We thank Dr. Alexandre Mourot for his comments on the manuscript. This work was supported by grants from the Agence Nationale de la Recherche (ANR 2011 MALZ 003 01; ANR-15-CE16-0010 and ANR-17-CE37-0010-03), BLG is supported by fellowship from the Fondation pour la Recherche sur Alzheimer. We thank the animal facility of the IBPS (Paris, France).

The authors have nothing to disclose.

Single cell multiplex RT-PCR after patch-clamp can simultaneously and reliably probe the expression of more than 30 genes in electrophysiologically identified cells5. Analyzing gene expression at the single cell level requires highly efficient PCR primers. One of the most limiting steps is collection of the cell&#39;s content. Its efficiency depends on the diameter of the patch pipette tip, which must be as large as possible while matching the cell size. Pipettes with a 1-2 &#181;m open tip diameter were proven to be suitable for most neuronal types. It is also essential to make sure that only the cellular content is collected, and not the surrounding tissue. This is achieved by controlling electrophysiologically the preservation of a tight seal during the harvest. The formation of an outside-out patch configuration during pipette withdrawal further protects the harvested cytoplasm from cellular debris. The success rate of the single cell multiplex RT-PCR also depends on mRNAs abundance of the investigated cell type. For instance, the yield obtained with astrocytes, which express mRNAs in relatively low amounts3, is generally lower than the one obtained with neurons and thus requires increasing sample size15,16. Reverse transcription, which has a low efficiency in tubes48, is the limiting reaction of single cell multiplex RT-PCR. It is therefore critical to use top quality reagents, to store them as aliquots at -80 &#176;C, and to use them only for one day. Finally, the DNA polymerase activity of the RTase is often an overlooked source of primer-dimer formation. To address this issue, performing a hot start with primers is critical to increase the amplification efficiency. In addition this will reduce the inhibitory effect of RTase on the Taq DNA polymerase activity49.
The single cell multiplex RT-PCR technique is highly versatile. It has been extensively used in rodents10,11,13,19,20,34,50,51,52,53,54 but can be adapted to virtually all animal models and genes assuming that tissue and gene sequences are available. Various patch-clamp solutions can be used as long as they do not interfere with the RT-PCR on cell free assays. For instance internal solutions based on K+ or Cs+ cations, Cl- or gluconate have been successfully used6,36,41,55.
Classical false negative results stem from RNase contamination of the patch pipette filament and/or internal patch-clamp solution. Carefully chlorinating the filament and validating the internal solution generally solve this problem. False negative results can also occur when a gene is expressed at a low single cell level, since only a proportion of the cytoplasm is harvested. The harvesting quality can be increased by using larger pipettes and/or by reducing the time of the whole-cell recording. Harvesting quality can be assessed by including a gene known to be expressed at a low&#160;level in single cells20. False positive results can occur with bad tissue quality, in which the amount of contaminating cellular debris is high. Testing the presence of debris is done by inserting a patch pipette into the slice without performing any seal and releasing the positive pressure prior to the pipette removal. The presence of amplifiable materials is then probed by multiplex RT-PCR42. Silanizing the patch pipette has also been used to reduce the collection of extracellular contaminants56. Single cell PCR is a very sensitive technique that can detect as little as a single copy of double stranded DNA57. In the case of intron-less genes, the gDNA contained in the nucleus can also produce false positives. Avoiding the collection of gDNA by placing the pipette away from the nucleus during the harvesting helps to solve this issue. The presence of gDNA can be reliably probed by amplifying an intronic sequence25.
The detection of mRNA molecules by RT-PCR becomes unreliable at 10 copies44, presumably because of the low efficiency of the RTase48, and can lead to an under detection of low-abundance transcripts26,42. This can be problematic in the case of intron-less genes. Indeed, avoiding harvest of the nucleus reduces the amount of cytoplasm that can be collected and therefore the detection sensitivity. The combination of single-cell RT-PCR after patch-clamp with biocytin labeling requires that the shape of the cell is maintained as much as possible (Figure 3). Unavoidably, this reduces the amount of material that can be collected, thereby reducing the success rate. A compromise between cytoplasm collection and preservation of cell morphology is mandatory.
Multiplex single-cell RT-PCR data are not quantitative as they only give information on whether cDNAs are present or absent in the collected material. However, because of the detection limits described above, the occurrence of detection at the population level can reflect the abundance of genes at the single cell level. Alternative approaches allow the generation of more quantitative data, but the technical constraints imposed by their specific amplification strategies (i.e., relative quantification of homologous genes or RT-qPCR) largely restrict the number of genes that can be simultaneously analyzed41,53,55,58,59,60,61,62,63,64,65,66. The recent combination of patch-clamp recordings and single cell RNaseq, referred to as Patch-seq30,31, allows quantitative transcriptomic analysis of electrophysiologically-characterized cells. It is a new and promising approach, yet it requires access to high-throughput sequencers and the data generated require time consuming analysis.

The cerebral cortex comprises numerous cell types involved in various physiological processes. Their identification and characterization, a prerequisite to the understanding of their specific functions, can be very challenging given the large morphological, physiological, and molecular diversity that characterizes cortical cell types1,2,3,4.
Single-cell multiplex RT-PCR is based on the combination of patch-clamp and RT-PCR techniques. It can probe simultaneously the expression of more than 30 predefined genes in electrophysiologically identified cells5. The inclusion of a neuronal tracer in the recording pipette further allows the morphological characterization of the recorded cells after histochemical revelation6,7,8,9,10. It is a very useful technique for the classification of neuronal types based on multivariate analysis of their phenotypic traits5,9,10,11,12,13,14. Single cell multiplex RT-PCR is also suited to the characterization of non-neuronal cells such as astrocytes15,16,17, and can be virtually applied to every brain structure18,19,20,21,22,23 and cell type, assuming they can be recorded in whole-cell configuration.
This technique is very convenient for the identification of cellular sources and/or targets of transmission systems7,8,15,16,20,21,24,25,26,27,28, especially when specific antibodies are lacking. It relies on patch-clamp recordings from visually identified cells29, and thus also allows the targeting of cells in a specific cellular environment8,15,16. Furthermore since the cytoarchitecture of brain tissue is preserved in brain slices, this approach also enables study of the anatomical relationships of the characterized cells with neuronal and non-neuronal elements7,8,18.
Since this technique is limited by the amount of harvested cytoplasm and by the efficiency of the RT, the detection of mRNA expressed at low copy number can be difficult. Although other approaches based on RNaseq technology allow to analyze the whole transcriptome of single cells3,4,30,31, they need high-throughput expensive sequencers not necessarily available to every laboratory. Since the single cell multiplex RT-PCR technique uses end-point PCR, it only requires widely available thermocyclers. It can be easily developed in laboratories equipped with electrophysiological set-ups and does not require expensive equipment. It can provide, within one day, a qualitative analysis of the expression of a predefined set of genes. Thus, this approach offers an easy access to the molecular characterization of single cells in a rapid manner.

<table><tbody><tr><td>MACAW v.2.0.5</td><td>NCBI</td><td></td><td>Multiple alignement for primer design</td></tr><tr><td>Dithiothreitol</td><td>VWR</td><td>443852A</td><td>RT</td></tr><tr><td>Random primers</td><td>Sigma-Aldrich (Merck)</td><td>11034731001</td><td>RT</td></tr><tr><td>dNTPs</td><td>GE Healthcare Life Sciences</td><td>28-4065-52</td><td>RT and PCR</td></tr><tr><td>RNasin Ribonuclease Inhibitors</td><td>Promega</td><td>N2511</td><td>RT</td></tr><tr><td>SuperScript II Reverse Transcriptase</td><td>Invitrogen</td><td>18064014</td><td>RT</td></tr><tr><td>Taq DNA Polymerase</td><td>Qiagen</td><td>201205</td><td>PCR</td></tr><tr><td>Mineral Oil</td><td>Sigma-Aldrich (Merck)</td><td>M5904-5ML</td><td>PCR</td></tr><tr><td>PCR primers</td><td>Sigma-Aldrich (Merck)</td><td></td><td>PCR / desalted and diluted at 200 &amp;micro;M</td></tr><tr><td>Tubes, 0.5 mL, flat cap</td><td>ThermoFisher Scientific</td><td>AB0350</td><td>RT and PCR</td></tr><tr><td>BT10 Series - 10 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT10</td><td>RT and PCR</td></tr><tr><td>BT20 Series - 20 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT20</td><td>RT and PCR</td></tr><tr><td>BT200 Series - 200 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT200</td><td>RT and PCR</td></tr><tr><td>BT1000 Series - 1000 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT1000.96</td><td>RT and PCR</td></tr><tr><td>DNA Thermal Cylcer</td><td>Perkin Elmer Cetus</td><td></td><td>PCR</td></tr><tr><td>Ethidium Bromide</td><td>Sigma-Aldrich (Merck)</td><td>E1510-10ML</td><td>Agarose gel electrophoresis</td></tr><tr><td>Tris-Borate-EDTA buffer</td><td>Sigma-Aldrich (Merck)</td><td>T4415-1L</td><td>Agarose gel electrophoresis</td></tr><tr><td>UltraPure Agarose</td><td>Life Technologies</td><td>16500-500</td><td>Agarose gel electrophoresis</td></tr><tr><td>&amp;Phi;X174 DNA-Hae III Digest</td><td>NEB (New England BioLabs)</td><td>N3026S</td><td>Agarose gel electrophoresis</td></tr><tr><td>EDA 290</td><td>Kodak</td><td></td><td>Agarose gel electrophoresis</td></tr><tr><td>Electrophoresis Power supply EPS 3500</td><td>Pharmacia Biotech</td><td></td><td>Agarose gel electrophoresis</td></tr><tr><td>Midi Horizontal Elecrophoresis Unit Model SHU13</td><td>Sigma-Aldrich (Merck)</td><td></td><td>Agarose gel electrophoresis</td></tr><tr><td>Smooth paper with satin appearance</td><td>Fisherbrand</td><td>1748B</td><td>Patch clamp internal solution</td></tr><tr><td>Potassium Hydroxyde</td><td>Sigma-Aldrich (Merck)</td><td>60377</td><td>Patch clamp internal solution</td></tr><tr><td>Ethylene glycol-bis(2-aminoethylether)-N,N,N&amp;prime;,N&amp;prime;-tetraacetic acid</td><td>Sigma-Aldrich (Merck)</td><td>E3889</td><td>Patch clamp internal solution</td></tr><tr><td>HEPES</td><td>Sigma-Aldrich (Merck)</td><td>H4034</td><td>Patch clamp internal solution</td></tr><tr><td>Potassium D-gluconate</td><td>Sigma-Aldrich (Merck)</td><td>G4500</td><td>Patch clamp internal solution</td></tr><tr><td>Magnesium chloride solution</td><td>Sigma-Aldrich (Merck)</td><td>M1028</td><td>Patch clamp internal solution</td></tr><tr><td>5500 Vapor Pressure Osmometer</td><td>Wescor</td><td></td><td>Patch clamp internal solution</td></tr><tr><td>Biocytin</td><td>Sigma-Aldrich (Merck)</td><td>B4261</td><td>Patch clamp internal solution</td></tr><tr><td>Sucrose</td><td>Sigma-Aldrich (Merck)</td><td>S5016</td><td>Slice preparation</td></tr><tr><td>D-(+)-Glucose monohydrate</td><td>Sigma-Aldrich (Merck)</td><td>49159</td><td>Slice preparation</td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich (Merck)</td><td>S6191</td><td>Slice preparation</td></tr><tr><td>Potassium chloride</td><td>Sigma-Aldrich (Merck)</td><td>60128</td><td>Slice preparation</td></tr><tr><td>Sodium bicarbonate</td><td>Sigma-Aldrich (Merck)</td><td>31437-M</td><td>Slice preparation</td></tr><tr><td>Sodium phosphate monobasic</td><td>Sigma-Aldrich (Merck)</td><td>S5011</td><td>Slice preparation</td></tr><tr><td>Magnesium chloride solution</td><td>Sigma-Aldrich (Merck)</td><td>63069</td><td>Slice preparation</td></tr><tr><td>Calcium chloride solution</td><td>Sigma-Aldrich (Merck)</td><td>21115</td><td>Slice preparation</td></tr><tr><td>Kynurenic acid</td><td>Sigma-Aldrich (Merck)</td><td>K3375</td><td>Slice preparation</td></tr><tr><td>Isoflurane</td><td>Piramal Healthcare UK</td><td></td><td>Slice preparation</td></tr><tr><td>VT 1000S</td><td>Leica Biosystems</td><td>14047235613</td><td>Slice preparation</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma-Aldrich (Merck)</td><td>H1009</td><td>Patch Clamp set-up cleaning</td></tr><tr><td>Thin Wall Glass Capillaries with filament</td><td>World Precision Instruments</td><td>TW150F-4</td><td>Patch Clamp</td></tr><tr><td>PP-83</td><td>Narishige</td><td></td><td>Patch Clamp</td></tr><tr><td>Eppendorf Microloader</td><td>Eppendorf</td><td>5242956003</td><td>Patch Clamp</td></tr><tr><td>BX51WI Upright microscope</td><td>Olympus</td><td></td><td>Patch Clamp</td></tr><tr><td>XC-ST70/CE CCD B/W VIDEO CAMERA</td><td>Sony</td><td></td><td>Patch Clamp</td></tr><tr><td>Axopatch 200B Amplifier</td><td>Molecular Devices</td><td></td><td>Patch Clamp</td></tr><tr><td>Digidata 1440</td><td>Molecular Devices</td><td></td><td>Patch Clamp</td></tr><tr><td>pCLAMP 10 software suite</td><td>Molecular Devices</td><td></td><td>Patch Clamp</td></tr><tr><td>10 mL syringe</td><td>Terumo</td><td>SS-10ES</td><td>Expelling</td></tr><tr><td>E Series with Straight Body (Holder)</td><td>Phymep</td><td>64-0997</td><td>Expelling</td></tr><tr><td>Sodium phosphate dibasic</td><td>Sigma-Aldrich (Merck)</td><td>S7907</td><td>Histochemical revelation</td></tr><tr><td>Sodium phosphate monobasic</td><td>Sigma-Aldrich (Merck)</td><td>S8282</td><td>Histochemical revelation</td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich (Merck)</td><td>P6148</td><td>Histochemical revelation</td></tr><tr><td>Triton X-100</td><td>Sigma-Aldrich (Merck)</td><td>X100</td><td>Histochemical revelation</td></tr><tr><td>Gelatin from cold water fish skin</td><td>Sigma-Aldrich (Merck)</td><td>G7041</td><td>Histochemical revelation</td></tr><tr><td>Streptavidin, Alexa Fluor 488 conjugate</td><td>ThermoFisher Scientific</td><td>S11223</td><td>Histochemical revelation</td></tr><tr><td>24-well plate</td><td>Greiner Bio-One</td><td>662160</td><td>Histochemical revelation</td></tr></tbody></table>

single cell multiplex reverse transcription polymerase chain reaction after patch-clamp

The cerebral cortex is composed of numerous cell types exhibiting various morphological, physiological, and molecular features. This diversity hampers easy identification and characterization of these cell types, prerequisites to study their specific functions. This article describes the multiplex single cell reverse transcription polymerase chain reaction (RT-PCR) protocol, which allows, after patch-clamp recording in slices, to detect simultaneously the expression of tens of genes in a single cell. This simple method can be implemented with morphological characterization and is widely applicable to determine the phenotypic traits of various cell types and their particular cellular environment, such as in the vicinity of blood vessels. The principle of this protocol is to record a cell with the patch-clamp technique, to harvest and reverse transcribe its cytoplasmic content, and to detect qualitatively the expression of a predefined set of genes by multiplex PCR. It requires a careful design of PCR primers and intracellular patch-clamp solution compatible with RT-PCR. To ensure a selective and reliable transcript detection, this technique also requires appropriate controls from cytoplasm harvesting to amplification steps. Although precautions discussed here must be strictly followed, virtually any electrophysiological laboratory can use the multiplex single cell RT-PCR technique.

A representative validation of multiplex RT-PCR is shown in Figure 3. The protocol was designed to probe simultaneously the expression of 12 different genes. The vesicular glutamate transporter vGluT1 was taken as a positive control for glutamatergic neurons42. The GABA synthesizing enzymes (GAD65 and GAD 67), Neuropeptide Y (NPY), and Somatostatin (SOM) were used as markers of GABAergic interneurons3,5,11. The cyclooxygenase-2 enzyme (COX-2) was used as a marker of the pyramidal cell sub-population3,16.
The ATP1&#945;1-3 subunits of the Na+/K+ ATPase and the Kir6.2 and SUR1 subunits of the ATP-sensitive K+ channels were chosen to evaluate the relationship between neuronal activity and metabolic states43. Since Kir6.2 is an intron-less gene, the SOM intron was included as a genomic control. The protocol has been tested on 1 ng of reverse transcribed total RNA extracted from mouse whole brain, which corresponds approximately to the transcripts of 20 cells44. The multiplex PCR produced 12 amplicons of the expected size (Figure 3 and Table 1) demonstrating the sensitivity and efficiency of the protocol. The negative control performed without RNA produced no amplicon (data not shown).
A layer V pyramidal neuron was visually identified by its large soma and a prominent apical dendrite (Figure 5A, inset). Whole cell recording revealed typical electrophysiological properties of layer V regular spiking neurons5,45,46 with, notably, a low input resistance, long-lasting action potentials, and pronounced spike frequency adaptation (Figure 5A). The molecular analysis of this neuron revealed the expression of vGluT1 (Figure 5B), confirming its glutamatergic phenotype42,46. This neuron also expressed SOM, ATP1&#945;1, and 3 subunits of the Na+/K+ ATPase. Biocytin labeling of the recorded neurons confirmed a pyramidal morphology (Figure 5D).
As expected from glutamatergic neurons, the molecular analysis of 26 layer V pyramidal cells revealed expression of VGluT1, but neither of the two GADs (Figure 5C). Markers of interneurons were rarely observed5,42,46. COX-2, chiefly expressed by layer II-III pyramidal cells3,16, was not detected in layer V pyramidal cells. The ATP1&#945;1 and 3 subunits were more frequently observed than the ATP1&#945;2 subunit3. The Kir6.2 and SUR1 subunits were rarely detected in layer V pyramidal neurons, which is consistent with their preferential expression in upper layers3,43. Care was taken not to harvest the nuclei, resulting in a rare detection of SOM introns (3 out of 26 cells, i.e., 12%).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57627/57627fig1.jpg" /> 
Figure 1: Dedicated box for single cell RT-PCR. List of materials reserved for RT-PCR after patch-clamp. (1) Borosilicate glass capillaries, (2) 20 &#181;L long, fine, flexible tips, (3) 20 &#181;L micropipette, (4) home-made expeller, (5) 500 &#181;L PCR tubes, (6) 10 &#181;L aerosol resistant filter tips, and (7) permanent markers. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57627/57627fig2.jpg" /> 
Figure 2: PCR primer design strategy. (A) Schematic representation of the coding sequence of COX 2 cDNA aligned to the mouse chromosome 2 sequence containing the COX 2 gene. Exons are represented by black boxes and introns on gDNA by white boxes. Note the gaps in the cDNA corresponding to the intronic sequences on gDNA. Representative examples of bad and good oligonucleotides represented as red and green arrows, respectively. Right and left arrows denote forward and reverse primers. (B) Sequences and secondary structures of the oligonucleotides shown in (A). Left and right panels indicate hairpin self-complementarity and self-dimer formation, respectively. The B1 oligonucleotide displays both a strong hairpin self-complementarity and dimer formation whereas the B2 oligonucleotide only shows dimer formation. Both B3 and B4 oligonucleotides have no hairpin self-complementarity and no dimer formation; they are intron overspanning (A) and have been selected as potential PCR primers (see Table 1). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57627/57627fig3.jpg" /> 
Figure 3: Validation of multiplex PCR. 1 ng of total RNA from mouse whole brain was subjected to a reverse transcription followed by two rounds of PCR amplification. The 12 PCR products were resolved in separate lanes by agarose gel electrophoresis in parallel with &#934;x174 digested by HaeIII. The second PCR products had sizes (in bp) predicted by the sequences: 153 (vGluT1), 248 (GAD65), 255 (GAD67), 181 (COX 2), 220 (NPY), 146 (SOM), 183 (ATP1a1), 213 (ATP1a2), 128 (ATP1a3), 342 (Kir6.2), 211 (SUR1), and 182 (SOMint). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57627/57627fig4.jpg" /> 
Figure 4: Patch-clamp harvesting in brain slices. Once a cell is visually identified, the recording pipette is approached with a positive pressure in order to avoid cellular debris contamination at the tip of the pipette. Note the dimple on the membrane of this neuron. Positive pressure is then interrupted in order to form a cell-attached configuration with a Gigaohm tight seal. Brief suctions are applied to switch to whole-cell configuration. At the end of the recording, the cytoplasm is harvested by applying a gentle negative pressure into the pipette while maintaining the tight seal. Note the shrinkage of the cell body during the harvesting procedure. The recording pipette is then gently withdrawn to form an outside-out patch, which favors cell membrane closure for subsequent biocytin revelation, and preservation of harvested material in the patch pipette. Reproduced from Cauli and Lambolez47 with permission from the Royal Society of Chemistry. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57627/57627fig5.jpg" /> 
Figure 5: Characterization of layer V neocortical pyramidal cells. (A) Membrane potential response of a layer V pyramidal&#160;cell induced by current pulses of -100, -40, -10, +60, +120, and +500 pA (bottom traces). The neuron displays a weak potential deflection after the initial hyperpolarizing response (upper traces). In response to a supraliminal depolarization, the neuron discharged long-lasting action potentials with slowly developing after-hyperpolarization (upper trace). Near saturation, the neuron discharged at a low frequency and exhibited a pronounced adaptation (upper gray trace). Inset: infrared pictures of the recorded layer V pyramidal neuron. The pial surface is upward. Scale bar: 20 &#181;m. (B) Multiplex RT-PCR analysis revealing expression of vGluT1, SOM, ATP1&#945;1, and ATP1&#945;3. (C) Gene expression profile in a sample of 26 layer V pyramidal cells. vGluT1 was expressed in all neurons while GAD65, GAD67, and COX2 were never detected. NPY, SOM, Kir6.2, SUR1, and SOMint were rarely observed. Pyramidal cells expressed ATP1&#945;3, 1 subunit of the Na+/K+ ATPase, and ATP1&#945;2 to a lesser extent. (D) Maximum intensity projection of confocal images showing biocytin labeling of the neuron recorded in (A). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene / GenBank number</td>
			<td colspan="2">External primers</td>
			<td>Size (bp)</td>
			<td colspan="2">Internal primers</td>
			<td>Size (bp)</td>
		</tr>
		<tr>
			<td rowspan="4">vGlut1 
			NM_182993</td>
			<td colspan="2">Sense, -113</td>
			<td rowspan="4">259</td>
			<td colspan="2">Sense, -54</td>
			<td rowspan="4">153</td>
		</tr>
		<tr>
			<td colspan="2">GGCTCCTTTTTCTGGGGCTAC</td>
			<td colspan="2">ATTCGCAGCCAACAGGGTCT</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 126</td>
			<td colspan="2">Anti-sense, 79</td>
		</tr>
		<tr>
			<td colspan="2">CCAGCCGACTCCGTTCTAAG</td>
			<td colspan="2">TGGCAAGCAGGGTATGTGAC</td>
		</tr>
		<tr>
			<td rowspan="4">GAD65 
			NM_008078</td>
			<td colspan="2">Sense, 99</td>
			<td rowspan="4">375</td>
			<td colspan="2">Sense, 219</td>
			<td rowspan="4">248</td>
		</tr>
		<tr>
			<td colspan="2">CCAAAAGTTCACGGGCGG</td>
			<td colspan="2">CACCTGCGACCAAAAACCCT</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 454</td>
			<td colspan="2">Anti-sense, 447</td>
		</tr>
		<tr>
			<td colspan="2">TCCTCCAGATTTTGCGGTTG</td>
			<td colspan="2">GATTTTGCGGTTGGTCTGCC</td>
		</tr>
		<tr>
			<td rowspan="4">GAD67 
			NM_008077</td>
			<td colspan="2">Sense, 529</td>
			<td rowspan="4">598</td>
			<td colspan="2">Sense, 801</td>
			<td rowspan="4">255</td>
		</tr>
		<tr>
			<td colspan="2">TACGGGGTTCGCACAGGTC</td>
			<td colspan="2">CCCAGAAGTGAAGACAAAAGGC</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 1109</td>
			<td colspan="2">Anti-sense, 1034</td>
		</tr>
		<tr>
			<td colspan="2">CCCAGGCAGCATCCACAT</td>
			<td colspan="2">AATGCTCCGTAAACAGTCGTGC</td>
		</tr>
		<tr>
			<td rowspan="4">COX 2 
			NM_011198</td>
			<td colspan="2">Sense, 199</td>
			<td rowspan="4">268</td>
			<td colspan="2">Sense, 265</td>
			<td rowspan="4">181</td>
		</tr>
		<tr>
			<td colspan="2">CTGAAGCCCACCCCAAACAC</td>
			<td colspan="2">AACAACATCCCCTTCCTGCG</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 445</td>
			<td colspan="2">Anti-sense, 426</td>
		</tr>
		<tr>
			<td colspan="2">CCTTATTTCCCTTCACACCCAT</td>
			<td colspan="2">TGGGAGTTGGGCAGTCATCT</td>
		</tr>
		<tr>
			<td rowspan="4">NPY 
			NM_023456</td>
			<td colspan="2">Sense, 16</td>
			<td rowspan="4">294</td>
			<td colspan="2">Sense, 38</td>
			<td rowspan="4">220</td>
		</tr>
		<tr>
			<td colspan="2">CGAATGGGGCTGTGTGGA</td>
			<td colspan="2">CCCTCGCTCTATCTCTGCTCGT</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 286</td>
			<td colspan="2">Anti-sense, 236</td>
		</tr>
		<tr>
			<td colspan="2">AAGTTTCATTTCCCATCACCACAT</td>
			<td colspan="2">GCGTTTTCTGTGCTTTCCTTCA</td>
		</tr>
		<tr>
			<td rowspan="4">SOM 
			NM_009215</td>
			<td colspan="2">Sense, 43</td>
			<td rowspan="4">208</td>
			<td colspan="2">Sense, 75</td>
			<td rowspan="4">146</td>
		</tr>
		<tr>
			<td colspan="2">ATCGTCCTGGCTTTGGGC</td>
			<td colspan="2">GCCCTCGGACCCCAGACT</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 231</td>
			<td colspan="2">Anti-sense, 203</td>
		</tr>
		<tr>
			<td colspan="2">GCCTCATCTCGTCCTGCTCA</td>
			<td colspan="2">GCAAATCCTCGGGCTCCA</td>
		</tr>
		<tr>
			<td rowspan="4">ATP1&#945;1 
			NM_144900</td>
			<td colspan="2">Sense, 1287</td>
			<td rowspan="4">288</td>
			<td colspan="2">Sense, 1329</td>
			<td rowspan="4">183</td>
		</tr>
		<tr>
			<td colspan="2">CAGGGCAGTGTTTCAGGCTAA</td>
			<td colspan="2">TAAGCGGGCAGTAGCGGG</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 1556</td>
			<td colspan="2">Anti-sense, 1492</td>
		</tr>
		<tr>
			<td colspan="2">CCGTGGAGAAGGATGGAGC</td>
			<td colspan="2">AGGTGTTTGGGCTCAGATGC</td>
		</tr>
		<tr>
			<td rowspan="4">ATP1&#945;2 
			NM_178405</td>
			<td colspan="2">Sense, 1392</td>
			<td rowspan="4">268</td>
			<td colspan="2">Sense, 1430</td>
			<td rowspan="4">213</td>
		</tr>
		<tr>
			<td colspan="2">AGTGAGGAAGATGAGGGACAGG</td>
			<td colspan="2">AAATCCCCTTCAACTCCACCA</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 1640</td>
			<td colspan="2">Anti-sense, 1623</td>
		</tr>
		<tr>
			<td colspan="2">ACAGAAGCCCAGCACTCGTT</td>
			<td colspan="2">GTTCCCCAAGTCCTCCCAGC</td>
		</tr>
		<tr>
			<td rowspan="4">ATP1&#945;3 
			NM_144921</td>
			<td colspan="2">Sense, 127</td>
			<td rowspan="4">216</td>
			<td colspan="2">Sense, 158</td>
			<td rowspan="4">128</td>
		</tr>
		<tr>
			<td colspan="2">CGGAAATACAATACTGACTGCGTG</td>
			<td colspan="2">TGACACACAGTAAAGCCCAGGA</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 324</td>
			<td colspan="2">Anti-sense, 264</td>
		</tr>
		<tr>
			<td colspan="2">GTCATCCTCCGTCCCTGCC</td>
			<td colspan="2">CCACAGCAGGATAGAGAAGCCA</td>
		</tr>
		<tr>
			<td rowspan="4">Kir6.2 
			NM_010602</td>
			<td colspan="2">Sense, 306</td>
			<td rowspan="4">431</td>
			<td colspan="2">Sense, 339</td>
			<td rowspan="4">342</td>
		</tr>
		<tr>
			<td colspan="2">CGGAGAGGGCACCAATGT</td>
			<td colspan="2">CATCCACTCCTTTTCATCTGCC</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 719</td>
			<td colspan="2">Anti-sense, 663</td>
		</tr>
		<tr>
			<td colspan="2">CACCCACGCCATTCTCCA</td>
			<td colspan="2">TCGGGGCTGGTGGTCTTG</td>
		</tr>
		<tr>
			<td rowspan="4">SUR1 
			NM_011510</td>
			<td colspan="2">Sense, 1867</td>
			<td rowspan="4">385</td>
			<td colspan="2">Sense, 2041</td>
			<td rowspan="4">211</td>
		</tr>
		<tr>
			<td colspan="2">CAGTGTGCCCCCCGAGAG</td>
			<td colspan="2">ATCATCGGAGGCTTCTTCACC</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 2231</td>
			<td colspan="2">Anti-sense, 2231</td>
		</tr>
		<tr>
			<td colspan="2">GGTCTTCTCCCTCGCTGTCTG</td>
			<td colspan="2">GGTCTTCTCCCTCGCTGTCTG</td>
		</tr>
		<tr>
			<td rowspan="4">SOMint 
			X51468</td>
			<td colspan="2">Sense, 8</td>
			<td rowspan="4">240</td>
			<td colspan="2">Sense, 16</td>
			<td rowspan="4">182</td>
		</tr>
		<tr>
			<td colspan="2">CTGTCCCCCTTACGAATCCC</td>
			<td colspan="2">CTTACGAATCCCCCAGCCTT</td>
		</tr>
		<tr>
			<td colspan="2">Anti-sense, 228</td>
			<td colspan="2">Anti-sense, 178</td>
		</tr>
		<tr>
			<td colspan="2">CCAGCACCAGGGATAGAGCC</td>
			<td colspan="2">TTGAAAGCCAGGGAGGAACT</td>
		</tr>
	</tbody>
</table>
Table 1. Sequences of first and second PCR primers. The position of each PCR primer and their sequences are given from 5&#39; to 3&#39;. Except for the somatostatin intron, position 1 corresponds to the first base of the start codon of each gene.

Watch this Scientific Journal Video about Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp at JoVE.com

Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

This protocol describes the critical steps and precautions required to perform single cell multiplex reverse transcription polymerase chain reaction after patch-clamp. This technique is a simple and effective method to analyze the expression profile of a predetermined set of genes from a single cell characterized by patch-clamp recordings.

The cerebral cortex is composed of numerous cell types exhibiting various morphological, physiological, and molecular features. This diversity hampers ...

single-cell-multiplex-reverse-transcription-polymerase-chain-reaction

Nanyang Technological University

Research

JoVE Journal

Neuroscience

9.7K Views.  Sorbonne Université. This protocol describes the critical steps and precautions required to perform single cell multiplex reverse transcription polymerase chain reaction after patch-clamp. This technique is a simple and effective method to analyze the expression profile of a predetermined set of genes from a single cell characterized by patch-clamp recordings.

Video: Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

Profiling Voltage-gated Potassium Channel mRNA Expression in Nigral Neurons using Single-cell RT-PCR Techniques

In mammalian central nervous system, different types of neurons with diverse molecular and functional characteristics are intermingled with each other, difficult to separate and also not easily identified by their morphology. Thus, it is often difficult to analyze gene expression in a specific neuron type. Here we document a procedure that combines whole-cell patch clamp recording techniques with single-cell reverse transcription polymerase chain reaction (scRT-PCR) to profile mRNA expression in different types of neurons in the substantial nigra. Electrophysiological techniques are first used to record the neurophysiological and functional properties of individual neurons. Then, the cytoplasm of single electrophysiologically characterized nigral neurons is aspirated and subjected to scRT-PCR analysis to obtain mRNA expression profiles for neurotransmitter synthesis enzymes, receptors, and ion channels. The high selectivity and sensitivity make this method particularly useful when immunohistochemistry can not be used due to a lack of suitable antibody or low expression level of the protein. This method is also applicable to neurons in other brain areas.

Neurons are first characterized electrophysiologically. Then the cytoplasm from the recorded neuron is aspirated and subjected to reverse transcription-PCR analysis to detect the expression of mRNAs for neurotransmitter synthesis enzymes, ion channels, and receptors.

In mammalian central nervous system, different types of neurons with diverse molecular and functional characteristics are intermingled with each other, ...

Single-cell Profiling of Developing and Mature Retinal Neurons

Highly specialized, but exceedingly small populations of cells play important roles in many tissues. The identification of cell-type specific markers and gene expression programs for extremely rare cell subsets has been a challenge using standard whole-tissue approaches. Gene expression profiling of individual cells allows for unprecedented access to cell types that comprise only a small percentage of the total tissue1-7. In addition, this technique can be used to examine the gene expression programs that are transiently expressed in small numbers of cells during dynamic developmental transitions8.
This issue of cellular diversity arises repeatedly in the central nervous system (CNS) where neuronal connections can occur between quite diverse cells9. The exact number of distinct cell types is not precisely known, but it has been estimated that there may be as many as 1000 different types in the cortex itself10. The function(s) of complex neural circuits may rely on some of the rare neuronal types and the genes they express. By identifying new markers and helping to molecularly classify different neurons, the single-cell approach is particularly useful in the analysis of cell types in the nervous system. It may also help to elucidate mechanisms of neural development by identifying differentially expressed genes and gene pathways during early stages of neuronal progenitor development.
As a simple, easily accessed tissue with considerable neuronal diversity, the vertebrate retina is an excellent model system for studying the processes of cellular development, neuronal differentiation and neuronal diversification. However, as in other parts of the CNS, this cellular diversity can present a problem for determining the genetic pathways that drive retinal progenitors to adopt a specific cell fate, especially given that rod photoreceptors make up the majority of the total retinal cell population11. Here we report a method for the identification of the transcripts expressed in single retinal cells (Figure 1). The single-cell profiling technique allows for the assessment of the amount of heterogeneity present within different cellular populations of the retina2,4,5,12. In addition, this method has revealed a host of new candidate genes that may play role(s) in the cell fate decision-making processes that occur in subsets of retinal progenitor cells8. With some simple adjustments to the protocol, this technique can be utilized for many different tissues and cell types.

A method for the isolation of single retinal cells and subsequent amplification of their cDNAs is described. Single-cell transcriptomics reveals the degree of cellular heterogeneity present in a tissue and uncovers new marker genes for rare cell populations. The accompanying protocol can be adjusted to suit many different cell types.

Highly specialized, but exceedingly small populations of cells play important roles in many tissues. The identification of cell-type specific markers and ...

A Computer-assisted Multi-electrode Patch-clamp System

The patch-clamp technique is today the most well-established method for recording electrical activity from individual neurons or their subcellular compartments. Nevertheless, achieving stable recordings, even from individual cells, remains a time-consuming procedure of considerable complexity. Automation of many steps in conjunction with efficient information display can greatly assist experimentalists in performing a larger number of recordings with greater reliability and in less time. In order to achieve large-scale recordings we concluded the most efficient approach is not to fully automatize the process but to simplify the experimental steps and reduce the chances of human error while efficiently incorporating the experimenter's experience and visual feedback. With these goals in mind we developed a computer-assisted system which centralizes all the controls necessary for a multi-electrode patch-clamp experiment in a single interface, a commercially available wireless gamepad, while displaying experiment related information and guidance cues on the computer screen. Here we describe the different components of the system which allowed us to reduce the time required for achieving the recording configuration and substantially increase the chances of successfully recording large numbers of neurons simultaneously.

Multi-electrode patch-clamp recordings constitute a complex task. Here we show how, by automating of many of the experimental steps, it is possible to accelerate the process leading to qualitative improvement in performance and number of recordings.

The patch-clamp technique is today the most  well-established method for recording electrical activity from individual  neurons or their subcellular ...

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying potassium (referred to as GIRK) channels, which are important for regulating the excitability of neurons. There are four different mammalian GIRK channel subunits (GIRK1-GIRK4) - we focus on GIRK2 because it forms a homotetramer. Stimulation of different types of G protein-coupled receptors (GPCRs), such as the muscarinic receptor (M2R), leads to activation of GIRK channels. Alcohol also directly activates GIRK channels. We will show how to mutate one amino acid by specifically changing one or more nucleotides in the cDNA for the GIRK channel. This mutated cDNA sequence will be amplified in bacteria, purified, and the presence of the point mutation will be confirmed by DNA sequencing. The cDNAs for the mutated and wild-type GIRK channels will be transfected into human embryonic kidney HEK293T cells cultured in vitro. Lastly, whole-cell patch-clamp electrophysiology will be used to study the macroscopic potassium currents through the ectopically expressed wild-type or mutated GIRK channels. In this experiment, we will examine the effect of a L257W mutation in GIRK2 channels on M2R-dependent and alcohol-dependent activation.

We will demonstrate how to study the effect of a single point mutation on the function of an ion channel.

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

Biology

Optimized Transfection Strategy for Expression and Electrophysiological Recording of Recombinant Voltage-Gated Ion Channels in HEK-293T Cells

The in vitro expression and electrophysiological recording of recombinant voltage-gated ion channels in cultured human embryonic kidney cells (HEK-293T) is a ubiquitous research strategy. HEK-293T cells must be plated onto glass coverslips at low enough density so that they are not in contact with each other in order to allow for electrophysiological recording without confounding effects due to contact with adjacent cells. Transfected channels must also express with high efficiency at the plasma membrane for whole-cell patch clamp recording of detectable currents above noise levels. Heterologous ion channels often require long incubation periods at 28&deg;C after transfection in order to achieve adequate membrane expression, but there are increasing losses of cell-coverslip adhesion and membrane stability at this temperature. To circumvent this problem, we developed an optimized strategy to transfect and plate HEK-293T cells. This method requires that cells be transfected at a relatively high confluency, and incubated at 28&deg;C for varying incubation periods post-transfection to allow for adequate ion channel protein expression. Transfected cells are then plated onto glass coverslips and incubated at 37&deg;C for several hours, which allows for rigid cell attachment to the coverslips and membrane restabilization. Cells can be recorded shortly after plating, or can be transferred to 28&deg;C for further incubation. We find that the initial incubation at 28&deg;C, after transfection but before plating, is key for the efficient expression of heterologous ion channels that normally do not express well at the plasma membrane. Positively transfected, cultured cells are identified by co-expressed eGFP or eGFP expressed from a bicistronic vector (e.g. pIRES2-EGFP) containing the recombinant ion channel cDNA just upstream of an internal ribosome entry site and an eGFP coding sequence. Whole-cell patch clamp recording requires specialized equipment, plus the crafting of polished recording electrodes and L-shaped ground electrodes from borosilicate glass. Drug delivery to study the pharmacology of ion channels can be achieved by directly micropipetting drugs into the recording dish, or by using microperfusion or gravity flow systems that produce uninterrupted streams of drug solution over recorded cells.

Reliable method for highly efficient in vitro expression and subsequent electrophysiological recording of recombinant voltage-gated ion channels in cultured human embryonic kidney cells (HEK-293T).

The in vitro expression and electrophysiological recording of recombinant voltage-gated ion channels in cultured human embryonic kidney cells (HEK-293T) ...

Whole-cell Patch-clamp Recordings for Electrophysiological Determination of Ion Selectivity in Channelrhodopsins

Over the past decade, channelrhodopsins became indispensable in neuroscientific research where they are used as tools to non-invasively manipulate electrical processes in target cells. In this context, ion selectivity of a channelrhodopsin is of particular importance. This article describes the investigation of chloride selectivity for a recently identified anion-conducting channelrhodopsin of Proteomonas sulcata via electrophysiological patch-clamp recordings on HEK293 cells. The experimental procedure for measuring light-gated photocurrents demands a fast switchable &#8211; ideally monochromatic &#8211; light source coupled into the microscope of an otherwise conventional patch-clamp setup. Preparative procedures prior to the experiment are outlined involving preparation of buffered solutions, considerations on liquid junction potentials, seeding and transfection of cells, and pulling of patch pipettes. The actual recording of current-voltage relations to determine the reversal potentials for different chloride concentrations takes place 24 h to 48 h after transfection. Finally, electrophysiological data are analyzed with respect to theoretical considerations of chloride conduction.

This article describes how the ion selectivity of channelrhodopsin is determined with electrophysiological whole-cell patch-clamp recordings using HEK293 cells. Here, the experimental procedure for investigating chloride selectivity of an anion-selective channelrhodopsin is demonstrated. However, the procedure is transferable to other channelrhodopsins of distinct selectivity.

Over the past decade, channelrhodopsins became indispensable in neuroscientific research where they are used as tools to non-invasively manipulate ...

Single Cell Transcriptional Profiling of Adult Mouse Cardiomyocytes

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation between cells within a tissue. Isolation of pure cardiomyocyte populations through a collagenase perfusion of mouse hearts facilitates the generation of single cell microarrays for whole transcriptome gene expression, or qPCR of specific targets using nanofluidic arrays. We describe here a procedure to examine single cell gene expression profiles of cardiomyocytes isolated from the heart. This paradigm allows for the evaluation of metrics of interest which are not reliant on the mean (for example variance between cells within a tissue) which is not possible when using conventional whole tissue workflows for the evaluation of gene expression (Figure 1). We have achieved robust amplification of the single cell transcriptome yielding micrograms of double stranded cDNA that facilitates the use of microarrays on individual cells. In the procedure we describe the use of NimbleGen arrays which were selected for their ease of use and ability to customize their design. Alternatively, a reverse transcriptase - specific target amplification (RT-STA) reaction, allows for qPCR of hundreds of targets by nanofluidic PCR. Using either of these approaches, it is possible to examine the variability of expression between cells, as well as examining expression profiles of rare cell types from within a tissue. Overall, the single cell gene expression approach allows for the generation of data that can potentially identify idiosyncratic expression profiles that are typically averaged out when examining expression of millions of cells from typical homogenates generated from whole tissues.

Single cell expression profiling allows the detailed gene expression analysis of individual cells. We describe methods for the isolation of cardiomyocytes, and preparing the resulting lysates for either whole transcriptome microarray or qPCR of specific targets.

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation ...

One-channel Cell-attached Patch-clamp Recording

Ion channel proteins are universal devices for fast communication across biological membranes. The temporal signature of the ionic flux they generate depends on properties intrinsic to each channel protein as well as the mechanism by which it is generated and controlled and represents an important area of current research. Information about the operational dynamics of ion channel proteins can be obtained by observing long stretches of current produced by a single molecule. Described here is a protocol for obtaining one-channel cell-attached patch-clamp current recordings for a ligand gated ion channel, the NMDA receptor, expressed heterologously in HEK293 cells or natively in cortical neurons. Also provided are instructions on how to adapt the method to other ion channels of interest by presenting the example of the mechano-sensitive channel PIEZO1. This method can provide data regarding the channel&#8217;s conductance properties and the temporal sequence of open-closed conformations that make up the channel&#8217;s activation mechanism, thus helping to understand their functions in health and disease.

Described here is a procedure for obtaining long stretches of current recording from one ion channel with the cell-attached patch-clamp technique. This method allows for observing, in real time, the pattern of open-close channel conformations that underlie the biological signal. These data inform about channel properties in undisturbed biological membranes.

Ion channel proteins are universal devices for fast communication across biological membranes. The temporal signature of the ionic flux they generate ...

Technical Applications of Microelectrode Array and Patch Clamp Recordings on Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes

Drug-induced cardiotoxicity is the leading cause of drug attrition and withdrawal from the market. Therefore, using appropriate preclinical cardiac safety assessment models is a critical step during drug development. Currently, cardiac safety assessment is still highly dependent on animal studies. However, animal models are plagued by poor translational specificity to humans due to species-specific differences, particularly in terms of cardiac electrophysiological characteristics. Thus, there is an urgent need to develop a reliable, efficient, and human-based model for preclinical cardiac safety assessment. Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as an invaluable in vitro model for drug-induced cardiotoxicity screening and disease modeling. hiPSC-CMs can be obtained from individuals with diverse genetic backgrounds and various diseased conditions, making them an ideal surrogate to assess drug-induced cardiotoxicity individually. Therefore, methodologies to comprehensively investigate the functional characteristics of hiPSC-CMs need to be established. In this protocol, we detail various functional assays that can be assessed on hiPSC-CMs, including the measurement of contractility, field potential, action potential, and calcium handling. Overall, the incorporation of hiPSC-CMs into preclinical cardiac safety assessment has the potential to revolutionize drug development.

Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as a promising in vitro model for drug-induced cardiotoxicity screening and disease modeling. Here, we detail a protocol for measuring the contractility and electrophysiology of hiPSC-CMs.

Drug-induced cardiotoxicity is the leading cause of drug attrition and withdrawal from the market. Therefore, using appropriate preclinical cardiac safety ...

Medicine

Establishing a Whole-Cell Configuration through the Patch Clamp Method

Source: Segev, A. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/54024">Whole-cell Patch-clamp Recordings in Brain Slices.</a>&#160;J. Vis. Exp.&#160;(2016)
This video demonstrates the whole-cell patch clamp technique in a mouse brain slice. This technique establishes a stable connection between micropipette and neuron membrane, which is further disrupted to establish a whole-cell configuration to study the neuron&#39;s health and physiological responses.

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. Slice ...