원고에 대 한 그의 의견에 감사 박사 알렉산더 Mourot 하 고. 이 작품은 직원 회 드 라 검색 (ANR 2011 MALZ 003 01;에서 교부 금에 의해 지원 되었다 ANR-15-CE16-0010 고 ANR-17-CE37-0010-03), BLG Fondation 부 라 검색 르 츠에서에서 친교에 의해 지원 됩니다. 우리는 IBPS (파리, 프랑스)의 동물 시설 감사.

저자는 공개 없다.

단일 셀 다중 RT-PCR 후 패치 클램프 동시에 하 고 확실 하 게 electrophysiologically 확인 된 셀5에서 30 개 이상의 유전자의 표현을 조사할 수 있습니다. 단일 셀 수준에서 유전자 발현을 분석 고효율 PCR 뇌관을 요구 한다. 가장 제한 단계 중 하나를 셀의 내용의 모음입니다. 그것의 효율성은 셀 크기를 일치 하는 동안 가능한 한 크게 해야 패치 피 펫 팁의 직경에 따라 다릅니다. 1-2 µ m 오픈 팁 직경을 가진 펫은 가장 신경 종류에 적합 해야 입증 되었다. 또한 셀룰러 콘텐츠만 수집 되도록 필수적 이다 고 하지 주위 조직. 이 제어 electrophysiologically 수확 동안 단단한 물개를의 보존 하 여 이루어집니다. 피 펫 철수 더 동안 외부 아웃 패치 구성의 형성 세포 파편에서 수확된 세포질을 보호합니다. 멀티플렉스 RT-PCR는 또한 조사 셀 형식의 mRNAs 풍부에 따라 단일 셀의 성공률. 예를 들어, 항복 이다, 상대적으로 낮은 금액3mRNAs를 표현 하는 얻은 뉴런으로 얻은 것 보다 일반적으로 낮은 하며 따라서 샘플 크기15,16증가. 반전 녹음 방송, 튜브48에 낮은 효율을가지고, 단일의 제한 반응 셀 다중 RT-PCR입니다. 그것은 따라서-80 ° C에서 aliquots로 그들을 저장 하 고만 하루 동안 그들을 사용 하 여 최고 품질 시 약을 사용 하 여 중요 한. 마지막으로,는 RTase의 DNA 중 합 효소 활동은 종종 뇌관 이합체 형성의 간과 소스. 이 문제를 해결 하려면 증폭 효율을 높이 중요 한가 한 뇌관으로 뜨거운 시작을 수행 합니다. 또한이 Taq DNA 중 합 효소 활동49에 RTase의 억제 효과 줄일 것 이다.
단일 셀 다중 RT-PCR 기술은 매우 다양 한입니다. 그것은 광범위 하 게 사용 되었다 설치류10,11,13,19,20,34,,5051,52 ,,5354 그러나 거의 모든 동물 모델 및 유전자 조직 및 유전자 시퀀스를 사용할 수 있습니다 가정에 적용할 수 있습니다. 다양 한 패치 클램프 솔루션으로 그들은 RT-PCR 셀 무료 분석 실험에 방해 하지 않습니다 사용할 수 있습니다. 예를 들어 K+ + Cs 양이온, Cl- 또는 구 루 콘 내부 솔루션에 성공적으로 사용 된6,36,,4155되었습니다 수 있습니다.
클래식 틀린 부정적인 결과 패치 피 펫 필 라 멘 트 내부 패치 클램프 솔루션의 RNase 오염에서 줄기. 신중 하 게 chlorinating는 필 라 멘 트 및 내부 솔루션을 일반적으로 확인이 문제를 해결 합니다. 틀린 부정적인 결과 세포질의 비율만 수확 이후 낮은 단일 세포 수준에서 유전자는 표현 하는 경우에 발생할 수 있습니다. 더 큰 펫을 사용 하 여 또는 전체 세포 기록의 시간을 줄여 수확 품질을 높일 수 있습니다. 품질을 수확 단일 셀20에 낮은 수준에서 표현 될 알려진 유전자를 포함 하 여 평가 될 수 있다. 거짓 긍정적인 결과 나쁜 조직 품질, 오염 세포질 파편의 양을 높습니다 발생할 수 있습니다. 파편의 존재를 테스트 어떤 인감을 수행 하 고 피펫으로 제거 전에 긍정적인 압력을 방출 하지 않고 패치 피 펫을 조각에 삽입 하 여 수행 됩니다. Amplifiable 재료의 존재는 다음 다중 실시간 PCR42에 의해 조사 됩니다. Silanizing 패치 피 펫 또한 세포 외 오염 물질56의 컬렉션을 줄이기 위해 사용 되었습니다. 단 세포 PCR 이중 좌초 DNA57의 단일 복사본으로 약간 감지할 수 있는 매우 중요 한 기술입니다. Intron 없는 유전자의 경우 핵에 포함 된 gDNA 또한 가양성을 생성할 수 있습니다. 이 문제를 해결 하기 위해 수확 수 중 핵에서 피 펫을 배치 하 여 gDNA 컬렉션을 피하고. GDNA의 존재는 intronic 시퀀스25를 증폭 시켜 안정적으로 조사 될 수 있다.
RT-PCR에 의해 mRNA 분자의 검출 RTase48의 낮은 효율 때문에 아마도 10 부44, 신뢰할 수 없는 되 고 이어질 수는 낮은 풍부 녹취 록26,42의 아래. 이 intron 없는 유전자의 경우 문제가 될 수 있습니다. 실제로, 수집 될 수 있는 세포질의 양과 따라서 검출 감도 감소는 핵의 수확을 피하. 단일 셀 RT-PCR 후 biocytin 라벨로 패치 클램프 셀의 모양을 최대한 유지는 필요의 조합 (그림 3). 피할,이 수집 될 수 있습니다, 성공률을 줄이는 물질의 양을 줄일 수 있습니다. 세포질 컬렉션 및 세포 형태학의 보존 사이 타협은 필수입니다.
그들은 단지 cDNAs 여부에 정보를 제공으로 다중 단일 셀 RT-PCR 데이터 양적 되지 않습니다 제시 하거나 수집 된 자료에서 결 석. 그러나, 위에서 설명한 감지 한계 때문에 인구 수준에서 검출의 발생 단일 세포 수준에서 유전자의 풍부를 반영할 수 있습니다. 대체 방법을 수 있도록 더 많은 양적 데이터를 생성 하지만의 수를 제한 하는 그들의 특정 확대 전략 (즉, 동종 유전자 또는 실시간 정량의 상대 부 량)에 의해 크게 부과 기술적 제약 동시에 될 수 있는 유전자 분석41,53,55,,5859,60,61,62,63 ,,6465,66. 패치 클램프 기록 및 단일 셀 RNaseq, 패치-seq30,31, 라고 최근 조합 electrophysiologically 특징 세포의 양적 transcriptomic 분석을 수 있습니다. 새로운 유망 접근, 아직 높은 처리량 시퀀서에 대 한 액세스 요구 이며 생성 된 데이터는 시간이 걸리는 분석이 필요.

대뇌 피 질에는 다양 한 생리 적 프로세스에 관련 된 수많은 셀 형식을 구성 되어 있습니다. 그들의 식별 및 특성화, 그들의 특정 기능에 대 한 이해를 전제 조건 매우 도전 수 대뇌 피 질의 세포 유형1 특징 큰 형태, 생리, 및 분자 다양성 부여 2,,34.
단일 셀 다중 RT-PCR 패치 클램프와 RT-PCR 기술의 결합을 기반으로 합니다. 그것은 동시에 electrophysiologically 확인 된 셀5에서 30 개 이상의 미리 정의 된 유전자의 표정을 프로브 수 있습니다. 기록 피 펫 추가에 신경 추적 프로그램의 포함 허용 조직화 학적인 계시6,7,,89, 후 기록 된 세포의 형태학 특성 10. 그것은 그들의 phenotypic 특성5,,910,11,12의 복수 변수 분석에 따라 신경 유형의 분류에 대 한 매우 유용한 기술입니다 ,,1314. 단일 셀 멀티플렉스 RT-PCR은 또한 이다15,,1617, 같은 비 신경 세포의 특성에 적합 하 고 거의 모든 뇌 구조18에 적용 될 수 있습니다. 19,20,21,22,23 및 셀 유형, 가정 그들은 전체 셀 구성에 기록 될 수 있습니다.
이 기술은 세포 소스의 식별 및 전송 시스템7,8,15,,1620,21, 목표에 대 한 매우 편리 하다 24,25,26,,2728, 특정 항 체 부족 하는 경우에 특히. 그것은 시각적으로 식별 된 셀29, 패치 클램프 기록에 의존 하며 따라서 또한 특정 세포 환경8,,1516셀을 대상으로 수 있습니다. 또한 뇌 조직의 cytoarchitecture 두뇌 분할 영역에 유지 됩니다, 이후이 방법은 또한 수 있습니다 신경 및 비 신경 요소7,8 특징이 세포의 해부학 적 관계의 연구를 , 18.
이 기술은 수확된 세포질의 크기와 RT의 효율에 의해 제한 된 있기 때문에, 낮은 복사 번호에서 표현 하는 mRNA의 검출은 어려울 수 있습니다. RNaseq 기술에 따라 다른 접근 분석 하는 단 세포3,4,,3031, 전체 transcriptome 있게 비록 그들은 반드시 높은 처리량 비싼 시퀀서 필요 모든 실험실을 사용할 수 있습니다. 단일 셀 다중 실시간 PCR 기술을 사용 하므로 끝점 PCR, 그것만 널리 thermocyclers를 요구 한다. 그것은 실험실을 갖춘 electrophysiological 설정에서 쉽게 개발 될 수 있다 하 고 비싼 장비가 필요 하지 않습니다. 그것은 제공할 수 있습니다, 어느 날, 내 유전자의 미리 정의 된 집합의 식에 대 한 질적 분석. 따라서,이 방법은 신속한 방식으로 단일 세포의 분자 특성에 대 한 쉬운 액세스를 제공합니다.

<table>
	<tbody>
		<tr>
			<td>MACAW v.2.0.5</td>
			<td>NCBI</td>
			<td></td>
			<td>Multiple alignement for primer design</td>
		</tr>
		<tr>
			<td>Dithiothreitol</td>
			<td>VWR</td>
			<td>443852A</td>
			<td>RT</td>
		</tr>
		<tr>
			<td>Random primers</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>11034731001</td>
			<td>RT</td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>GE Healthcare Life Sciences</td>
			<td>28-4065-52</td>
			<td>RT and PCR</td>
		</tr>
		<tr>
			<td>RNasin Ribonuclease Inhibitors</td>
			<td>Promega</td>
			<td>N2511</td>
			<td>RT</td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase</td>
			<td>Invitrogen</td>
			<td>18064014</td>
			<td>RT</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>Qiagen</td>
			<td>201205</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Mineral Oil</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>M5904-5ML</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td></td>
			<td>PCR / desalted and diluted at 200 &#181;M</td>
		</tr>
		<tr>
			<td>Tubes, 0.5 mL, flat cap</td>
			<td>ThermoFisher Scientific</td>
			<td>AB0350</td>
			<td>RT and PCR</td>
		</tr>
		<tr>
			<td>BT10 Series - 10 &#181;L Filter Tip</td>
			<td>Neptune Scientific</td>
			<td>BT10</td>
			<td>RT and PCR</td>
		</tr>
		<tr>
			<td>BT20 Series - 20 &#181;L Filter Tip</td>
			<td>Neptune Scientific</td>
			<td>BT20</td>
			<td>RT and PCR</td>
		</tr>
		<tr>
			<td>BT200 Series - 200 &#181;L Filter Tip</td>
			<td>Neptune Scientific</td>
			<td>BT200</td>
			<td>RT and PCR</td>
		</tr>
		<tr>
			<td>BT1000 Series - 1000 &#181;L Filter Tip</td>
			<td>Neptune Scientific</td>
			<td>BT1000.96</td>
			<td>RT and PCR</td>
		</tr>
		<tr>
			<td>DNA Thermal Cylcer</td>
			<td>Perkin Elmer Cetus</td>
			<td></td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>E1510-10ML</td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>Tris-Borate-EDTA buffer</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>T4415-1L</td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>UltraPure Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>&#934;X174 DNA-Hae III Digest</td>
			<td>NEB (New England BioLabs)</td>
			<td>N3026S</td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>EDA 290</td>
			<td>Kodak</td>
			<td></td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>Electrophoresis Power supply EPS 3500</td>
			<td>Pharmacia Biotech</td>
			<td></td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>Midi Horizontal Elecrophoresis Unit Model SHU13</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td></td>
			<td>Agarose gel electrophoresis</td>
		</tr>
		<tr>
			<td>Smooth paper with satin appearance</td>
			<td>Fisherbrand</td>
			<td>1748B</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>Potassium Hydroxyde</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>60377</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>Ethylene glycol-bis(2-aminoethylether)-N,N,N&#8242;,N&#8242;-tetraacetic acid</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>E3889</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>H4034</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>Potassium D-gluconate</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>G4500</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>Magnesium chloride solution</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>M1028</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>5500 Vapor Pressure Osmometer</td>
			<td>Wescor</td>
			<td></td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>Biocytin</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>B4261</td>
			<td>Patch clamp internal solution</td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>S5016</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>D-(+)-Glucose monohydrate</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>49159</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>S6191</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>60128</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Sodium bicarbonate</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>31437-M</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>S5011</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Magnesium chloride solution</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>63069</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Calcium chloride solution</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>21115</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Kynurenic acid</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>K3375</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>Piramal Healthcare UK</td>
			<td></td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>VT 1000S</td>
			<td>Leica Biosystems</td>
			<td>14047235613</td>
			<td>Slice preparation</td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>H1009</td>
			<td>Patch Clamp set-up cleaning</td>
		</tr>
		<tr>
			<td>Thin Wall Glass Capillaries with filament</td>
			<td>World Precision Instruments</td>
			<td>TW150F-4</td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>PP-83</td>
			<td>Narishige</td>
			<td></td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>Eppendorf Microloader</td>
			<td>Eppendorf</td>
			<td>5242956003</td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>BX51WI Upright microscope</td>
			<td>Olympus</td>
			<td></td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>XC-ST70/CE CCD B/W VIDEO CAMERA</td>
			<td>Sony</td>
			<td></td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>Axopatch 200B Amplifier</td>
			<td>Molecular Devices</td>
			<td></td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>Digidata 1440</td>
			<td>Molecular Devices</td>
			<td></td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>pCLAMP 10 software suite</td>
			<td>Molecular Devices</td>
			<td></td>
			<td>Patch Clamp</td>
		</tr>
		<tr>
			<td>10 mL syringe</td>
			<td>Terumo</td>
			<td>SS-10ES</td>
			<td>Expelling</td>
		</tr>
		<tr>
			<td>E Series with Straight Body (Holder)</td>
			<td>Phymep</td>
			<td>64-0997</td>
			<td>Expelling</td>
		</tr>
		<tr>
			<td>Sodium phosphate dibasic</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>S7907</td>
			<td>Histochemical revelation</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>S8282</td>
			<td>Histochemical revelation</td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>P6148</td>
			<td>Histochemical revelation</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>X100</td>
			<td>Histochemical revelation</td>
		</tr>
		<tr>
			<td>Gelatin from cold water fish skin</td>
			<td>Sigma-Aldrich (Merck)</td>
			<td>G7041</td>
			<td>Histochemical revelation</td>
		</tr>
		<tr>
			<td>Streptavidin, Alexa Fluor 488 conjugate</td>
			<td>ThermoFisher Scientific</td>
			<td>S11223</td>
			<td>Histochemical revelation</td>
		</tr>
		<tr>
			<td>24-well plate</td>
			<td>Greiner Bio-One</td>
			<td>662160</td>
			<td>Histochemical revelation</td>
		</tr>
	</tbody>
</table>

single cell multiplex reverse transcription polymerase chain reaction after patch-clamp

대뇌 피 질은 수많은 종류의 세포 다양 한 형태, 생리, 및 분자 기능을 전시로 구성. 이 다양성에는 쉽게 식별 하 고 이러한 세포 유형, 그들의 특정 기능을 공부 하는 전제의 지장을 초래할 수 있습니다. 이 문서에서는 다중 단일 셀 반전 녹음 방송 중 합 효소 연쇄 반응 (RT-PCR) 프로토콜을, 패치 클램프 조각, 기록 후 허용 하는 단일 셀에 유전자의 수만의 표현을 동시에 감지 하는 설명 합니다. 이 간단한 방법 형태학 상 특성을 구현할 수 있다 고 널리 혈관 주변 등 다양 한 세포 유형 및 그들의 특정 세포 환경 phenotypic 특성 결정에 적용 됩니다. 이 프로토콜의 원리 기록 하 패치 클램프 기술 수확 및 역방향 셀의 세포질 내용 녹음 이며 질적으로 감지 하 여 유전자의 미리 정의 된 집합의 표현 다중 PCR. PCR 뇌관 및 RT-PCR과 호환 세포내 패치 클램프 솔루션의 설계를 필요합니다. 선택적이 고 신뢰할 수 있는 증명서를 위해 탐지,이 기술은 또한 증폭 단계에 수확 하는 세포질에서 적절 한 컨트롤을 필요 합니다. 여기서 설명 하는 조치를 엄격 하 게 따라야 합니다, 하지만 거의 모든 electrophysiological 실험실 다중 단일 셀 RT-PCR 기법을 사용할 수 있습니다.

멀티플렉스 RT-PCR의 대표 유효성 검사는 그림 3에 표시 됩니다. 프로토콜은 12 다른 유전자의 표현을 동시에 조사 하도록 설계 되었습니다. 기공을 글루타민 산 염 운송업 자 vGluT1 glutamatergic 신경42에 대 한 긍정적인 제어로 찍은. GABA 합성 효소 (GAD65와 갓 67), Neuropeptide Y (NPY), 및 Somatostatin (SOM) GABAergic 수3,,511의 표식으로 사용 되었다. Cyclooxygenase 2 효소 (COX-2) 피라미드 셀 하위 인구3,16의 표식으로 사용 되었다.
ATP1α1-3 소 단위 나+의 /K+ ATPase 그리고 Kir6.2 및 SUR1 하는 소 단위 ATP에 민감한 K+ 채널의 신경 활동과 신진 대사 국가43의 관계를 평가 하기 위해 선정 됐다. Kir6.2 intron 덜 유전자 이기 때문에, 솜 intron 게놈 제어로 포함 되었다. 프로토콜 1에서 테스트 되었습니다 약 20의 증명서에 해당 하는 마우스 전체 뇌에서 추출 반전 베낀된 총 RNA의 ng 세포44. 멀티플렉스 PCR 생산 예상된 크기 (그림 3 및 표 1)의 12 amplicons 감도 프로토콜의 효율성을 보여주는. RNA 없이 부정적인 제어 생산 없음 amplicon (데이터 표시 되지 않음).
레이어 V 피라미드 뉴런의 큰 소마와 저명한 꼭대기 모 수석으로 시각적으로 확인 되었다 (그림 5A, 삽입). 전체 세포 기록 공개 레이어 V 일반 신경5,,4546 , 특히 급상승, 낮은 입력된 저항, 긴-지속적인 활동 전위, 그리고 발음된 스파이크의 전형적인 electrophysiological 속성 주파수 적응 (그림 5A)입니다. 이 신경의 분자 분석 공개 vGluT1의 표현 (그림 5B), 그것의 glutamatergic 표현 형42,46확인. 이 신경은 또한 솜, ATP1α1, 및 Na+의 3 소 단위 표현 /K+ ATPase. Biocytin 라벨 기록 된 뉴런의 피라미드 형태 (그림 5D) 확인.
VGluT1의 표현 하지만 두 GADs (그림 5C). 의 26 층 V 피라미드 세포의 분자 분석 공개 glutamatergic 뉴런에서 예상 대로 수의 마커 거의5,,4246을 관찰 했다. 콕스-2, 레이어 II-III 피라미드 세포3,16에 의해 주로 표현 하지 레이어 V 피라미드 세포에서 발견 되었다. ATP1α1와 3 소 단위 ATP1α2 소 단위3보다 더 자주 관찰 했다. Kir6.2 및 SUR1 소 단위 했다는 상층3,43식 그들의 특혜와 일치 하는 레이어 V 피라미드 뉴런에서 거의 감지 됩니다. 주의 했다 핵, 솜 introns (26의 3 셀, 즉, 12%)의 드문 탐지 결과 수확을 하지.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57627/57627fig1.jpg"> 그림 1: 단일 셀 RT-PCR 전용된 상자. 패치 클램프 후 RT-PCR를 위해 예약 된 자료의 목록입니다. (1) 붕 규 산 유리 모 세관, 긴 (2) 20 µ L, 괜 찮 아 요, 유연한 팁, (3) 20 µ L micropipette, 착 유기 (4) 집에서 만든, (5) 500 µ L PCR 튜브, (6) 10 µ L에 어로 졸 방지 필터 팁, 그리고 (7) 영구 마커 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57627/57627fig2.jpg"> 그림 2: PCR 뇌관 디자인 전략. (A) 콕스 2 유전자를 포함 하는 마우스 염색체 2 시퀀스에 콕스 2 cDNA의 코딩 시퀀스의 도식 적인 표현입니다. Exons 블랙 박스와 introns gDNA 흰색 상자에 표시 됩니다. GDNA에 intronic 시퀀스에 해당 하는 cDNA에서 간격 note 빨간색과 녹색 화살표로 각각 표현 하는 나쁜 및 좋은 oligonucleotides의 대표적인 예. 오른쪽 및 왼쪽 화살표는 앞으로 역 뇌관을 나타냅니다. 시퀀스 (B) 및 (A) 에서처럼 oligonucleotides의 보조 구조 왼쪽 및 오른쪽 패널 헤어핀 complementarity 자기와 자기-이합체 형성을, 각각 나타냅니다. B1 oligonucleotide 반면 B2 oligonucleotide 이합체 형성만 두는 강한 머리 핀 자체 complementarity 고 이합체 형성을 표시 합니다. B 3 과 b 4 oligonucleotides 없는 머리 핀 자체 complementarity 있고 전혀 이합체 형성; 그들은 intron overspanning (A) 하 고 잠재적인 PCR 뇌관 ( 표 1참조)으로 선정 되었습니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57627/57627fig3.jpg"> 그림 3: 다중 PCR의 유효성 검사. 1 마우스 뇌에서 총 RNA의 ng PCR 확대의 2 라운드 뒤 반전 녹음 방송에 복종 되었다. 12 PCR 제품 병행 해III에 의해 소화 Φx174 agarose 젤 전기 이동 법에 의해 별도 차선에서 해결 했다. 두 번째 PCR 제품 크기 (bp)는 시퀀스에 의해 예측 했다: 153 (vGluT1), 248 (GAD65), 255 (GAD67), 181 (콕스 2), 220 (NPY), 146 (SOM), 183 (ATP1a1), 213 (ATP1a2), 128 (ATP1a3), 342 (Kir6.2), 211 (SUR1), 및 182 (솜int). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57627/57627fig4.jpg"> 그림 4: 두뇌 조각에서 수확 하는 패치 클램프. 셀을 시각적으로 확인 한 기록 피 펫은 피 펫의 끝에 세포 파편 오염을 방지 하기 위해 긍정적인 압력 접근 이다. 이 신경의 막에 보조 개 note 긍정적인 압력은 다음 셀 연결 구성 Gigaohm 단단한 물개를 형성 하기 위하여 중단 된다. 짧은 suctions는 전체 셀 구성 전환에 적용 됩니다. 녹음의 끝에, 세포질은 피펫으로에 단단한 물개를 유지 하면서 부드러운 부정적인 압력을 적용 하 여 수확 합니다. 수확 동안 세포 체의 수축 note. 기록 피 펫은 다음 부드럽게 호의 후속 biocytin 계시, 그리고 패치 피 펫에서 수확된 자료의 보존에 대 한 세포 막 폐쇄는 외부 아웃 패치를 철회 했다. 화학의 왕 사회에서 허가 함께 Cauli 및 Lambolez47 에서 재현. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57627/57627fig5.jpg"> 그림 5: 레이어 V neocortical 피라미드 세포의 특성. (A) 막 레이어 V 피라미드 세포의 잠재적인 응답-100,-40,-10, 60, 120, 및 + 500 pA (하단 성분)의 전류 펄스에 의해 유도. 신경 초기 hyperpolarizing 응답 (위 추적) 후 약한 잠재적인 편향 표시 됩니다. Supraliminal 도발은에 대응, 신경 방전 후 hyperpolarization (위 추적)을 천천히 개발 오랫동안 활동 전위. 채도, 근처 신경 낮은 주파수에서 방전 하 고 발음된 적응 (상단 회색 추적)을 전시 합니다. 삽입: 기록 된 레이어 V 피라미드 뉴런의 적외선 사진. Pial 표면 위로 이다입니다. 눈금 막대: 20 µ m (B) 다중 RT-PCR 분석 공개 vGluT1, 솜, ATP1α1, 및 ATP1α3의 표현. (C) 26의 샘플에서 진 식 프로필 레이어 V 피라미드 세포. vGluT1는 GAD65, GAD67, 및 COX2 결코 검색 하는 동안 모든 신경 세포에 표현 했다. NPY, 솜, Kir6.2, SUR1, 및 솜int 드물게 관찰 되었다. 피라미드 세포 표현 ATP1α3 Na+의 1 소 단위 /K+ ATPase, 그리고 낮은 범위를 ATP1α2. (D) 최대 강도 투영 confocal 이미지 (A)에 기록 된 biocytin 신경의 라벨 표시. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57627/57627fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>유전자 / 은행 번호</td>
			<td colspan="2">외부 뇌관</td>
			<td>크기 (bp)</td>
			<td colspan="2">내부 뇌관</td>
			<td>크기 (bp)</td>
		</tr>
<tr>
<td rowspan="4">vGlut1 NM_182993</td>
			<td colspan="2">감각,-113</td>
			<td rowspan="4">259</td>
			<td colspan="2">감각,-54</td>
			<td rowspan="4">153</td>
		</tr>
<tr>
<td colspan="2">GGCTCCTTTTTCTGGGGCTAC</td>
			<td colspan="2">ATTCGCAGCCAACAGGGTCT</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 126</td>
			<td colspan="2">반대로 감각, 79</td>
		</tr>
<tr>
<td colspan="2">CCAGCCGACTCCGTTCTAAG</td>
			<td colspan="2">TGGCAAGCAGGGTATGTGAC</td>
		</tr>
<tr>
<td rowspan="4">GAD65 NM_008078</td>
			<td colspan="2">감각, 99</td>
			<td rowspan="4">375</td>
			<td colspan="2">감각, 219</td>
			<td rowspan="4">248</td>
		</tr>
<tr>
<td colspan="2">CCAAAAGTTCACGGGCGG</td>
			<td colspan="2">CACCTGCGACCAAAAACCCT</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 454</td>
			<td colspan="2">반대로 감각, 447</td>
		</tr>
<tr>
<td colspan="2">TCCTCCAGATTTTGCGGTTG</td>
			<td colspan="2">GATTTTGCGGTTGGTCTGCC</td>
		</tr>
<tr>
<td rowspan="4">GAD67 NM_008077</td>
			<td colspan="2">감각, 529</td>
			<td rowspan="4">598</td>
			<td colspan="2">감각, 801</td>
			<td rowspan="4">255</td>
		</tr>
<tr>
<td colspan="2">TACGGGGTTCGCACAGGTC</td>
			<td colspan="2">CCCAGAAGTGAAGACAAAAGGC</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 1109</td>
			<td colspan="2">반대로 감각, 1034</td>
		</tr>
<tr>
<td colspan="2">CCCAGGCAGCATCCACAT</td>
			<td colspan="2">AATGCTCCGTAAACAGTCGTGC</td>
		</tr>
<tr>
<td rowspan="4">콕스 2 NM_011198</td>
			<td colspan="2">감각, 199</td>
			<td rowspan="4">268</td>
			<td colspan="2">감각, 265</td>
			<td rowspan="4">181</td>
		</tr>
<tr>
<td colspan="2">CTGAAGCCCACCCCAAACAC</td>
			<td colspan="2">AACAACATCCCCTTCCTGCG</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 445</td>
			<td colspan="2">반대로 감각, 426</td>
		</tr>
<tr>
<td colspan="2">CCTTATTTCCCTTCACACCCAT</td>
			<td colspan="2">TGGGAGTTGGGCAGTCATCT</td>
		</tr>
<tr>
<td rowspan="4">NPY NM_023456</td>
			<td colspan="2">감각, 16</td>
			<td rowspan="4">294</td>
			<td colspan="2">감각, 38</td>
			<td rowspan="4">220</td>
		</tr>
<tr>
<td colspan="2">CGAATGGGGCTGTGTGGA</td>
			<td colspan="2">CCCTCGCTCTATCTCTGCTCGT</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 286</td>
			<td colspan="2">반대로 감각, 236</td>
		</tr>
<tr>
<td colspan="2">AAGTTTCATTTCCCATCACCACAT</td>
			<td colspan="2">GCGTTTTCTGTGCTTTCCTTCA</td>
		</tr>
<tr>
<td rowspan="4">솜 NM_009215</td>
			<td colspan="2">감각, 43</td>
			<td rowspan="4">208</td>
			<td colspan="2">감각, 75</td>
			<td rowspan="4">146</td>
		</tr>
<tr>
<td colspan="2">ATCGTCCTGGCTTTGGGC</td>
			<td colspan="2">GCCCTCGGACCCCAGACT</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 231</td>
			<td colspan="2">반대로 감각, 203</td>
		</tr>
<tr>
<td colspan="2">GCCTCATCTCGTCCTGCTCA</td>
			<td colspan="2">GCAAATCCTCGGGCTCCA</td>
		</tr>
<tr>
<td rowspan="4">
ATP1Α1 NM_144900
</td>
			<td colspan="2">감각, 1287</td>
			<td rowspan="4">288</td>
			<td colspan="2">감각, 1329</td>
			<td rowspan="4">183</td>
		</tr>
<tr>
<td colspan="2">CAGGGCAGTGTTTCAGGCTAA</td>
			<td colspan="2">TAAGCGGGCAGTAGCGGG</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 1556</td>
			<td colspan="2">반대로 감각, 1492</td>
		</tr>
<tr>
<td colspan="2">CCGTGGAGAAGGATGGAGC</td>
			<td colspan="2">AGGTGTTTGGGCTCAGATGC</td>
		</tr>
<tr>
<td rowspan="4">ATP1Α2 NM_178405</td>
			<td colspan="2">감각, 1392</td>
			<td rowspan="4">268</td>
			<td colspan="2">감각, 1430</td>
			<td rowspan="4">213</td>
		</tr>
<tr>
<td colspan="2">AGTGAGGAAGATGAGGGACAGG</td>
			<td colspan="2">AAATCCCCTTCAACTCCACCA</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 1640</td>
			<td colspan="2">반대로 감각, 1623</td>
		</tr>
<tr>
<td colspan="2">ACAGAAGCCCAGCACTCGTT</td>
			<td colspan="2">GTTCCCCAAGTCCTCCCAGC</td>
		</tr>
<tr>
<td rowspan="4">ATP1Α3 NM_144921</td>
			<td colspan="2">의미, 127</td>
			<td rowspan="4">216</td>
			<td colspan="2">감각, 158</td>
			<td rowspan="4">128</td>
		</tr>
<tr>
<td colspan="2">CGGAAATACAATACTGACTGCGTG</td>
			<td colspan="2">TGACACACAGTAAAGCCCAGGA</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 324</td>
			<td colspan="2">반대로 감각, 264</td>
		</tr>
<tr>
<td colspan="2">GTCATCCTCCGTCCCTGCC</td>
			<td colspan="2">CCACAGCAGGATAGAGAAGCCA</td>
		</tr>
<tr>
<td rowspan="4">Kir6.2 NM_010602</td>
			<td colspan="2">감각, 306</td>
			<td rowspan="4">431</td>
			<td colspan="2">감각, 339</td>
			<td rowspan="4">342</td>
		</tr>
<tr>
<td colspan="2">CGGAGAGGGCACCAATGT</td>
			<td colspan="2">CATCCACTCCTTTTCATCTGCC</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 719</td>
			<td colspan="2">반대로 감각, 663</td>
		</tr>
<tr>
<td colspan="2">CACCCACGCCATTCTCCA</td>
			<td colspan="2">TCGGGGCTGGTGGTCTTG</td>
		</tr>
<tr>
<td rowspan="4">SUR1 NM_011510</td>
			<td colspan="2">감각, 1867</td>
			<td rowspan="4">385</td>
			<td colspan="2">감각, 2041</td>
			<td rowspan="4">211</td>
		</tr>
<tr>
<td colspan="2">CAGTGTGCCCCCCGAGAG</td>
			<td colspan="2">ATCATCGGAGGCTTCTTCACC</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 2231</td>
			<td colspan="2">반대로 감각, 2231</td>
		</tr>
<tr>
<td colspan="2">GGTCTTCTCCCTCGCTGTCTG</td>
			<td colspan="2">GGTCTTCTCCCTCGCTGTCTG</td>
		</tr>
<tr>
<td rowspan="4">SOMint X51468</td>
			<td colspan="2">감각, 8</td>
			<td rowspan="4">240</td>
			<td colspan="2">감각, 16</td>
			<td rowspan="4">182</td>
		</tr>
<tr>
<td colspan="2">CTGTCCCCCTTACGAATCCC</td>
			<td colspan="2">CTTACGAATCCCCCAGCCTT</td>
		</tr>
<tr>
<td colspan="2">반대로 감각, 228</td>
			<td colspan="2">반대로 감각, 178</td>
		</tr>
<tr>
<td colspan="2">CCAGCACCAGGGATAGAGCC</td>
			<td colspan="2">TTGAAAGCCAGGGAGGAACT</td>
		</tr>
</tbody></table>표 1입니다. 시퀀스의 첫 번째 및 두 번째 PCR 뇌관. 각 PCR 뇌관 및 그들의 시퀀스의 위치를 3' 5'에서 부여 됩니다. Somatostatin intron 제외 1 각 유전자의 시작 codon의 1 루에 해당합니다.

Watch this Scientific Journal Video about Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp at JoVE.com

Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

패치 클램프 후 단일 셀 다중 반전 녹음 방송 연쇄 반응

이 프로토콜에는 중요 한 단계 및 패치 클램프 후 단일 셀 다중 반전 녹음 방송 연쇄 반응 하는 데 필요한 조치 설명 합니다. 이 기술은 패치 클램프 기록 특징 하나의 세포에서 유전자의 미리 결정 된 집합 식 프로 파일을 분석 하는 간단 하 고 효과적인 방법입니다.

The cerebral cortex is composed of numerous cell types exhibiting various morphological, physiological, and molecular features. This diversity hampers ...

single-cell-multiplex-reverse-transcription-polymerase-chain-reaction

Nanyang Technological University

Research

JoVE Journal

Neuroscience

9.7K 조회수.  Sorbonne Université. 이 프로토콜에는 중요 한 단계 및 패치 클램프 후 단일 셀 다중 반전 녹음 방송 연쇄 반응 하는 데 필요한 조치 설명 합니다. 이 기술은 패치 클램프 기록 특징 하나의 세포에서 유전자의 미리 결정 된 집합 식 프로 파일을 분석 하는 간단 하 고 효과적인 방법입니다.

비디오: Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

Culturing and Electrophysiology of Cells on NRCC Patch-clamp Chips

Due to its exquisite sensitivity and the ability to monitor and control individual cells at the level of ion channels, patch-clamping is the gold standard of electrophysiology applied to disease models and pharmaceutical screens alike 1. The method traditionally involves gently contacting a cell with a glass pipette filled by a physiological solution in order to isolate a patch of the membrane under its apex 2. An electrode inserted in the pipette captures ion-channel activity within the membrane patch or, when ruptured, for the whole cell. In the last decade, patch-clamp chips have been proposed as an alternative 3, 4: a suspended film separates the physiological medium from the culture medium, and an aperture microfabricated in the film replaces the apex of the pipette. Patch-clamp chips have been integrated in automated systems and commercialized for high-throughput screening 5. To increase throughput, they include the fluidic delivery of cells from suspension, their positioning on the aperture by suction, and automated routines to detect cell-to-probe seals and enter into whole cell mode. We have reported on the fabrication of a silicon patch-clamp chip with optimized impedance and orifice shape that permits the high-quality recording of action potentials in cultured snail neurons 6; recently, we have also reported progress towards interrogating mammalian neurons 7. Our patch-clamp chips are fabricated at the Canadian Photonics Fabrication Centre 8, a commercial foundry, and are available in large series. We are eager to engage in collaborations with electrophysiologists to validate the use of the NRCC technology in different models. The chips are used according to the general scheme represented in Figure 1: the silicon chip is at the bottom of a Plexiglas culture vial and the back of the aperture is connected to a subterranean channel fitted with tubes at either end of the package. Cells are cultured in the vial and the cell on top of the probe is monitored by a measuring electrode inserted in the channel.The two outside fluidic ports facilitate solution exchange with minimal disturbance to the cell; this is an advantage compared to glass pipettes for intracellular perfusion.
<img alt="Figure 1" src="/files/ftp_upload/3288/3288fig1.jpg" />
Figure 1. Principle of measurement using the NRCC patch-clamp chip
We detail here the protocols to sterilize and prime the chips, load them with medium, plate them with cells, and finally use them for electrophysiological recordings.

We show how planar patch-clamp chips fabricated at the National Research Council of Canada are sterilized, primed, loaded with medium, plated with cells, and used for electrophysiological recordings.

NRCC 패치 - 클램프 칩에 대한 세포의 Culturing 및 전기 생리학

Due to its exquisite sensitivity and the ability to monitor and control individual cells at the level of ion channels, patch-clamping is the gold standard ...

연구

신경과학

Patch-clamp Capacitance Measurements and Ca2+ Imaging at Single Nerve Terminals in Retinal Slices

Visual stimuli are detected and conveyed over a wide dynamic range of light intensities and frequency changes by specialized neurons in the vertebrate retina. Two classes of retinal neurons, photoreceptors and bipolar cells, accomplish this by using ribbon-type active zones, which enable sustained and high-throughput neurotransmitter release over long time periods. ON-type mixed bipolar cell (Mb) terminals in the goldfish retina, which depolarize to light stimuli and receive mixed rod and cone photoreceptor input, are suitable for the study of ribbon-type synapses both due to their large size (~10-12 &mu;m diameter) and to their numerous lateral and reciprocal synaptic connections with amacrine cell dendrites. Direct access to Mb bipolar cell terminals in goldfish retinal slices with the patch-clamp technique allows the measurement of presynaptic Ca2+ currents, membrane capacitance changes, and reciprocal synaptic feedback inhibition mediated by GABAA and GABAC receptors expressed on the terminals. Presynaptic membrane capacitance measurements of exocytosis allow one to study the short-term plasticity of excitatory neurotransmitter release 14,15. In addition, short-term and long-term plasticity of inhibitory neurotransmitter release from amacrine cells can also be investigated by recordings of reciprocal feedback inhibition arriving at the Mb terminal 21. Over short periods of time (e.g. ~10 s), GABAergic reciprocal feedback inhibition from amacrine cells undergoes paired-pulse depression via GABA vesicle pool depletion 11. The synaptic dynamics of retinal microcircuits in the inner plexiform layer of the retina can thus be directly studied.
The brain-slice technique was introduced more than 40 years ago but is still very useful for the investigation of the electrical properties of neurons, both at the single cell soma, single dendrite or axon, and microcircuit synaptic level 19. Tissues that are too small to be glued directly onto the slicing chamber are often first embedded in agar (or placed onto a filter paper) and then sliced 20, 23, 18, 9. In this video, we employ the pre-embedding agar technique using goldfish retina. Some of the giant bipolar cell terminals in our slices of goldfish retina are axotomized (axon-cut) during the slicing procedure. This allows us to isolate single presynaptic nerve terminal inputs, because recording from axotomized terminals excludes the signals from the soma-dendritic compartment. Alternatively, one can also record from intact Mb bipolar cells, by recording from terminals attached to axons that have not been cut during the slicing procedure. Overall, use of this experimental protocol will aid in studies of retinal synaptic physiology, microcircuit functional analysis, and synaptic transmission at ribbon synapses.

Patch-clamp Capacitance Measurements and Ca2+ Imaging at Single Nerve Terminals in Retinal Slices

Here we describe a protocol for the preparation of agar-embedded retinal slices that are suitable for electrophysiology and Ca2+ imaging. This method allows one to study ribbon-type synapses in retinal microcircuits using direct patch-clamp recordings of single presynaptic nerve terminals.

패치 - 클램프 커패시턴스 측정 및 CA 2 +</sup망막 조각의 단일 신경 터미널에서> 영상

Visual stimuli are detected and conveyed over a wide dynamic range of light intensities and frequency changes by specialized neurons in the vertebrate ...

Patch Clamp Recordings in Inner Ear Hair Cells Isolated from Zebrafish

Patch clamp analyses of the voltage-gated channels in sensory hair cells isolated from a variety of species have been described previously1-4 but this video represents the first application of those techniques to hair cells from zebrafish. Here we demonstrate a method to isolate healthy, intact hair cells from all of the inner ear end-organs: saccule, lagena, utricle and semicircular canals. Further, we demonstrate the diversity in hair cell size and morphology and give an example of the kinds of patch clamp recordings that can be obtained. The advantage of the use of this zebrafish model system over others stems from the availability of zebrafish mutants that affect both hearing and balance. In combination with the use of transgenic lines and other techniques that utilize genetic analysis and manipulation, the cell isolation and electrophysiological methods introduced here should facilitate greater insight into the roles hair cells play in mediating these sensory modalities.

The purpose of this video is to demonstrate procedures for obtaining healthy, intact hair cells from the inner ear organs of adult zebrafish and then using them for patch clamp studies aimed at characterizing the biophysical properties of their voltage-gated channels.

귀에 세포의 패치 클램프 녹음 절연 Zebrafish에서

Patch  clamp analyses of the voltage-gated channels in sensory hair cells isolated  from a variety of species have been described previously1-4 but this  ...

Whole Cell Patch Clamp for Investigating the Mechanisms of Infrared Neural Stimulation

It has been demonstrated in recent years that pulsed, infrared laser light can be used to elicit electrical responses in neural tissue, independent of any further modification of the target tissue. Infrared neural stimulation has been reported in a variety of peripheral and sensory neural tissue in vivo, with particular interest shown in stimulation of neurons in the auditory nerve. However, while INS has been shown to work in these settings, the mechanism (or mechanisms) by which infrared light causes neural excitation is currently not well understood. The protocol presented here describes a whole cell patch clamp method designed to facilitate the investigation of infrared neural stimulation in cultured primary auditory neurons. By thoroughly characterizing the response of these cells to infrared laser illumination in vitro under controlled conditions, it may be possible to gain an improved understanding of the fundamental physical and biochemical processes underlying infrared neural stimulation.

Infrared nerve stimulation has been proposed as an alternative to electrical stimulation in a range of nerve types, including those associated with the auditory system. This protocol describes a patch clamp method for studying the mechanism of infrared nerve stimulation in a culture of primary auditory neurons.

적외선 신경 자극의 메커니즘을 조사하는 전체 세포 패치 클램프

It has been  demonstrated in recent years that pulsed, infrared laser light can be used to  elicit electrical responses in neural tissue, independent of ...

Patch Clamp Recordings from Embryonic Zebrafish Mauthner Cells

Mauthner cells (M-cells) are large reticulospinal neurons located in the hindbrain of teleost fish. They are key neurons involved in a characteristic behavior known as the C-start or escape response that occurs when the organism perceives a threat. The M-cell has been extensively studied in adult goldfish where it has been shown to receive a wide range of excitatory, inhibitory and neuromodulatory signals1. We have been examining M-cell activity in embryonic zebrafish in order to study aspects of synaptic development in a vertebrate preparation. In the late 1990s Ali and colleagues developed a preparation for patch clamp recording from M-cells in zebrafish embryos, in which the CNS was largely intact2,3,4. The objective at that time was to record synaptic activity from hindbrain neurons, spinal cord neurons and trunk skeletal muscle while maintaining functional synaptic connections within an intact brain-spinal cord preparation. This preparation is still used in our laboratory today. To examine the mechanisms underlying developmental synaptic plasticity, we record excitatory (AMPA and NMDA-mediated)5,6 and inhibitory (GABA and glycine) synaptic currents from developing M-cells. Importantly, this unique preparation allows us to return to the same cell (M-cell) from preparation to preparation to carefully examine synaptic plasticity and neuro-development in an embryonic organism. The benefits provided by this preparation include 1) intact, functional synaptic connections onto the M-cell, 2) relatively inexpensive preparations, 3) a large supply of readily available embryos 4) the ability to return to the same cell type (i.e. M-cell) in every preparation, so that synaptic development at the level of an individual cell can be examined from fish to fish, and 5) imaging of whole preparations due to the transparent nature of the embryos.

We have developed an intact brain-spinal cord preparation to record and monitor electrical activity via patch clamp recording from the Mauthner neurons and other reticulospinal cells in zebrafish embryos. Thus, we are able to record excitatory and inhibitory synaptic currents, voltage-gated channel activity and action potentials from key neurons in a developing embryo.

배아 Zebrafish의 MAUTHNER 세포에서 패치 클램프 녹음

Mauthner cells (M-cells) are large  reticulospinal neurons located in the hindbrain of teleost fish. They are key  neurons involved in a characteristic ...

A Computer-assisted Multi-electrode Patch-clamp System

The patch-clamp technique is today the most well-established method for recording electrical activity from individual neurons or their subcellular compartments. Nevertheless, achieving stable recordings, even from individual cells, remains a time-consuming procedure of considerable complexity. Automation of many steps in conjunction with efficient information display can greatly assist experimentalists in performing a larger number of recordings with greater reliability and in less time. In order to achieve large-scale recordings we concluded the most efficient approach is not to fully automatize the process but to simplify the experimental steps and reduce the chances of human error while efficiently incorporating the experimenter's experience and visual feedback. With these goals in mind we developed a computer-assisted system which centralizes all the controls necessary for a multi-electrode patch-clamp experiment in a single interface, a commercially available wireless gamepad, while displaying experiment related information and guidance cues on the computer screen. Here we describe the different components of the system which allowed us to reduce the time required for achieving the recording configuration and substantially increase the chances of successfully recording large numbers of neurons simultaneously.

Multi-electrode patch-clamp recordings constitute a complex task. Here we show how, by automating of many of the experimental steps, it is possible to accelerate the process leading to qualitative improvement in performance and number of recordings.

컴퓨터를 이용한 다중 전극 패치 클램프 시스템

The patch-clamp technique is today the most  well-established method for recording electrical activity from individual  neurons or their subcellular ...

Whole-cell Patch-clamp Recordings from Morphologically- and Neurochemically-identified Hippocampal Interneurons

GABAergic inhibitory interneurons play a central role within neuronal circuits of the brain. Interneurons comprise a small subset of the neuronal population (10-20%), but show a high level of physiological, morphological, and neurochemical heterogeneity, reflecting their diverse functions. Therefore, investigation of interneurons provides important insights into the organization principles and function of neuronal circuits. This, however, requires an integrated physiological and neuroanatomical approach for the selection and identification of individual interneuron types. Whole-cell patch-clamp recording from acute brain slices of transgenic animals, expressing fluorescent proteins under the promoters of interneuron-specific markers, provides an efficient method to target and electrophysiologically characterize intrinsic and synaptic properties of specific interneuron types. Combined with intracellular dye labeling, this approach can be extended with post-hoc morphological and immunocytochemical analysis, enabling systematic identification of recorded neurons. These methods can be tailored to suit a broad range of scientific questions regarding functional properties of diverse types of cortical neurons.

Cortical networks are controlled by a small, but diverse set of inhibitory interneurons. Functional investigation of interneurons therefore requires targeted recording and rigorous identification. Described here is a combined approach involving whole-cell recordings from single or synaptically-coupled pairs of neurons with intracellular labeling, post-hoc morphological and immunocytochemical analysis.

Morphologically- 및 Neurochemically 확인 된 해마의 interneurons에서 전체 세포 패치 클램프 녹음

GABAergic inhibitory interneurons play a central role within neuronal circuits of the brain. Interneurons comprise a small subset of the neuronal ...

Recording Light-evoked Postsynaptic Responses in Neurons in Dark-adapted, Mouse Retinal Slice Preparations Using Patch Clamp Techniques

The retina is the gateway to the visual system. To understand visual signal processing mechanisms, we investigate retinal neural network functions. Retinal neurons in the network comprise of numerous subtypes. More than 10 subtypes of bipolar cells, ganglion cells, and amacrine cells have been identified by morphological studies. Multiple subtypes of retinal neurons are thought to encode distinct features of visual signaling, such as motion and color, and form multiple neural pathways. However, the functional roles of each neuron in visual signal processing are not fully understood. The patch clamp method is useful to address this fundamental question. Here, a protocol to record light-evoked synaptic responses in mouse retinal neurons using patch clamp recordings in dark-adapted conditions is provided. The mouse eyes are dark-adapted O/N, and retinal slice preparations are dissected in a dark room using infrared illumination and viewers. Infrared light does not activate mouse photoreceptors and thus preserves their light responsiveness. Patch clamp is used to record light-evoked responses in retinal neurons. A fluorescent dye is injected during recordings to characterize neuronal morphological subtypes. This procedure enables us to determine the physiological functions of each neuron in the mouse retina.

We will demonstrate how to prepare retinal slices from the mouse eye and record light responses in retinal neurons. The entire procedure is conducted in dark-adapted conditions.

녹화 패치 클램프 기술을 사용하여 어두운 적응 마우스 망막 슬라이스 준비에 신경 세포의 시냅스 응답 빛-유발

The retina is the gateway to the visual system. To understand visual signal processing mechanisms, we investigate retinal neural network functions. ...

Whole-cell Patch-clamp Recordings in Brain Slices

Whole-cell patch-clamp recording is an electrophysiological technique that allows the study of the&#160;electrical properties of a substantial part of the neuron. In this configuration, the micropipette is in tight contact with the cell membrane, which prevents current leakage and thereby provides more accurate ionic current measurements than the previously used intracellular sharp electrode recording method. Classically, whole-cell recording can be performed on neurons in various types of preparations, including cell culture models, dissociated neurons, neurons in brain slices, and in intact anesthetized or awake animals. In summary, this technique has immensely contributed to the understanding of passive and active biophysical properties of excitable cells. A major advantage of this technique is that it provides information on how specific manipulations (e.g., pharmacological, experimenter-induced plasticity) may alter specific neuronal functions or channels in real-time. Additionally, significant opening of the plasma membrane allows the internal pipette solution to freely diffuse into the cytoplasm, providing means for introducing drugs, e.g., agonists or antagonists of specific intracellular proteins, and manipulating these targets without altering their functions in neighboring cells. This article will focus on whole-cell recording performed on neurons in brain slices,&#160;a preparation that has the advantage of recording neurons in relatively well preserved brain circuits, i.e., in a physiologically relevant context. In particular,&#160;when combined with appropriate pharmacology, this technique is a powerful tool allowing identification of specific neuroadaptations that occurred following any type of experiences, such as learning, exposure to drugs of abuse, and stress. In summary, whole-cell patch-clamp recordings in brain slices provide means to measure in ex vivo preparation long-lasting changes in neuronal functions that have developed in intact awake animals.

This protocol describes basic procedural steps for performing whole-cell patch-clamp recordings. This technique allows the study of&#160;the electrical behavior of neurons, and when performed in brain slices, allows the assessment of various neuronal functions from neurons that are still integrated in relatively well preserved brain circuits.

뇌 조각에서 전체 셀 패치 클램프 녹음

Whole-cell patch-clamp recording is an electrophysiological technique that allows the study of the&#160;electrical properties of a substantial part of the ...

Whole-cell Patch-clamp Recordings for Electrophysiological Determination of Ion Selectivity in Channelrhodopsins

Over the past decade, channelrhodopsins became indispensable in neuroscientific research where they are used as tools to non-invasively manipulate electrical processes in target cells. In this context, ion selectivity of a channelrhodopsin is of particular importance. This article describes the investigation of chloride selectivity for a recently identified anion-conducting channelrhodopsin of Proteomonas sulcata via electrophysiological patch-clamp recordings on HEK293 cells. The experimental procedure for measuring light-gated photocurrents demands a fast switchable &#8211; ideally monochromatic &#8211; light source coupled into the microscope of an otherwise conventional patch-clamp setup. Preparative procedures prior to the experiment are outlined involving preparation of buffered solutions, considerations on liquid junction potentials, seeding and transfection of cells, and pulling of patch pipettes. The actual recording of current-voltage relations to determine the reversal potentials for different chloride concentrations takes place 24 h to 48 h after transfection. Finally, electrophysiological data are analyzed with respect to theoretical considerations of chloride conduction.

This article describes how the ion selectivity of channelrhodopsin is determined with electrophysiological whole-cell patch-clamp recordings using HEK293 cells. Here, the experimental procedure for investigating chloride selectivity of an anion-selective channelrhodopsin is demonstrated. However, the procedure is transferable to other channelrhodopsins of distinct selectivity.

패치 클램프 후 단일 셀 다중 반전 녹음 방송 연쇄 반응

요약

더 많은 비디오 탐색

이 비디오의 챕터

NRCC 패치 - 클램프 칩에 대한 세포의 Culturing 및 전기 생리학

패치 - 클램프 커패시턴스 측정 및 CA^{2 + 영상}

귀에 세포의 패치 클램프 녹음 절연 Zebrafish에서

적외선 신경 자극의 메커니즘을 조사하는 전체 세포 패치 클램프

배아 Zebrafish의 MAUTHNER 세포에서 패치 클램프 녹음

컴퓨터를 이용한 다중 전극 패치 클램프 시스템

Morphologically- 및 Neurochemically 확인 된 해마의 interneurons에서 전체 세포 패치 클램프 녹음

녹화 패치 클램프 기술을 사용하여 어두운 적응 마우스 망막 슬라이스 준비에 신경 세포의 시냅스 응답 빛-유발

뇌 조각에서 전체 셀 패치 클램프 녹음

Channelrhodopsins에서 이온 선택성의 전기 생리 학적 결정을위한 전체 셀 패치 - 클램프 기록

패치 클램프 후 단일 셀 다중 반전 녹음 방송 연쇄 반응

요약

더 많은 비디오 탐색

이 비디오의 챕터

NRCC 패치 - 클램프 칩에 대한 세포의 Culturing 및 전기 생리학

패치 - 클램프 커패시턴스 측정 및 CA 2 + 영상

귀에 세포의 패치 클램프 녹음 절연 Zebrafish에서

적외선 신경 자극의 메커니즘을 조사하는 전체 세포 패치 클램프

배아 Zebrafish의 MAUTHNER 세포에서 패치 클램프 녹음

컴퓨터를 이용한 다중 전극 패치 클램프 시스템

Morphologically- 및 Neurochemically 확인 된 해마의 interneurons에서 전체 세포 패치 클램프 녹음

녹화 패치 클램프 기술을 사용하여 어두운 적응 마우스 망막 슬라이스 준비에 신경 세포의 시냅스 응답 빛-유발

뇌 조각에서 전체 셀 패치 클램프 녹음

Channelrhodopsins에서 이온 선택성의 전기 생리 학적 결정을위한 전체 셀 패치 - 클램프 기록

패치 - 클램프 커패시턴스 측정 및 CA^{2 + 영상}