We thank F. Benfenati (Istituto Italiano di Tecnologia, IIT) for support and Carmela Vitale for helping with the demonstration. This work was funded by IIT and the Compagnia San Paolo (grant no. 9734 to LAC).

<ol>
	<li>Lam, J. K., Chow, M. Y., Zhang, Y., Leung, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA+Versus+miRNA+as+Therapeutics+for+Gene+Silencing.">siRNA Versus miRNA as Therapeutics for Gene Silencing.</a> Mol Ther-Nucl Acids. 4, e252 (2015).</li><li>Kohl, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemisphere-specific+optogenetic+stimulation+reveals+left-right+asymmetry+of+hippocampal+plasticity.">Hemisphere-specific optogenetic stimulation reveals left-right asymmetry of hippocampal plasticity.</a> Nat Neurosci. 14 (11), 1413-1415 (2011).</li><li>Maejima, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+loss+of+P/Q-type+channels+confined+to+rhombic-lip-derived+neurons+alters+synaptic+transmission+at+the+parallel+fiber+to+purkinje+cell+synapse+and+replicates+genomic+Cacna1a+mutation+phenotype+of+ataxia+and+seizures+in+mice.">Postnatal loss of P/Q-type channels confined to rhombic-lip-derived neurons alters synaptic transmission at the parallel fiber to purkinje cell synapse and replicates genomic Cacna1a mutation phenotype of ataxia and seizures in mice.</a> J Neurosci. 33 (12), 5162-5174 (2013).</li><li>Mark, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delayed+postnatal+loss+of+P/Q-type+calcium+channels+recapitulates+the+absence+epilepsy,+dyskinesia,+and+ataxia+phenotypes+of+genomic+Cacna1a+mutations.">Delayed postnatal loss of P/Q-type calcium channels recapitulates the absence epilepsy, dyskinesia, and ataxia phenotypes of genomic Cacna1a mutations.</a> J Neurosci. 31 (11), 4311-4326 (2011).</li><li>Thalhammer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+P/Q-Type+Ca2++Channels+Shapes+Presynaptic+Plasticity.">Alternative Splicing of P/Q-Type Ca2+ Channels Shapes Presynaptic Plasticity.</a> Cell Rep. 20 (2), 333-343 (2017).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-phosphate-mediated+Transfection+of+Eukaryotic+Cells+with+Plasmid+DNAs.">Calcium-phosphate-mediated Transfection of Eukaryotic Cells with Plasmid DNAs.</a> CSH Protoc. 2006 (1), (2006).</li><li>Chung, K. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycistronic+RNA+polymerase+II+expression+vectors+for+RNA+interference+based+on+BIC/miR-155.">Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155.</a> Nucleic Acids Res. 34 (7), e53 (2006).</li><li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titering+of+recombinant+adeno-associated+viral+vectors.">Production and titering of recombinant adeno-associated viral vectors.</a> J Vis Exp. (57), e3348 (2011).</li><li>Cingolani, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity-dependent+regulation+of+synaptic+AMPA+receptor+composition+and+abundance+by+beta3+integrins.">Activity-dependent regulation of synaptic AMPA receptor composition and abundance by beta3 integrins.</a> Neuron. 58 (5), 749-762 (2008).</li><li>Huang, H., Xu, Y., Cheng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+alternative+splicing+during+epithelial-mesenchymal+transition.">Detection of alternative splicing during epithelial-mesenchymal transition.</a> J Vis Exp. (92), e51845 (2014).</li><li>Vandesompele, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+normalization+of+real-time+quantitative+RT-PCR+data+by+geometric+averaging+of+multiple+internal+control+genes.">Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.</a> Genome Biol. 3 (7), (2002).</li><li>Cetin, A., Komai, S., Eliava, M., Seeburg, P. H., Osten, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stereotaxic+gene+delivery+in+the+rodent+brain.">Stereotaxic gene delivery in the rodent brain.</a> Nat Protoc. 1 (6), 3166-3173 (2006).</li><li>Paxinos, G., Franklin, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (2012).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2013).</li><li>Gunaydin, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+optogenetic+control.">Ultrafast optogenetic control.</a> Nat Neurosci. 13 (3), 387-392 (2010).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+of+alpha+1A+subunit+gene+generates+phenotypic+variants+of+P-+and+Q-type+calcium+channels.">Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels.</a> Nat Neurosci. 2 (5), 407-415 (1999).</li><li>Chaudhuri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing+as+a+molecular+switch+for+Ca2+/calmodulin-dependent+facilitation+of+P/Q-type+Ca2++channels.">Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels.</a> J Neurosci. 24 (28), 6334-6342 (2004).</li><li>Soong, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+splice+variants+in+human+P/Q-type+channel+alpha1(2.1)+subunits:+implications+for+current+density+and+Ca2+-dependent+inactivation.">Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation.</a> J Neurosci. 22 (23), 10142-10152 (2002).</li><li>Berndt, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+channelrhodopsins+for+fast+neuronal+stimulation+at+low+light+levels.">High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels.</a> P Natl Acad Sci USA. 108 (18), 7595-7600 (2011).</li><li>Klapoetke, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Independent+optical+excitation+of+distinct+neural+populations.">Independent optical excitation of distinct neural populations.</a> Nat Methods. 11 (3), 338-346 (2014).</li><li>Lin, J. Y., Lin, M. Z., Steinbach, P., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+engineered+channelrhodopsin+variants+with+improved+properties+and+kinetics.">Characterization of engineered channelrhodopsin variants with improved properties and kinetics.</a> Biophys J. 96 (5), 1803-1814 (2009).</li><li>Zhang, Y. P., Oertner, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+induction+of+synaptic+plasticity+using+a+light-sensitive+channel.">Optical induction of synaptic plasticity using a light-sensitive channel.</a> Nat Methods. 4 (2), 139-141 (2007).</li><li>Fowler, D. K., Williams, C., Gerritsen, A. T., Washbourne, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+knockdown+from+artificial+microRNAs+in+an+enhanced+miR-155+backbone:+a+designer's+guide+to+potent+multi-target+RNAi.">Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi.</a> Nucleic Acids Res. 44 (5), e48 (2016).</li></ol>

The authors have nothing to disclose.

Co-expression of an optogenetic probe and a miR against a presynaptic gene of interest offers a powerful approach to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. For this experimental approach, it is important to identify and characterize miRs that are highly efficient and selective in knocking down the gene of interest in native systems. If possible, two or more independent miRs against the same mRNA of interest should be used to control for eventual off-target effects. Rescue experiments, in which a miR-resistant gene is reintroduced in the system, can be used as a control for specificity.
Using the same construct to express an optogenetic probe and a miR allows for stimulating optically only the presynaptic neurons that have been manipulated. This is not possible with electrical stimulations because they do not distinguish between infected and non-infected neurons, thus producing mixed and diluted results. Because optical stimulations can induce multiple action potentials15, it is important to choose only the fastest optogenetic probes, among an expanding palette15,19,20,21. In addition, it is essential to ensure that optical stimulation does not induce a direct depolarization of presynaptic boutons, to avoid bypassing some of the steps of synaptic transmission one wishes to investigate22.
The experimental approach we describe here, makes it possible to evaluate in parallel the physiological relevance of multiple presynaptic genes of interest within a limited time period (4&#8211;6 months). However, it is important to keep in mind that knockdowns rarely reach 100%. Moreover, rAAVs need to be expressed for at least two weeks to allow for maximal knockdown and full expression of the optogenetic probe, which may represent a time constraint when investigating early developmental processes. Though more time consuming, conditional knockout mice limited to presynaptic neurons, generally result in complete removal of the gene of interest and offer therefore a valid complementary approach.
A specific advantage of the miR technology is that it enables the expression of multiple miRs from the same promoter. This property has mainly been used to increase knockdown efficiency by inserting multiple copies of the same miR or different miRs against the same target gene. It can however be used also to knockdown multiple genes by expressing miRs against different target genes7,23. This property might be used to silence multiple presynaptic proteins to dissect presynaptic signaling pathways.
Here, we have combined optogenetics with artificial miRs to characterize the effects of gene knockdown on presynaptic function in acute hippocampal slices. A similar approach could also be used to manipulate and probe neuronal circuitry in vivo. In addition, combining artificial miRs with chemogenetic approaches would enable one to interrogate neuronal circuitry on longer time scales.

This protocol describes a new approach to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. Investigating presynaptic function in intact neuronal circuits is challenging because many presynaptic boutons are too small and far away from the soma to allow combined molecular and electrophysiological interventions. Although RNA interference offers a powerful and flexible means to knockdown synaptic proteins1, this approach has been used sparingly to investigate presynaptic function because it is difficult to detect the effects of knockdown using traditional electrical stimulations, which do not distinguish between manipulated and na&#239;ve presynaptic boutons2. Here, we describe how to combine artificial microRNA (miR)-mediated RNA interference with recently developed optogenetic technology to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices.
While conditional knockout mice in combination with electrophysiology could also be used to investigate the function of presynaptic proteins3,4, our strategy does not require the development and maintenance of genetically modified mouse lines and can also be easily employed to knock down specific isoforms of a gene. Relative to more commonly used short hairpin RNAs (shRNAs), artificial miRs, which we employ here, offer key advantages for knockdown in neurons. Unlike shRNAs, they can be expressed under the control of a polymerase II promoter1. Thus, a single promoter can be used to drive the expression of both miR and an optogenetic probe, along with a fluorescent reporter. In this way, the size of the construct can be kept within the packaging limits of recombinant adeno-associated viruses (rAAV, Figure 1A). Also, the use of a single construct and a single promoter reduces experimental variability because it allows for expression of the miR, the optogenetic probe and the fluorescent reporter in a fixed ratio.
We have recently applied this technology to examine the role of alternatively spliced isoforms of presynaptic calcium channels in the hippocampus5. Such a strategy is generally applicable to studying the physiological relevance of other presynaptically expressed proteins in any brain circuit of interest.

<table>
	<tbody>
		<tr>
			<td>Acrylamide</td>
			<td>Sigma</td>
			<td>Acrylamide/Bis-acrylamide, 30% solution</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Animal Temperature Controller with heat pad</td>
			<td>WPI</td>
			<td>ATC2000</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA protein assay kit</td>
			<td>ThermoFisher Scientific</td>
			<td>23225</td>
			<td></td>
		</tr>
		<tr>
			<td>BLOCK-iT Pol II miR RNAi Expression Vector kit</td>
			<td>ThermoFisher Scientific</td>
			<td>K4936-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Brain slices Prechamber</td>
			<td>Harvard Apparatus</td>
			<td>BSC-PC</td>
			<td></td>
		</tr>
		<tr>
			<td>CCD camera-based imager</td>
			<td>Bio-Rad</td>
			<td>ChemiDoc&#8482; MP</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture reagents</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate</td>
			<td>GE Helthcare</td>
			<td>ECL Western Blotting Reagents, RPN2106</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma</td>
			<td>C2432</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Cytosine &#946;-D-arabinofuranoside</td>
			<td>Sigma</td>
			<td>C6645</td>
			<td></td>
		</tr>
		<tr>
			<td>Drill</td>
			<td>Foredom</td>
			<td>K.1030</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Sigma</td>
			<td>E4378</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentamicin ointment</td>
			<td>Local pharmacy</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma</td>
			<td>G7021</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Sigma</td>
			<td>54459</td>
			<td></td>
		</tr>
		<tr>
			<td>Injection micropipettes</td>
			<td>Narishige</td>
			<td>GD1</td>
			<td></td>
		</tr>
		<tr>
			<td>Inorganic salts &#38; detergents</td>
			<td>Sigma</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K2-creatine phosphate</td>
			<td>Calbiochem</td>
			<td>237911</td>
			<td></td>
		</tr>
		<tr>
			<td>KGluconate</td>
			<td>Fluka</td>
			<td>60245</td>
			<td></td>
		</tr>
		<tr>
			<td>Laser</td>
			<td>Laserglow Technologies</td>
			<td>LRS-0473-GFM-00100-03</td>
			<td></td>
		</tr>
		<tr>
			<td>Membrane</td>
			<td>Amersham</td>
			<td>Protran&#8482; 0.2 &#181;m NC</td>
			<td></td>
		</tr>
		<tr>
			<td>MgATP</td>
			<td>Sigma</td>
			<td>A9187</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipette holder</td>
			<td>Narishige</td>
			<td>IM-H1</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Narishige</td>
			<td>PC-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3GTP</td>
			<td>Sigma</td>
			<td>G8877</td>
			<td></td>
		</tr>
		<tr>
			<td>NaPyruvate</td>
			<td>Sigma</td>
			<td>P5280</td>
			<td></td>
		</tr>
		<tr>
			<td>Ocular lubricant</td>
			<td>Local pharmacy</td>
			<td>Lacrigel</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate inhibitors</td>
			<td>Sigma</td>
			<td>P0044, P5726</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitors</td>
			<td>Sigma</td>
			<td>cOmplete&#8482;, EDTA-free Protease Inhibitor Cocktail</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein gel electrophoresis and blotting devices</td>
			<td>Bio-Rad</td>
			<td>Mini-Protean III Cell</td>
			<td></td>
		</tr>
		<tr>
			<td>Providone iodine</td>
			<td>Local pharmacy</td>
			<td>Betadine</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiazol Lysis Reagent</td>
			<td>Qiagen</td>
			<td>79306</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>QuantiTect Reverse 
			Transcription Kit</td>
			<td>Qiagen</td>
			<td>205311</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Micro Kit</td>
			<td>Qiagen</td>
			<td>74004</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>ThermoFisher Scientific</td>
			<td>Nanodrop 2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereotactic apparatus</td>
			<td>WPI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tetrodotoxin</td>
			<td>Tocris</td>
			<td>1069</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Vibratome</td>
			<td>Leica</td>
			<td>VT1200S</td>
			<td></td>
		</tr>
	</tbody>
</table>

combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a workflow on how to combine artificial microRNA (miR)-mediated RNA interference with optogenetics to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices. The experimental approach involves the use of a single viral construct and a single neuron-specific promoter to drive the expression of both an optogenetic probe and artificial miR(s) against presynaptic gene(s). When stereotactically injected in the brain region of interest, the expressed construct makes it possible to stimulate with light exclusively the neurons with reduced expression of the gene(s) under investigation. This strategy does not require the development and maintenance of genetically modified mouse lines and can in principle be applied to other organisms and to any neuronal gene of choice. We have recently applied it to investigate how the knockdown of alternative splice isoforms of presynaptic P/Q-type voltage-gated calcium channels (VGCCs) regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses in acute hippocampal slices. A similar approach could also be used to manipulate and probe the neuronal circuitry in vivo.

The procedures described above provide a robust method to assess how synaptic transmission is affected by the knockdown of synaptic proteins in presynaptic neurons. Representative results on how the knockdown of alternative splice isoforms of presynaptic Cav2.1 (P/Q-type) VGCCs regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses are given below as an example.
Cav2.1 (P/Q-type) channels are the predominant presynaptic VGCCs at most fast synapses in the central nervous system. Alternative splicing of the mutually exclusive exons 37a and 37b of the pore-forming &#945;1 subunit of Cav2.1 (&#945;1A) produces two major variants, Cav2.1[EFa] and Cav2.1[EFb]16,17,18. To determine whether Cav2.1[EFa] and Cav2.1[EFb] differentially regulate synaptic transmission and plasticity in rat hippocampal pyramidal neurons, we first developed isoform-specific miRs to knockdown selectively Cav2.1[EFa] or Cav2.1[EFb]5. Despite the short size (97 bp) and high similarity (61.86% identity at the nucleotide level) between exons 37a and 37b, we could design three miR sequences against rat Cav2.1[EFa] (miR EFa1: TCCTTATAGTGAATGCGGCCG; miR EFa2: ATGTCCTTATAGTGAATGCGG; miR EFa3: TTGCAAGCAACCCTATGAGGA) and two against rat Cav2.1[EFb] (miR EFb1: ATACATGTCCGGGTAAGGCAT; miR EFb2: ATCTGATACATGTCCGGGTAA) with predicted high knockdown efficiency. As negative control (miR Control), we used the pcDNA6.2-GW/EmGFP-miR-neg plasmid containing a sequence that does not target any known vertebrate gene. Based on a first screen in HEK 293 cells against heterologous channels, we selected miR EFa1, miR EFa3 and miR EFb2 and cloned their expression cassettes into the 3&#39;UTR of the vector pAAV-Syn-ChETA-TdT-miR-X, which is designed for production of rAAVs and where the synapsin promoter drives expression of the ultrafast channelrhodopsin ChETA, the red fluorescent protein TdTomato and the inserted miR (Figure 1). We also duplicated the expression cassette of miR EFb2 to increase the knockdown efficiency of this miR.
Next, we prepared rAAV1/2 for the above four constructs, and quantified their knockdown efficiency and selectivity in primary rat neuronal cultures using isoform-specific qRT-PCR. miR EFa1 and miR EFa3 reduced mRNA of native Cav2.1[EFa] by ~70% but not that of Cav2.1[EFb], whilst miR EFb reduced mRNA of native Cav2.1[EFb] by ~60% but not that of Cav2.1[EFa] (Figure 2).
We then stereotactically injected each of the four rAAV1/2 into the CA3 area of the hippocampus of P18 rats (Figure 3A-C), with coordinates of (A-P/M-L/D-V from Bregma) &#8722;2.6/&#177; 2.9/&#8722;2.9. Fifteen to twenty-four days post-injection, we prepared acute hippocampal slices from rAAV1/2-injected rats and used TdTomato fluorescence to confirm the expression and localization of rAAVs (Figure 3B). To investigate whether presynaptic knockdown of either Cav2.1[EFa] or Cav2.1[EFb] affected short-term synaptic plasticity at CA3 to CA1 synapses, we stimulated selectively infected CA3 neurons with brief 473 nm laser light pulses (2 ms-long; Figure 3C), and recorded the resulting EPSCs by patching pyramidal neurons in the proximal to medial tract of the CA1 region (Figure 3C). We found that the knockdown of Cav2.1 splice isoforms affected responses to paired-pulse stimulation in opposite directions: knockdown of Cav2.1[EFa] (miR EFa1 or miR EFa3) boosted paired-pulse facilitation (PPF) whereas knockdown of Cav2.1[EFb] (miR EFb2) abolished it (Figure 3D, E).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57223/57223fig1.jpg" /> 
Figure 1: Scheme of the constructs for combined expression of the ultrafast optogenetic probe ChETA and isoform-specific miRs against Cav2.1[EFa] and Cav2.1[EFb]. (A) Map of the rAAV construct pAAV-Syn-ChETA-TdT-miR-X, containing a synapsin promoter (Syn), the ultrafast channelrhodopsin ChETA fused to TdTomato and, in the proximal 3&#39;UTR, a Cav2.1 splice isoform-specific miR. Restriction enzymes shown are single cutters. (B) Top, scheme of the expression cassette. The synapsin promoter drives expression of both ChETA-TdTomato and an isoform-specific miR. Bottom, reverse complement of the 21-nucleotide target sequences, which form part of the miR cassette. For miR EFb2 two identical miR cassettes were expressed in tandem one after the other. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57223/57223fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57223/57223fig2.jpg" /> 
Figure 2. Evaluation of the knockdown efficiency and selectivity of isoform-specific miRs for Cav2.1[EFa] and Cav2.1[EFb]. Isoform-specific qRT-PCR analysis on RNA isolated from 17-18 DIV primary cultures infected at 6 DIV with rAAVs expressing miRs targeting either Cav2.1[EFa] (miR EFa1 and miR EFa3) or Cav2.1[EFb] (miR EFb2). Data are normalized to the negative control (miR Control). miR EFa1 and miR EFa3 significantly and selectively reduce mRNA of Cav2.1[EFa] (n = 8 and 7 cultures, respectively), while miR EFb significantly and selectively reduces mRNA of Cav2.1[EFb] (n = 4 cultures; ***p&#60;0.001; one-way analysis of variance test followed by the Tukey-Kramer post-test). Data are presented as mean &#177; SEM. This figure has been adapted from Thalhammer, A. et al.5. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57223/57223fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57223/57223fig3.jpg" /> 
Figure 3. Assessing the role of Cav2.1[EFa] and Cav2.1[EFb] in the native hippocampus by targeted stimulation of knocked-down neurons with optogenetics. (A) Scheme of the expression cassette of the rAAV constructs used for in vivo infection. (B) Hippocampal section showing that TdTomato fluorescence is limited to the CA3 region and its projections. (C) Experimental configuration: laser beam was directed onto CA3 somata, and patch clamp recordings were performed from CA1 pyramidal neurons. (D) 2 ms-long blue (473 nm) laser light pulses shone at 20 Hz evoke EPSCs whose PPF is increased by miRs targeting Cav2.1[EFa] and abolished by miR for Cav2.1[EFb]. (E) Summary of paired-pulse ratio for experiments as in (D), showing an increase in PPF for miR EFa1 and miR EFa3 and a decrease for miR EFb2, relative to miR Control (n = 9 - 11 recordings; *p=0.02; **p=0.01; ***p&#60;0.0004; analysis of covariance). Data are presented as mean &#177; SEM. This figure has been adapted from Thalhammer, A. et al.5. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57223/57223fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

combining-optogenetics-with-artificial-micrornas-to-characterize

Nanyang Technological University

Research

JoVE Journal

Neuroscience

10.1K Views.  Istituto Italiano di Tecnologia. This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.

Video: Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Vibrodissociation of Neurons from Rodent Brain Slices to Study Synaptic Transmission and Image Presynaptic Terminals

Mechanical dissociation of neurons from the central nervous system has the advantage that presynaptic boutons remain attached to the isolated neuron of interest. This allows for examination of synaptic transmission under conditions where the extracellular and postsynaptic intracellular environments can be well controlled. A vibration-based technique without the use of proteases, known as vibrodissociation, is the most popular technique for mechanical isolation. A micropipette, with the tip fire-polished to the shape of a small ball, is placed into a brain slice made from a P1-P21 rodent. The micropipette is vibrated parallel to the slice surface and lowered through the slice thickness resulting in the liberation of isolated neurons. The isolated neurons are ready for study within a few minutes of vibrodissociation. This technique has advantages over the use of primary neuronal cultures, brain slices and enzymatically isolated neurons including: rapid production of viable, relatively mature neurons suitable for electrophysiological and imaging studies; superior control of the extracellular environment free from the influence of neighboring cells; suitability for well-controlled pharmacological experiments using rapid drug application and total cell superfusion; and improved space-clamp in whole-cell recordings relative to neurons in slice or cell culture preparations. This preparation can be used to examine synaptic physiology, pharmacology, modulation and plasticity. Real-time imaging of both pre- and postsynaptic elements in the living cells and boutons is also possible using vibrodissociated neurons. Characterization of the molecular constituents of pre- and postsynaptic elements can also be achieved with immunological and imaging-based approaches.

This report demonstrates a technique for mechanical isolation of individual viable neurons retaining attached presynaptic boutons. Vibrodissociated neurons have the advantages of rapid production, excellent pharmacological control and improved space-clamp without influence from neighboring cells. This method can be used for imaging of synaptic elements and patch-clamp recording.

Mechanical dissociation of neurons from the central nervous system has the advantage that presynaptic boutons remain attached to the isolated neuron of ...

Mapping Inhibitory Neuronal Circuits by Laser Scanning Photostimulation

Inhibitory neurons are crucial to cortical function. They comprise about 20% of the entire cortical neuronal population and can be further subdivided into diverse subtypes based on their immunochemical, morphological, and physiological properties1-4. Although previous research has revealed much about intrinsic properties of individual types of inhibitory neurons, knowledge about their local circuit connections is still relatively limited3,5,6. Given that each individual neuron's function is shaped by its excitatory and inhibitory synaptic input within cortical circuits, we have been using laser scanning photostimulation (LSPS) to map local circuit connections to specific inhibitory cell types. Compared to conventional electrical stimulation or glutamate puff stimulation, LSPS has unique advantages allowing for extensive mapping and quantitative analysis of local functional inputs to individually recorded neurons3,7-9. Laser photostimulation via glutamate uncaging selectively activates neurons perisomatically, without activating axons of passage or distal dendrites, which ensures a sub-laminar mapping resolution. The sensitivity and efficiency of LSPS for mapping inputs from many stimulation sites over a large region are well suited for cortical circuit analysis.
Here we introduce the technique of LSPS combined with whole-cell patch clamping for local inhibitory circuit mapping. Targeted recordings of specific inhibitory cell types are facilitated by use of transgenic mice expressing green fluorescent proteins (GFP) in limited inhibitory neuron populations in the cortex3,10, which enables consistent sampling of the targeted cell types and unambiguous identification of the cell types recorded. As for LSPS mapping, we outline the system instrumentation, describe the experimental procedure and data acquisition, and present examples of circuit mapping in mouse primary somatosensory cortex. As illustrated in our experiments, caged glutamate is activated in a spatially restricted region of the brain slice by UV laser photolysis; simultaneous voltage-clamp recordings allow detection of photostimulation-evoked synaptic responses. Maps of either excitatory or inhibitory synaptic input to the targeted neuron are generated by scanning the laser beam to stimulate hundreds of potential presynaptic sites. Thus, LSPS enables the construction of detailed maps of synaptic inputs impinging onto specific types of inhibitory neurons through repeated experiments. Taken together, the photostimulation-based technique offers neuroscientists a powerful tool for determining the functional organization of local cortical circuits.

This paper introduces an approach of combining laser scanning photostimulation with whole cell recordings in transgenic mice expressing GFP in limited inhibitory neuron populations. The technique allows for extensive mapping and quantitative analysis of local synaptic circuits of specific inhibitory cortical neurons.

Inhibitory neurons are crucial to cortical function. They comprise about 20% of the entire cortical neuronal population and can be further subdivided into ...

Multi-unit Recording Methods to Characterize Neural Activity in the Locust (Schistocerca Americana) Olfactory Circuits

Detection and interpretation of olfactory cues are critical for the survival of many organisms. Remarkably, species across phyla have strikingly similar olfactory systems suggesting that the biological approach to chemical sensing has been optimized over evolutionary time1. In the insect olfactory system, odorants are transduced by olfactory receptor neurons (ORN) in the antenna, which convert chemical stimuli into trains of action potentials. Sensory input from the ORNs is then relayed to the antennal lobe (AL; a structure analogous to the vertebrate olfactory bulb). In the AL, neural representations for odors take the form of spatiotemporal firing patterns distributed across ensembles of principal neurons (PNs; also referred to as projection neurons)2,3. The AL output is subsequently processed by Kenyon cells (KCs) in the downstream mushroom body (MB), a structure associated with olfactory memory and learning4,5. Here, we present electrophysiological recording techniques to monitor odor-evoked neural responses in these olfactory circuits.
First, we present a single sensillum recording method to study odor-evoked responses at the level of populations of ORNs6,7. We discuss the use of saline filled sharpened glass pipettes as electrodes to extracellularly monitor ORN responses. Next, we present a method to extracellularly monitor PN responses using a commercial 16-channel electrode3. A similar approach using a custom-made 8-channel twisted wire tetrode is demonstrated for Kenyon cell recordings8. We provide details of our experimental setup and present representative recording traces for each of these techniques.

Multi-unit Recording Methods to Characterize Neural Activity in the Locust Schistocerca Americana Olfactory Circuits

We demonstrate variations of the extracellular multi-unit recording technique to characterize odor-evoked responses in the first three stages of the invertebrate olfactory pathway. These techniques can easily be adapted to examine ensemble activity in other neural systems as well.

Detection and interpretation of olfactory cues are critical for the survival  of many organisms. Remarkably, species across phyla have strikingly similar ...

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

The brain's ability to change in response to experience is essential for healthy brain function, and abnormalities in this process contribute to a variety of brain disorders1,2. To better understand the mechanisms by which brain circuits react to an animal's experience requires the ability to monitor the experience-dependent molecular changes in a given set of neurons, over a prolonged period of time, in the live animal. While experience and associated neural activity is known to trigger gene expression changes in neurons1,2, most of the methods to detect such changes do not allow repeated observation of the same neurons over multiple days or do not have sufficient resolution to observe individual neurons3,4. Here, we describe a method that combines in vivo two-photon microscopy with a genetically encoded fluorescent reporter to track experience-dependent gene expression changes in individual cortical neurons over the course of day-to-day experience. 
One of the well-established experience-dependent genes is Activity-regulated cytoskeletal associated protein (Arc)5,6. The transcription of Arc is rapidly and highly induced by intensified neuronal activity3, and its protein product regulates the endocytosis of glutamate receptors and long-term synaptic plasticity7. The expression of Arc has been widely used as a molecular marker to map neuronal circuits involved in specific behaviors3. In most of those studies, Arc expression was detected by in situ hybridization or immunohistochemistry in fixed brain sections. Although those methods revealed that the expression of Arc was localized to a subset of excitatory neurons after behavioral experience, how the cellular patterns of Arc expression might change with multiple episodes of repeated or distinctive experiences over days was not investigated. 
In vivo two-photon microscopy offers a powerful way to examine experience-dependent cellular changes in the living brain8,9. To enable the examination of Arc expression in live neurons by two-photon microscopy, we previously generated a knock-in mouse line in which a GFP reporter is placed under the control of the endogenous Arc promoter10. This protocol describes the surgical preparations and imaging procedures for tracking experience-dependent Arc-GFP expression patterns in neuronal ensembles in the live animal. In this method, chronic cranial windows were first implanted in Arc-GFP mice over the cortical regions of interest. Those animals were then repeatedly imaged by two-photon microscopy after desired behavioral paradigms over the course of several days. This method may be generally applicable to animals carrying other fluorescent reporters of experience-dependent molecular changes4.

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

Experience-dependent molecular changes in neurons are essential for the brain's ability to adapt in response to behavioral challenges. An in vivo two-photon imaging method is described here that allows the tracking of such molecular changes in individual cortical neurons through genetically encoded reporters.

The brain's ability to change in response to experience is essential for healthy brain function, and abnormalities in this process contribute to a variety ...

Fast Micro-iontophoresis of Glutamate and GABA: A Useful Tool to Investigate Synaptic Integration

One of the fundamental interests in neuroscience is to understand the integration of excitatory and inhibitory inputs along the very complex structure of the dendritic tree, which eventually leads to neuronal output of action potentials at the axon. The influence of diverse spatial and temporal parameters of specific synaptic input on neuronal output is currently under investigation, e.g. the distance-dependent attenuation of dendritic inputs, the location-dependent interaction of spatially segregated inputs, the influence of GABAergig inhibition on excitatory integration, linear and non-linear integration modes, and many more.
With fast micro-iontophoresis of glutamate and GABA it is possible to precisely investigate the spatial and temporal integration of glutamatergic excitation and GABAergic inhibition. Critical technical requirements are either a triggered fluorescent lamp, light-emitting diode (LED), or a two-photon scanning microscope to visualize dendritic branches without introducing significant photo-damage of the tissue. Furthermore, it is very important to have a micro-iontophoresis amplifier that allows for fast capacitance compensation of high resistance pipettes. Another crucial point is that no transmitter is involuntarily released by the pipette during the experiment.
Once established, this technique will give reliable and reproducible signals with a high neurotransmitter and location specificity. Compared to glutamate and GABA uncaging, fast iontophoresis allows using both transmitters at the same time but at very distant locations without limitation to the field of view. There are also advantages compared to focal electrical stimulation of axons: with micro-iontophoresis the location of the input site is definitely known and it is sure that only the neurotransmitter of interest is released. However it has to be considered that with micro-iontophoresis only the postsynapse is activated and presynaptic aspects of neurotransmitter release are not resolved. In this article we demonstrate how to set up micro-iontophoresis in brain slice experiments.

In this article we introduce fast micro-iontophoresis of neurotransmitters as a technique to investigate integration of postsynaptic signals with high spatial and temporal precision.

One of the fundamental interests in neuroscience is to understand the integration of excitatory and inhibitory inputs along the very complex structure of ...

A Procedure for Implanting Organized Arrays of Microwires for Single-unit Recordings in Awake, Behaving Animals

In vivo electrophysiological recordings in the awake, behaving animal provide a powerful method for understanding neural signaling at the single-cell level. The technique allows experimenters to examine temporally and regionally specific firing patterns in order to correlate recorded action potentials with ongoing behavior. Moreover, single-unit recordings can be combined with a plethora of other techniques in order to produce comprehensive explanations of neural function. In this article, we describe the anesthesia and preparation for microwire implantation. Subsequently, we enumerate the necessary equipment and surgical steps to accurately insert a microwire array into a target structure. Lastly, we briefly describe the equipment used to record from each individual electrode in the array. The fixed microwire arrays described are well-suited for chronic implantation and allow for longitudinal recordings of neural data in almost any behavioral preparation. We discuss tracing electrode tracks to triangulate microwire positions as well as ways to combine microwire implantation with immunohistochemical techniques in order to increase the anatomical specificity of recorded results.

Implanting organized arrays of microwires for use in single-unit electrophysiological recordings presents a number of technical challenges.&#160;Methods for performing this technique and the equipment necessary are described.&#160;Also, the beneficial use of organized microwire arrays to record from distinct neural subregions with high spatial selectivity is discussed.

In vivo electrophysiological recordings in the awake, behaving animal provide a powerful method for understanding neural signaling at the single-cell ...

Using the Electroretinogram to Assess Function in the Rodent Retina and the Protective Effects of Remote Limb Ischemic Preconditioning

The ERG is the sum of all retinal activity. The ERG is usually recorded from the cornea, which acts as an antenna that collects and sums signals from the retina. The ERG is a sensitive measure of changes in retinal function that are pan-retinal, but is less effective for detecting damage confined to a small area of retina. In the present work we describe how to record the &#8216;flash&#8217; ERG, which is the potential generated when the retina is exposed to a brief light flash. We describe methods of anaesthesia, mydriasis and corneal management during recording; how to keep the retina dark adapted; electrode materials and placement; the range and calibration of stimulus energy; recording parameters and the extraction of data. We also describe a method of inducing ischemia in one limb, and how to use the ERG to assess the effects of this remote-from-the-retina ischemia on retinal function after light damage. A two-flash protocol is described which allows isolation of the cone-driven component of the dark-adapted ERG, and thereby the separation of the rod and cone components. Because it can be recorded with techniques that are minimally invasive, the ERG has been widely used in studies of the physiology, pharmacology and toxicology of the retina. We describe one example of this usefulness, in which the ERG is used to assess the function of the light-damaged retina, with and without a neuroprotective intervention; preconditioning by remote ischemia.

The electroretinogram (ERG) is an electrical potential generated by the retina in response to light. This paper describes how to use the ERG to assess retinal function, in dark-adapted rats, and how it can be can be used to assess a neuroprotective intervention, in the present case remote ischemic preconditioning.

The ERG is the sum of all retinal activity. The ERG is usually recorded from the cornea, which acts as an antenna that collects and sums signals from the ...

Optogenetic Entrainment of Hippocampal Theta Oscillations in Behaving Mice

Extensive data on relationships of neural network oscillations to behavior and organization of neuronal discharge across brain regions call for new tools to selectively manipulate brain rhythms. Here we describe an approach combining projection-specific optogenetics with extracellular electrophysiology for high-fidelity control of hippocampal theta oscillations (5-10 Hz) in behaving mice. The specificity of the optogenetic entrainment is achieved by targeting channelrhodopsin-2 (ChR2) to the GABAergic population of medial septal cells, crucially involved in the generation of hippocampal theta oscillations, and a local synchronized activation of a subset of inhibitory septal afferents in the hippocampus. The efficacy of the optogenetic rhythm control is verified by a simultaneous monitoring of the local field potential (LFP) across lamina of the CA1 area and/or of neuronal discharge. Using this readily implementable preparation we show efficacy of various optogenetic stimulation protocols for induction of theta oscillations and for the manipulation of their frequency and regularity. Finally, a combination of the theta rhythm control with projection-specific inhibition addresses the readout of particular aspects of the hippocampal synchronization by efferent regions.

We describe the use of optogenetics and electrophysiological recordings for selective manipulations of hippocampal theta oscillations (5-10 Hz) in behaving mice. The efficacy of the rhythm entrainment is monitored using local field potential. A combination of opto- and pharmacogenetic inhibition addresses the efferent readout of hippocampal synchronization.

Extensive data on relationships of neural network oscillations to behavior and organization of neuronal discharge across brain regions call for new tools ...

Optogenetics Identification of a Neuronal Type with a Glass Optrode in Awake Mice

It is a major concern in neuroscience how different types of neurons work in neural circuits. Recent advances in optogenetics have enabled the identification of the neuronal type in in vivo electrophysiological experiments in broad brain regions. In optogenetics experiments, it is critical to deliver the light to the recording site. However, it is often hard to deliver the stimulation light to the deep brain regions from the brain&#39;s surface. Especially, it is difficult for the stimulation light to reach the deep brain regions when the optical transparency of the brain surface is low, as is often the case with recordings from awake animals. Here, we describe a method to record spike responses to the light from an awake mouse using a custom-made glass optrode. In this method, the light is delivered through the recording glass electrode so that it is possible to reliably stimulate the recorded neuron with light in the deep brain regions. This custom-made optrode system consists of accessible and inexpensive materials and is easy to assemble.

This work introduces a method to perform an optogenetic single-unit recording reliably from an awake mouse using a custom-made glass optrode.

It is a major concern in neuroscience how different types of neurons work in neural circuits. Recent advances in optogenetics have enabled the ...

In Vivo Calcium Imaging of Lateral-line Hair Cells in Larval Zebrafish

Sensory hair cells are mechanoreceptors found in the inner ear that are required for hearing and balance. Hair cells are activated in response to sensory stimuli that mechanically deflect apical protrusions called hair bundles. Deflection opens mechanotransduction (MET) channels in hair bundles, leading to an influx of cations, including calcium. This cation influx depolarizes the cell and opens voltage-gated calcium channels located basally at the hair-cell presynapse. In mammals, hair cells are encased in bone, and it is challenging to functionally assess these activities in vivo. In contrast, larval zebrafish are transparent and possess an externally located lateral-line organ that contains hair cells. These hair cells are functionally and structurally similar to mammalian hair cells and can be functionally assessed in vivo. This article outlines a technique that utilizes a genetically encoded calcium indicator (GECI), GCaMP6s, to measure stimulus-evoked calcium signals in zebrafish lateral-line hair cells. GCaMP6s can be used, along with confocal imaging, to measure in vivo calcium signals at the apex and base of lateral-line hair cells. These signals provide a real-time, quantifiable readout of both mechanosensation- and presynapse-dependent calcium activities within these hair cells. These calcium signals also provide important functional information regarding how hair cells detect and transmit sensory stimuli. Overall, this technique generates useful data about relative changes in calcium activity in vivo. It is less well-suited for quantification of the absolute magnitude of calcium changes. This in vivo technique is sensitive to motion artifacts. A reasonable amount of practice and skill are required for proper positioning, immobilization, and stimulation of larvae. Ultimately, when properly executed, the protocol outlined in this article provides a powerful way to collect valuable information about the activity of hair-cells in their natural, fully integrated states within a live animal.

The zebrafish is a model system that has many valuable features including optical clarity, rapid external development, and, of particular importance to the field of hearing and balance, externally located sensory hair cells. This article outlines how transgenic zebrafish can be used to assay both hair-cell mechanosensation and presynaptic function in toto.

Sensory hair cells are mechanoreceptors found in the inner ear that are required for hearing and balance. Hair cells are activated in response to sensory ...

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Summary

Explore More Videos

Chapters in this video

Vibrodissociation of Neurons from Rodent Brain Slices to Study Synaptic Transmission and Image Presynaptic Terminals

Mapping Inhibitory Neuronal Circuits by Laser Scanning Photostimulation

Multi-unit Recording Methods to Characterize Neural Activity in the Locust (Schistocerca Americana) Olfactory Circuits

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

Fast Micro-iontophoresis of Glutamate and GABA: A Useful Tool to Investigate Synaptic Integration

A Procedure for Implanting Organized Arrays of Microwires for Single-unit Recordings in Awake, Behaving Animals

Using the Electroretinogram to Assess Function in the Rodent Retina and the Protective Effects of Remote Limb Ischemic Preconditioning

Optogenetic Entrainment of Hippocampal Theta Oscillations in Behaving Mice

Optogenetics Identification of a Neuronal Type with a Glass Optrode in Awake Mice

In Vivo Calcium Imaging of Lateral-line Hair Cells in Larval Zebrafish