tr><td>DNA ladders and markers</td><td>Vivantis</td><td>NL1405</td><td>Step 5.5</td></tr><tr><td>DNA gel loading dye (6X)</td><td>Thermo Fisher Scientific</td><td>R0611</td><td>Step 5.5</td></tr><tr><td>&lt;strong&gt;qPCR&lt;/strong&gt;</td><td></td><td></td><td>Step 6</td></tr><tr><td>PowerUP SYBR Green Master Mix</td><td>Thermo Fisher Scientific (Applied Biosystems)</td><td>A25779</td><td>Exemplified in Figures 4-6B&lt;br/&gt; Step 6.2</td></tr><tr><td>iTaq Universal SYBR Green Supermix</td><td>BIO-RAD</td><td>1725120</td><td>Exemplified in the video and in Figures 4-6A&lt;br/&gt; Step 6.2</td></tr><tr><td>&lt;strong&gt;Equipment&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Dounce tissue grinder pestle</td><td>Sigma-Aldrich</td><td>P1110</td><td>Protocol 2</td></tr><tr><td>MagNA Lyser Instrument</td><td>Roche</td><td>3358976001</td><td>An alternative tissue homogenizing option for protocol 2 which are used in conjunction with the lysing beads detailed above&lt;br/&gt; Step 2.2</td></tr><tr><td>FastPrep-24 5G Homogenizer</td><td>MP BIOMEDICALS</td><td>116005500</td><td></td></tr><tr><td>Refrigerated microcentrifuge</td><td>Eppendorf</td><td>Eppendorf 5427R</td><td>Protocol 2&lt;br/&gt; Step&amp;nbsp;2.4, 2.7 &amp;amp; 2.10</td></tr><tr><td>Refrigerated microcentrifuge</td><td>Eppendorf</td><td>Eppendorf 5418R</td><td></td></tr><tr><td>Heat box</td><td>Labnet</td><td>AccuBlock Digital Dry Bath</td><td>Protocol 2&lt;br/&gt; Step 2.13</td></tr><tr><td>Microvolume spectrophotometer&amp;nbsp;</td><td>Thermo Fisher Scientific (Applied Biosystems)</td><td>Nanodrop 2000</td><td>Protocol 3&lt;br/&gt; Step 3.1 - 3.4</td></tr><tr><td>PCR machine</td><td>BIO-RAD</td><td>T100 Thermal Cycler</td><td>Protocol 5&lt;br/&gt; Step 5.4</td></tr><tr><td>Power supply</td><td>BIO-RAD</td><td>PowerPac HC</td><td>Protocol 5&lt;br/&gt; Step 5.5</td></tr><tr><td>Horizontal gel electrophoresis</td><td>BIO-RAD</td><td>Mini ReadySub-Cell GT Cell #1704487edu</td><td>Protocol 5&lt;br/&gt; Step 5.5</td></tr><tr><td>Mini microcentrifuge</td><td>Corning</td><td>LSE 6766</td><td>Useful to quickly spin down PCR reaction tubes in protocols 4, 5 &amp;amp; 6&lt;br/&gt; Step 6.5.1</td></tr><tr><td>Microcentrifuge</td><td>LioFuge</td><td>LM-60</td><td>Step 6.5.1</td></tr><tr><td>qPCR machine and software</td><td>Thermo Fisher Scientific</td><td>7500 Fast Real-Time PCR System with 7500 Software v2.0</td><td>Protocol 6&lt;br/&gt; Step 6.6-6.8</td></tr><tr><td>qPCR machine and software</td><td>BIO-RAD</td><td>CFX96 Touch Real-Time PCR Detection System with CFX Manager software</td><td></td></tr><tr><td>&lt;strong&gt;General Materials&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Mayo scissors</td><td></td><td></td><td>Step 1.1-1.2</td></tr><tr><td>Forceps</td><td></td><td></td><td>Step 1.1-1.2</td></tr><tr><td>Pipette</td><td>Rainin</td><td>Pipette-Lite XLS</td><td></td></tr><tr><td>Aerosol-barrier pipette tips</td><td>Sigma-Aldrich</td><td>Z333328, Z333336, Z333344</td><td></td></tr><tr><td>Nuclease-free 1.5-ml microcentrifuge tubes</td><td>Eppendorf</td><td></td><td></td></tr></tbody></table>

detection of tilapia lake virus using conventional rt-pcr and sybr green rt-qpcr

The aim of this method is to facilitate the fast, sensitive and specific detection of Tilapia Lake Virus (TiLV) in tilapia tissues. This protocol can be used as part of surveillance programs, biosecurity measures and in TiLV basic research laboratories. The gold standard of virus diagnostics typically involves virus isolation followed by complementary techniques such as reverse-transcription polymerase chain reaction (RT-PCR) for further verification. This can be cumbersome, time-consuming and typically requires tissue samples heavily infected with virus. The use of RT-quantitative (q)PCR in the detection of viruses is advantageous because of its quantitative nature, high sensitivity, specificity, scalability and its rapid time to result. Here, the entire method of PCR based approaches for TiLV detection is described, from tilapia organ sectioning, total ribonucleic acid (RNA) extraction using a guanidium thiocyanate-phenol-chloroform solution, RNA quantification, followed by a two-step PCR protocol entailing, complementary deoxyribonucleic acid (cDNA) synthesis and detection of TiLV by either conventional PCR or quantitative identification via qPCR using SYBR green I dye. Conventional PCR requires post-PCR steps and will simply inform about the presence of the virus. The latter approach will allow for absolute quantification of TiLV down to as little as 2 copies and thus is exceptionally useful for TiLV diagnosis in sub-clinical cases. A detailed description of the two PCR approaches, representative results from two laboratories and a thorough discussion of the critical parameters of both have been included to ensure that researchers and diagnosticians find their most suitable and applicable method of TiLV detection.

Watch this Scientific Journal Video about Detection of Tilapia Lake Virus Using Conventional RT-PCR and SYBR Green RT-qPCR at JoVE.com

Detection of Tilapia Lake Virus Using Conventional RT-PCR and SYBR Green RT-qPCR

This protocol diagnoses Tilapia Lake Virus (TiLV) in tilapia tissues using RT-PCR methodologies. The entire method is described from tissue dissection to total RNA extraction, followed by cDNA synthesis and detection of TiLV by either conventional PCR or quantitative PCR using dsDNA binding a fluorescent binding dye.

The aim of this method is to facilitate the fast, sensitive and specific detection of Tilapia Lake Virus (TiLV) in tilapia tissues. This protocol can be ...

detection-tilapia-lake-virus-using-conventional-rt-pcr-sybr-green-rt

Nanyang Technological University

Research

JoVE Journal

Environment

26.9K Views.  University of Bern. This protocol diagnoses Tilapia Lake Virus (TiLV) in tilapia tissues using RT-PCR methodologies. The entire method is described from tissue dissection to total RNA extraction, followed by cDNA synthesis and detection of TiLV by either conventional PCR or quantitative PCR using dsDNA binding a fluorescent binding dye.

Video: Detection of Tilapia Lake Virus Using Conventional RT-PCR and SYBR Green RT-qPCR

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Detection and Genogrouping of Noroviruses from Children's Stools By Taqman One-step RT-PCR

Noroviruses (NoVs) are the leading cause of outbreaks of sporadic acute gastroenteritis worldwide in humans of all ages. They are important cause of hospitalizations in children with a public health impact similar to that of Rotavirus. NoVs are RNA viruses of great genetic diversity and there is a continuous appearance of new strains. Five genogroups are recognized; GI and GII with their many genotypes and subtypes being the most important for human infection. However, the diagnosis of these two genotypes remains problematic, delaying diagnosis and treatment. 1, 2, 3
For RNA extraction from stool specimens the most commonly used method is the QIAmp Viral RNA commercial kit from Qiagen. This method combines the binding properties of a silica gel membrane, buffers that control RNases and provide optimum binding of the RNA to the column together with the speed of microspin. This method is simple, fast and reliable and is carried out in a few steps that are detailed in the description provided by the manufacturer. 
 Norovirus is second only to rotavirus as the most common cause of diarrhea. Norovirus diagnosis should be available in all studies on pathogenesis of diarrhea as well as in outbreaks or individual diarrhea cases. At present however norovirus diagnosis is restricted to only a few centers due to the lack of simple methods of diagnosis. This delays diagnosis and treatment 1, 2, 3. In addition, due to costs and regulated transportation of corrosive buffers within and between countries use of these manufactured kits poses logistical problems. As a result, in this protocol we describe an alternative, economic, in-house method which is based on the original Boom et al. method4 which uses the nucleic acid binding properties of silica particles together with the anti-nuclease properties of guanidinium thiocyanate.
For the detection and genogrouping (GI and GII) of NoVs isolates from stool specimens, several RT-PCR protocols utilizing different targets have been developed. The consensus is that an RT-PCR using TaqMan chemistry would be the best molecular technique for diagnosis, because it combines high sensitivity, specificity and reproducibility with high throughput and ease of use. Here we describe an assay targeting the open reading frame 1 (ORF1)-ORF2 junction region; the most conserved region of the NoV genome and hence most suitable for diagnosis. For further genetic analysis a conventional RT-PCR that targets the highly variable N-terminal-shell from the major protein of the capsid (Region C) using primers originally described by Kojima et al. 5 is detailed. Sequencing of the PCR product from the conventional PCR enables the differentiation of genotypes belonging to the GI and GII genogroups.

A One-Step RT-PCR assay for detection and genogroup identification of Norovirus isolates from children&#x2019;s stools, that utilizes primers and TaqMan probes specific to the open reading frame 1 (ORF1)-ORF2 junction region, the most conserved region of the Norovirus genome is described. A non-commercial, cost-effective RNA extraction method is detailed.

Noroviruses (NoVs) are the leading cause of outbreaks of sporadic acute gastroenteritis worldwide in humans of all ages. They are important cause of ...

Medicine

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Biochemistry

Measuring Dengue Virus RNA in the Culture Supernatant of Infected Cells by Real-time Quantitative Polymerase Chain Reaction

At present, real-time polymerase chain reaction (PCR) technology is an indispensable tool for the detection and quantification of viral genomes in research laboratories, as well as for molecular diagnosis, because of its sensitivity, specificity, and convenience. However, in most cases, the quantitative PCR (qPCR) assay generally used to detect virus infection has relied on the purification of viral nucleic acid prior to the PCR step. In this study, the fluorescence-based reverse transcription qPCR (RT-qPCR) assay is developed through the combination of a processing buffer and a one-step RT-PCR reagent so that the whole process, from the harvest of the culture supernatant of virus-infected cells until real-time detection, can be performed without viral RNA purification. The established protocol enables the quantification of a wide range of RNA concentrations of dengue virus (DENV) within 90 min. In addition, the adaptability of the direct RT-qPCR assay to the evaluation of an antiviral agent is demonstrated by an in vitro experiment using a previously reported DENV inhibitor, mycophenolic acid (MPA). Moreover, other RNA viruses, including yellow fever virus (YFV), Chikungunya virus (CHIKV), and measles virus (MeV), can be quantified by direct RT-qPCR with the same protocol. Therefore, the direct RT-qPCR assay described in this report is useful for monitoring RNA virus replication in a simple and rapid manner, which will be further developed into a promising platform for a high-throughput screening study and clinical diagnosis.

Real-time quantitative polymerase chain reaction analysis combined with reverse transcription (RT-qPCR) has been widely used to measure the level of RNA virus infections. Here we present a direct RT-qPCR assay, which does not require an RNA purification step, developed for the quantification of several RNA viruses, including dengue virus.

At present, real-time polymerase chain reaction (PCR) technology is an indispensable tool for the detection and quantification of viral genomes in ...

Immunology and Infection

Pan-lyssavirus Real Time RT-PCR for Rabies Diagnosis

Molecular assays are rapid, sensitive and specific, and have become central to diagnosing rabies. PCR based assays have been utilized for decades to confirm rabies diagnosis but have only recently been accepted by the OIE (World Organisation for Animal Health) as a primary method to detect rabies infection. Real-time RT-PCR assays provide real-time data, and are closed-tube systems, minimizing the risk of contamination during setup. DNA intercalating fluorochrome real-time RT-PCR assays do not require expensive probes, minimizing the cost per sample, and when the primers are designed in conserved regions, assays that are specific across virus genera rather than specific to just one virus species are possible. Here we describe a pan-lyssavirus SYBR real-time RT-PCR assay that detects lyssaviruses across the Lyssavirus genus, including the most divergent viruses IKOV, WCBV and LLEBV. In conjunction with dissociation curve analysis, this assay is sensitive and specific, with the advantage of detecting all lyssavirus species. The assay has been adopted in many diagnostic laboratories with quality assured environments, enabling robust, rapid, sensitive diagnosis of animal and human rabies cases.

This real-time RT-PCR using dsDNA intercalating dye is suitable to diagnose lyssavirus infections. The method begins with RNA extracted from rabies suspected ante-mortem or post-mortem samples, detailing master mix preparation, RNA addition, setup of the real-time machine and correct interpretation of results.

Molecular assays are rapid, sensitive and specific, and have become central to diagnosing rabies. PCR based assays have been utilized for decades to ...

Field Postmortem Rabies Rapid Immunochromatographic Diagnostic Test for Resource-Limited Settings with Further Molecular Applications

Functional rabies surveillance systems are crucial to provide reliable data and increase the political commitment necessary for disease control. To date, animals suspected as rabies-positive must be submitted to a postmortem confirmation using classical or molecular laboratory methods. However, most endemic areas are in low- and middle-income countries where animal rabies diagnosis is restricted to central veterinary laboratories. Poor availability of surveillance infrastructure leads to serious disease underreporting from remote areas. Several diagnostic protocols requiring low technical expertise have been recently developed, providing opportunity to establish rabies diagnosis in decentralized laboratories. We present here a complete protocol for field postmortem diagnosis of animal rabies using a rapid immunochromatographic diagnostic test (RIDT), from brain biopsy sampling to the final interpretation. We complete the protocol by describing a further use of the device for molecular analysis and viral genotyping. RIDT easily detects rabies virus and other lyssaviruses in brain samples. The principle of such tests is simple: brain material is applied on a test strip where gold conjugated antibodies bind specifically to rabies antigens. The antigen-antibody complexes bind further to fixed antibodies on the test line, resulting in a clearly visible purple line. The virus is inactivated in the test strip, but viral RNA can be subsequently extracted. This allows the test strip, rather than the infectious brain sample, to be safely and easily sent to an equipped laboratory for confirmation and molecular typing. Based on a modification of the manufacturer&#39;s protocol, we found increased test sensitivity, reaching 98% compared to the gold standard reference method, the direct immunofluorescence antibody test. The advantages of the test are numerous: rapid, easy-to-use, low cost and no requirement for laboratory infrastructure, such as microscopy or cold-chain compliance. RIDTs represent a useful alternative for areas where reference diagnostic methods are not available.

We present a complete protocol for postmortem diagnosis of animal rabies under field conditions using a rapid immunochromatographic diagnostic test (RIDT), from brain biopsy sampling to final interpretation. We also describe further applications using the device for molecular analysis and viral genotyping.

Functional rabies surveillance systems are crucial to provide reliable data and increase the political commitment necessary for disease control. To date, ...

Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for the Specific and Rapid Detection of Tilapia Lake Virus

Tilapia lake virus disease (TiLVD), an emerging viral disease in tilapia caused by the tilapia lake virus (TiLV), is a persistent challenge in the aquaculture industry that has resulted in the mass morbidity and mortality of tilapia in many parts of the world. An effective, rapid, and accurate diagnostic assay for TiLV infection is therefore necessary to detect the initial infection and to prevent the spread of the disease in aquaculture farming. In this study, a highly sensitive and practical reverse transcription loop-mediated isothermal amplification (RT-LAMP) method is presented to detect tilapia lake virus in fish tissue. A comparison of the RT-qPCR and RT-LAMP assays of infected samples revealed positive results in 63 (100%) and 51 (80.95%) samples, respectively. Moreover, an analysis of uninfected samples showed that all 63 uninfected tissues yielded negative results for both the RT-qPCR and RT-LAMP assays. The cross-reactivity with five pathogens in tilapia was evaluated using RT-LAMP, and all the tests showed negative results. Both the liver and mucus samples obtained from infected fish showed comparable results using the RT-LAMP method, suggesting that mucus can be used in RT-LAMP as a nonlethal assay to avoid killing fish. In conclusion, the results demonstrated that the presented RT-LAMP assay provides an effective method for TiLV detection in tilapia tissue within 1 h. The method is therefore recommended as a screening tool on farms for the rapid diagnosis of TiLV.

Reverse Transcription Loop-Mediated Isothermal Amplification RT-LAMP Assay for the Specific and Rapid Detection of Tilapia Lake Virus

We present an RT-LAMP assay for the detection of TiLV in tilapia fish using simple instruments over a relatively short period of time compared to conventional RT-PCR techniques. This protocol may help control the epidemic spread of TiLVD, especially in developing countries.

Tilapia lake virus disease (TiLVD), an emerging viral disease in tilapia caused by the tilapia lake virus (TiLV), is a persistent challenge in the ...

Using Colorimetric and RT-LAMP Analysis to Detect SARS-CoV-2 

Detecting SARS-CoV-2 Virus by Reverse Transcription-Loop-Mediated Isothermal Amplification

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus has dramatically impacted human health. It continues to be a threat to modern society because many people die as a result of infection. The disease is diagnosed using serologic and molecular tests, such as the gold standard real-time polymerase chain reaction (RT-PCR). The last has several disadvantages because it requires specialized infrastructure, costly equipment, and trained personnel. Here, we present a protocol outlining the steps required to detect the SARS-CoV-2 virus using reverse transcription-loop-mediated isothermal amplification (RT-LAMP) in human samples. The protocol includes instructions for designing primers in silico, preparing reagents, amplification, and visualization. Once standardized, this method can be easily implemented and adapted to any laboratory or point-of-care within 60 min at a low cost and using inexpensive equipment. It is adaptable to detecting different pathogens. Thus, it can potentially be used in the field and in health centers to carry out timely epidemiological surveillance.

Author Spotlight: Advancing Pathogen Diagnostics with Standardized LAMP

Here we provide a complete protocol to standardize and implement the method for detecting the SARS-CoV-2 virus in human samples by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method, done within 60 min, could be adapted to any laboratory or point-of-care at a low cost and using inexpensive equipment.

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus has dramatically impacted human health. It continues to be a threat to modern ...

Biology

Multiplex RT-qPCR Assay for Respiratory Virus Detection

Development of Multiplex Real-Time RT-qPCR Assays for the Detection of SARS-CoV-2, Influenza A/B, and MERS-CoV

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that causes Coronavirus disease 2019 (COVID-19) is a serious threat to the general public&#39;s health. During influenza seasons, the spread of SARS-CoV-2 and other respiratory viruses may cause a population-wide burden of respiratory disease that is difficult to manage. For that, the respiratory viruses SARS-CoV-2, Influenza A, Influenza B, and Middle East respiratory syndrome (MERS-CoV) will need to be carefully watched over in the upcoming fall and winter seasons, particularly in the case of SARS-CoV-2, Influenza A, and Influenza B, which share similar epidemiological factors like susceptible populations, mode of transmission, and clinical syndromes. Without target-specific assays, it can be challenging to differentiate among cases of these viruses owing to their similarities. Accordingly, a sensitive and targeted multiplex assay that can easily differentiate between these viral targets will be useful for healthcare practitioners. In this study, we developed a real-time reverse transcriptase-PCR-based assay utilizing an in-house developed R3T one-step RT-qPCR kit for simultaneous detection of SARS-CoV-2, Influenza A, Influenza B, and SARS-CoV-2, MERS-CoV. With as few as 10 copies of their synthetic RNAs, we can successfully identify SARS-CoV-2, Influenza A, Influenza B, and MERS-CoV targets simultaneously with 100% specificity. This assay is found to be accurate, reliable, simple, sensitive, and specific. The developed method can be used as an optimized SARS-CoV-2, Influenza A, Influenza B, and SARS-CoV-2, MERS-CoV diagnostic assay in hospitals, medical centers, and diagnostic laboratories as well as for research purposes.

Author Spotlight: Advancements in Multiplex Detection of Respiratory Viruses 

We present two probe-based in-house one-step RT-qPCR kits for common respiratory viruses. The first assay is for SARS-CoV-2 (N), Influenza A (H1N1 and H3N2), and Influenza B. The second is for SARS-Cov-2 (N) and MERS (UpE and ORF1a). These assays can be successfully implemented in any specialized laboratory.

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that causes Coronavirus disease 2019 (COVID-19) is a serious threat to the general ...

RNA Analysis of Environmental Samples Using RT-PCR

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - The University of Arizona 
Demonstrating Author: Bradley Schmitz
Reverse transcription-polymerase chain reaction (RT-PCR) involves the same process as conventional PCR &#8212; cycling temperature to amplify nucleic acids. However, while conventional PCR only amplifies deoxyribonucleic acids (DNA), RT-PCR enables the amplification of ribonucleic acids (RNA) through the formation of complementary DNA (cDNA). This enables RNA-based organisms found within the environment to be analyzed utilizing methods and technologies that are designed for DNA.
Many viruses found in the environment use RNA as their genetic material. Several RNA-based viral pathogens, such as Norovirus, and indicator organisms, such as pepper mild mottle virus (PMMoV), do not have culture-based detection methods for quantification. In order to detect for the presence of these RNA viruses in environmental samples from soil, water, agriculture, etc., molecular assays rely on RT-PCR to convert RNA into DNA. Without RT-PCR, microbiologists would not be able to assay and research numerous RNA-based viruses that pose risks to human and environmental health.
RT-PCR can also be employed as a tool to measure microbial activity in the environment. Messenger RNA (mRNA) is the single-stranded template for protein translation, and measuring the levels of different mRNAs indicates which genes from which microbes are being expressed within the environment. Analyzing gene expression gives clues to what biological pathways are used by organisms to survive in different environmental conditions. In some cases, gene expression can be utilized to determine which organisms may survive best in harsh conditions and have capabilities for bioremediation of contaminated soil or water.