We thank F. Benfenati (Istituto Italiano di Tecnologia, IIT) for support and Carmela Vitale for helping with the demonstration. This work was funded by IIT and the Compagnia San Paolo (grant no. 9734 to LAC).

<ol>
	<li>Lam, J. K., Chow, M. Y., Zhang, Y. and Leung, S. W. siRNA Versus miRNA as Therapeutics for Gene Silencing. Mol Ther-Nucl Acids. 4 e252 (2015).</li>
	<li>Kohl, M. M. et al. Hemisphere-specific optogenetic stimulation reveals left-right asymmetry of hippocampal plasticity. Nat Neurosci. 14 (11), 1413-1415 (2011).</li>
	<li>Maejima, T. et al. Postnatal loss of P/Q-type channels confined to rhombic-lip-derived neurons alters synaptic transmission at the parallel fiber to purkinje cell synapse and replicates genomic Cacna1a mutation phenotype of ataxia and seizures in mice. J Neurosci. 33 (12), 5162-5174 (2013).</li>
	<li>Mark, M. D. et al. Delayed postnatal loss of P/Q-type calcium channels recapitulates the absence epilepsy, dyskinesia, and ataxia phenotypes of genomic Cacna1a mutations. J Neurosci. 31 (11), 4311-4326 (2011).</li>
	<li>Thalhammer, A. et al. Alternative Splicing of P/Q-Type Ca2+ Channels Shapes Presynaptic Plasticity. Cell Rep. 20 (2), 333-343 (2017).</li>
	<li>Sambrook, J. and Russell, D. W. Calcium-phosphate-mediated Transfection of Eukaryotic Cells with Plasmid DNAs. CSH Protoc. 2006 (1), (2006).</li>
	<li>Chung, K. H. et al. Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155. Nucleic Acids Res. 34 (7), e53 (2006).</li>
	<li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M. and Murray, A. J. Production and titering of recombinant adeno-associated viral vectors. J Vis Exp. (57), e3348 (2011).</li>
	<li>Cingolani, L. A. et al. Activity-dependent regulation of synaptic AMPA receptor composition and abundance by beta3 integrins. Neuron. 58 (5), 749-762 (2008).</li>
	<li>Huang, H., Xu, Y. and Cheng, C. Detection of alternative splicing during epithelial-mesenchymal transition. J Vis Exp. (92), e51845 (2014).</li>
	<li>Vandesompele, J. et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7), RESEARCH0034 (2002).</li>
	<li>Cetin, A., Komai, S., Eliava, M., Seeburg, P. H. and Osten, P. Stereotaxic gene delivery in the rodent brain. Nat Protoc. 1 (6), 3166-3173 (2006).</li>
	<li>Paxinos, G. and Franklin, K. B. The Mouse Brain in Stereotaxic Coordinates. Academic Press, (2012).</li>
	<li>Paxinos, G. and Watson, C. The Rat Brain in Stereotaxic Coordinates. Academic Press, (2013).</li>
	<li>Gunaydin, L. A. et al. Ultrafast optogenetic control. Nat Neurosci. 13 (3), 387-392 (2010).</li>
	<li>Bourinet, E. et al. Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels. Nat Neurosci. 2 (5), 407-415 (1999).</li>
	<li>Chaudhuri, D. et al. Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels. J Neurosci. 24 (28), 6334-6342 (2004).</li>
	<li>Soong, T. W. et al. Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation. J Neurosci. 22 (23), 10142-10152 (2002).</li>
	<li>Berndt, A. et al. High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. P Natl Acad Sci USA. 108 (18), 7595-7600 (2011).</li>
	<li>Klapoetke, N. C. et al. Independent optical excitation of distinct neural populations. Nat Methods. 11 (3), 338-346 (2014).</li>
	<li>Lin, J. Y., Lin, M. Z., Steinbach, P. and Tsien, R. Y. Characterization of engineered channelrhodopsin variants with improved properties and kinetics. Biophys J. 96 (5), 1803-1814 (2009).</li>
	<li>Zhang, Y. P. and Oertner, T. G. Optical induction of synaptic plasticity using a light-sensitive channel. Nat Methods. 4 (2), 139-141 (2007).</li>
	<li>Fowler, D. K., Williams, C., Gerritsen, A. T. and Washbourne, P. Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer&#39;s guide to potent multi-target RNAi. Nucleic Acids Res. 44 (5), e48 (2016).</li>
</ol>

The authors have nothing to disclose.

Co-expression of an optogenetic probe and a miR against a presynaptic gene of interest offers a powerful approach to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. For this experimental approach, it is important to identify and characterize miRs that are highly efficient and selective in knocking down the gene of interest in native systems. If possible, two or more independent miRs against the same mRNA of interest should be used to control for eventual off-target effects. Rescue experiments, in which a miR-resistant gene is reintroduced in the system, can be used as a control for specificity.
Using the same construct to express an optogenetic probe and a miR allows for stimulating optically only the presynaptic neurons that have been manipulated. This is not possible with electrical stimulations because they do not distinguish between infected and non-infected neurons, thus producing mixed and diluted results. Because optical stimulations can induce multiple action potentials15, it is important to choose only the fastest optogenetic probes, among an expanding palette15,19,20,21. In addition, it is essential to ensure that optical stimulation does not induce a direct depolarization of presynaptic boutons, to avoid bypassing some of the steps of synaptic transmission one wishes to investigate22.
The experimental approach we describe here, makes it possible to evaluate in parallel the physiological relevance of multiple presynaptic genes of interest within a limited time period (4&#8211;6 months). However, it is important to keep in mind that knockdowns rarely reach 100%. Moreover, rAAVs need to be expressed for at least two weeks to allow for maximal knockdown and full expression of the optogenetic probe, which may represent a time constraint when investigating early developmental processes. Though more time consuming, conditional knockout mice limited to presynaptic neurons, generally result in complete removal of the gene of interest and offer therefore a valid complementary approach.
A specific advantage of the miR technology is that it enables the expression of multiple miRs from the same promoter. This property has mainly been used to increase knockdown efficiency by inserting multiple copies of the same miR or different miRs against the same target gene. It can however be used also to knockdown multiple genes by expressing miRs against different target genes7,23. This property might be used to silence multiple presynaptic proteins to dissect presynaptic signaling pathways.
Here, we have combined optogenetics with artificial miRs to characterize the effects of gene knockdown on presynaptic function in acute hippocampal slices. A similar approach could also be used to manipulate and probe neuronal circuitry in vivo. In addition, combining artificial miRs with chemogenetic approaches would enable one to interrogate neuronal circuitry on longer time scales.

This protocol describes a new approach to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. Investigating presynaptic function in intact neuronal circuits is challenging because many presynaptic boutons are too small and far away from the soma to allow combined molecular and electrophysiological interventions. Although RNA interference offers a powerful and flexible means to knockdown synaptic proteins1, this approach has been used sparingly to investigate presynaptic function because it is difficult to detect the effects of knockdown using traditional electrical stimulations, which do not distinguish between manipulated and na&#239;ve presynaptic boutons2. Here, we describe how to combine artificial microRNA (miR)-mediated RNA interference with recently developed optogenetic technology to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices.
While conditional knockout mice in combination with electrophysiology could also be used to investigate the function of presynaptic proteins3,4, our strategy does not require the development and maintenance of genetically modified mouse lines and can also be easily employed to knock down specific isoforms of a gene. Relative to more commonly used short hairpin RNAs (shRNAs), artificial miRs, which we employ here, offer key advantages for knockdown in neurons. Unlike shRNAs, they can be expressed under the control of a polymerase II promoter1. Thus, a single promoter can be used to drive the expression of both miR and an optogenetic probe, along with a fluorescent reporter. In this way, the size of the construct can be kept within the packaging limits of recombinant adeno-associated viruses (rAAV, Figure 1A). Also, the use of a single construct and a single promoter reduces experimental variability because it allows for expression of the miR, the optogenetic probe and the fluorescent reporter in a fixed ratio.
We have recently applied this technology to examine the role of alternatively spliced isoforms of presynaptic calcium channels in the hippocampus5. Such a strategy is generally applicable to studying the physiological relevance of other presynaptically expressed proteins in any brain circuit of interest.

<table><tbody><tr><td>Acrylamide</td><td>Sigma</td><td>Acrylamide/Bis-acrylamide, 30% solution</td><td>Toxic</td></tr><tr><td>Animal Temperature Controller with heat pad</td><td>WPI</td><td>ATC2000</td><td></td></tr><tr><td>BCA protein assay kit</td><td>ThermoFisher Scientific</td><td>23225</td><td></td></tr><tr><td>BLOCK-iT Pol II miR RNAi Expression Vector kit</td><td>ThermoFisher Scientific</td><td>K4936-00</td><td></td></tr><tr><td>Brain slices Prechamber</td><td>Harvard Apparatus</td><td>BSC-PC</td><td></td></tr><tr><td>CCD camera-based imager</td><td>Bio-Rad</td><td>ChemiDoc&amp;trade; MP</td><td></td></tr><tr><td>Cell Culture reagents</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Chemiluminescent substrate</td><td>GE Helthcare</td><td>ECL Western Blotting Reagents, RPN2106</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>C2432</td><td>Toxic</td></tr><tr><td>Cytosine &amp;beta;-D-arabinofuranoside</td><td>Sigma</td><td>C6645</td><td></td></tr><tr><td>Drill</td><td>Foredom</td><td>K.1030</td><td></td></tr><tr><td>EGTA</td><td>Sigma</td><td>E4378</td><td></td></tr><tr><td>Gentamicin ointment</td><td>Local pharmacy</td><td></td><td></td></tr><tr><td>Glucose</td><td>Sigma</td><td>G7021</td><td></td></tr><tr><td>Hepes</td><td>Sigma</td><td>54459</td><td></td></tr><tr><td>Injection micropipettes</td><td>Narishige</td><td>GD1</td><td></td></tr><tr><td>Inorganic salts &amp;amp; detergents</td><td>Sigma</td><td></td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;-creatine phosphate</td><td>Calbiochem</td><td>237911</td><td></td></tr><tr><td>KGluconate</td><td>Fluka</td><td>60245</td><td></td></tr><tr><td>Laser</td><td>Laserglow Technologies</td><td>LRS-0473-GFM-00100-03</td><td></td></tr><tr><td>Membrane</td><td>Amersham</td><td>Protran&amp;trade; 0.2 &amp;micro;m NC</td><td></td></tr><tr><td>MgATP</td><td>Sigma</td><td>A9187</td><td></td></tr><tr><td>Micropipette holder</td><td>Narishige</td><td>IM-H1</td><td></td></tr><tr><td>Micropipette puller</td><td>Narishige</td><td>PC-100</td><td></td></tr><tr><td>Na&lt;sub&gt;3&lt;/sub&gt;GTP</td><td>Sigma</td><td>G8877</td><td></td></tr><tr><td>NaPyruvate</td><td>Sigma</td><td>P5280</td><td></td></tr><tr><td>Ocular lubricant</td><td>Local pharmacy</td><td>Lacrigel</td><td></td></tr><tr><td>Phosphate inhibitors</td><td>Sigma</td><td>P0044, P5726</td><td></td></tr><tr><td>Protease inhibitors</td><td>Sigma</td><td>cOmplete&amp;trade;, EDTA-free Protease Inhibitor Cocktail</td><td></td></tr><tr><td>Protein gel electrophoresis and blotting devices</td><td>Bio-Rad</td><td>Mini-Protean III Cell</td><td></td></tr><tr><td>Providone iodine</td><td>Local pharmacy</td><td>Betadine</td><td></td></tr><tr><td>Qiazol Lysis Reagent</td><td>Qiagen</td><td>79306</td><td>Toxic</td></tr><tr><td>QuantiTect Reverse&lt;br/&gt; Transcription Kit</td><td>Qiagen</td><td>205311</td><td></td></tr><tr><td>RNeasy Micro Kit</td><td>Qiagen</td><td>74004</td><td></td></tr><tr><td>Spectrophotometer</td><td>ThermoFisher Scientific</td><td>Nanodrop 2000</td><td></td></tr><tr><td>Stereotactic apparatus</td><td>WPI</td><td></td><td></td></tr><tr><td>Tetrodotoxin</td><td>Tocris</td><td>1069</td><td>Toxic</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1200S</td><td></td></tr></tbody></table>

combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a workflow on how to combine artificial microRNA (miR)-mediated RNA interference with optogenetics to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices. The experimental approach involves the use of a single viral construct and a single neuron-specific promoter to drive the expression of both an optogenetic probe and artificial miR(s) against presynaptic gene(s). When stereotactically injected in the brain region of interest, the expressed construct makes it possible to stimulate with light exclusively the neurons with reduced expression of the gene(s) under investigation. This strategy does not require the development and maintenance of genetically modified mouse lines and can in principle be applied to other organisms and to any neuronal gene of choice. We have recently applied it to investigate how the knockdown of alternative splice isoforms of presynaptic P/Q-type voltage-gated calcium channels (VGCCs) regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses in acute hippocampal slices. A similar approach could also be used to manipulate and probe the neuronal circuitry in vivo.

The procedures described above provide a robust method to assess how synaptic transmission is affected by the knockdown of synaptic proteins in presynaptic neurons. Representative results on how the knockdown of alternative splice isoforms of presynaptic Cav2.1 (P/Q-type) VGCCs regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses are given below as an example.
Cav2.1 (P/Q-type) channels are the predominant presynaptic VGCCs at most fast synapses in the central nervous system. Alternative splicing of the mutually exclusive exons 37a and 37b of the pore-forming &#945;1 subunit of Cav2.1 (&#945;1A) produces two major variants, Cav2.1[EFa] and Cav2.1[EFb]16,17,18. To determine whether Cav2.1[EFa] and Cav2.1[EFb] differentially regulate synaptic transmission and plasticity in rat hippocampal pyramidal neurons, we first developed isoform-specific miRs to knockdown selectively Cav2.1[EFa] or Cav2.1[EFb]5. Despite the short size (97 bp) and high similarity (61.86% identity at the nucleotide level) between exons 37a and 37b, we could design three miR sequences against rat Cav2.1[EFa] (miR EFa1: TCCTTATAGTGAATGCGGCCG; miR EFa2: ATGTCCTTATAGTGAATGCGG; miR EFa3: TTGCAAGCAACCCTATGAGGA) and two against rat Cav2.1[EFb] (miR EFb1: ATACATGTCCGGGTAAGGCAT; miR EFb2: ATCTGATACATGTCCGGGTAA) with predicted high knockdown efficiency. As negative control (miR Control), we used the pcDNA6.2-GW/EmGFP-miR-neg plasmid containing a sequence that does not target any known vertebrate gene. Based on a first screen in HEK 293 cells against heterologous channels, we selected miR EFa1, miR EFa3 and miR EFb2 and cloned their expression cassettes into the 3&#39;UTR of the vector pAAV-Syn-ChETA-TdT-miR-X, which is designed for production of rAAVs and where the synapsin promoter drives expression of the ultrafast channelrhodopsin ChETA, the red fluorescent protein TdTomato and the inserted miR (Figure 1). We also duplicated the expression cassette of miR EFb2 to increase the knockdown efficiency of this miR.
Next, we prepared rAAV1/2 for the above four constructs, and quantified their knockdown efficiency and selectivity in primary rat neuronal cultures using isoform-specific qRT-PCR. miR EFa1 and miR EFa3 reduced mRNA of native Cav2.1[EFa] by ~70% but not that of Cav2.1[EFb], whilst miR EFb reduced mRNA of native Cav2.1[EFb] by ~60% but not that of Cav2.1[EFa] (Figure 2).
We then stereotactically injected each of the four rAAV1/2 into the CA3 area of the hippocampus of P18 rats (Figure 3A-C), with coordinates of (A-P/M-L/D-V from Bregma) &#8722;2.6/&#177; 2.9/&#8722;2.9. Fifteen to twenty-four days post-injection, we prepared acute hippocampal slices from rAAV1/2-injected rats and used TdTomato fluorescence to confirm the expression and localization of rAAVs (Figure 3B). To investigate whether presynaptic knockdown of either Cav2.1[EFa] or Cav2.1[EFb] affected short-term synaptic plasticity at CA3 to CA1 synapses, we stimulated selectively infected CA3 neurons with brief 473 nm laser light pulses (2 ms-long; Figure 3C), and recorded the resulting EPSCs by patching pyramidal neurons in the proximal to medial tract of the CA1 region (Figure 3C). We found that the knockdown of Cav2.1 splice isoforms affected responses to paired-pulse stimulation in opposite directions: knockdown of Cav2.1[EFa] (miR EFa1 or miR EFa3) boosted paired-pulse facilitation (PPF) whereas knockdown of Cav2.1[EFb] (miR EFb2) abolished it (Figure 3D, E).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57223/57223fig1.jpg" /> 
Figure 1: Scheme of the constructs for combined expression of the ultrafast optogenetic probe ChETA and isoform-specific miRs against Cav2.1[EFa] and Cav2.1[EFb]. (A) Map of the rAAV construct pAAV-Syn-ChETA-TdT-miR-X, containing a synapsin promoter (Syn), the ultrafast channelrhodopsin ChETA fused to TdTomato and, in the proximal 3&#39;UTR, a Cav2.1 splice isoform-specific miR. Restriction enzymes shown are single cutters. (B) Top, scheme of the expression cassette. The synapsin promoter drives expression of both ChETA-TdTomato and an isoform-specific miR. Bottom, reverse complement of the 21-nucleotide target sequences, which form part of the miR cassette. For miR EFb2 two identical miR cassettes were expressed in tandem one after the other. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57223/57223fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57223/57223fig2.jpg" /> 
Figure 2. Evaluation of the knockdown efficiency and selectivity of isoform-specific miRs for Cav2.1[EFa] and Cav2.1[EFb]. Isoform-specific qRT-PCR analysis on RNA isolated from 17-18 DIV primary cultures infected at 6 DIV with rAAVs expressing miRs targeting either Cav2.1[EFa] (miR EFa1 and miR EFa3) or Cav2.1[EFb] (miR EFb2). Data are normalized to the negative control (miR Control). miR EFa1 and miR EFa3 significantly and selectively reduce mRNA of Cav2.1[EFa] (n = 8 and 7 cultures, respectively), while miR EFb significantly and selectively reduces mRNA of Cav2.1[EFb] (n = 4 cultures; ***p&#60;0.001; one-way analysis of variance test followed by the Tukey-Kramer post-test). Data are presented as mean &#177; SEM. This figure has been adapted from Thalhammer, A. et al.5. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57223/57223fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57223/57223fig3.jpg" /> 
Figure 3. Assessing the role of Cav2.1[EFa] and Cav2.1[EFb] in the native hippocampus by targeted stimulation of knocked-down neurons with optogenetics. (A) Scheme of the expression cassette of the rAAV constructs used for in vivo infection. (B) Hippocampal section showing that TdTomato fluorescence is limited to the CA3 region and its projections. (C) Experimental configuration: laser beam was directed onto CA3 somata, and patch clamp recordings were performed from CA1 pyramidal neurons. (D) 2 ms-long blue (473 nm) laser light pulses shone at 20 Hz evoke EPSCs whose PPF is increased by miRs targeting Cav2.1[EFa] and abolished by miR for Cav2.1[EFb]. (E) Summary of paired-pulse ratio for experiments as in (D), showing an increase in PPF for miR EFa1 and miR EFa3 and a decrease for miR EFb2, relative to miR Control (n = 9 - 11 recordings; *p=0.02; **p=0.01; ***p&#60;0.0004; analysis of covariance). Data are presented as mean &#177; SEM. This figure has been adapted from Thalhammer, A. et al.5. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57223/57223fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

combining-optogenetics-with-artificial-micrornas-to-characterize

Nanyang Technological University

Research

JoVE Journal

Neuroscience

10.2K Views.  Istituto Italiano di Tecnologia. This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.

Video: Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Stereotactic Injection of MicroRNA-expressing Lentiviruses to the Mouse Hippocampus CA1 Region and Assessment of the Behavioral Outcome

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an entire gene expression pathway by inducing destruction and/or inhibiting translation of these targets. Several miRNAs play key roles in maintaining neuronal structure and function and in higher-level brain functions, and methods are sought for manipulating their levels for exploring these functions. Here, we present a direct in vivo method for examining the cognitive consequences of enforced miRNAs excess in mice by stereotactic injection of miRNA-encoding virus particles. Specifically, the current protocol involves injection into the hippocampal CA1 region, which contributes to mammalian memory consolidation, learning, and stress responses, and offers a convenient injection site. The coordinates are measured according to the mouse bregma and virus perfusion is digitally controlled and kept very slow. After injection, the surgery wound is sealed and the animals recover. Lentiviruses encoding silencers of the corresponding mRNA targets serve to implicate the specific miRNA/target interaction responsible for the observed effect, with na&iuml;ve mice, mice injected with saline and mice injected with "empty" lentivirus vectors as controls. One month post-injection, the animals are examined in the Morris Water Maze (MWM) for assessing their navigation learning and memory abilities. The MWM is a round tank filled with colored water with a small platform submerged 1 cm below the water surface. Steady visual cues around the tank allow for spatial navigation (sound and the earth's magnetic field may also assist the animals in navigating). Video camera monitoring enables measuring the route of swim and the time to find and amount the platform. The mouse is first taught that mounting the hidden platform offers an escape from the enforced swimming; it is then tested for using this escape and finally, the platform is removed and probe tests examine if the mouse remembers its previous location. Repeated tests over several consecutive days highlight improved performance of tested mice at shorter latencies to find and mount the platform, and as more direct routes to reach the platform or its location. Failure to show such improvement represents impaired learning and memory and/or anxiety, which may then be tested specifically (e.g. in the elevated plus maze). This approach enables validation of specific miRNAs and target transcripts in the studied cognitive and/or stress-related processes.

MicroRNAs have significant roles in brain structure and function. Here we describe a method to enforce hippocampal miRNA over-expression using stereotactic injection of an engineered miRNA-expressing lentivirus. This approach can serve as a relatively rapid way to assess the in vivo effects of over-expressed miRNAs in specific brain regions.

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an ...

Behavior

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

Optogenetic methods have emerged as a powerful tool for elucidating neural circuit activity underlying a diverse set of behaviors across a broad range of species. Optogenetic tools of microbial origin consist of light-sensitive membrane proteins that are able to activate (e.g., channelrhodopsin-2, ChR2) or silence (e.g., halorhodopsin, NpHR) neural activity ingenetically-defined cell types over behaviorally-relevant timescales. We first demonstrate a simple approach for adeno-associated virus-mediated delivery of ChR2 and NpHR transgenes to the dorsal subiculum and prelimbic region of the prefrontal cortex in rat. Because ChR2 and NpHR are genetically targetable, we describe the use of this technology to control the electrical activity of specific populations of neurons (i.e., pyramidal neurons) embedded in heterogeneous tissue with high temporal precision. We describe herein the hardware, custom software user interface, and procedures that allow for simultaneous light delivery and electrical recording from transduced pyramidal neurons in an anesthetized in vivo preparation. These light-responsive tools provide the opportunity for identifying the causal contributions of different cell types to information processing and behavior.

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

The recent development of neuroscience tools that combine genetics and optics, termed "optogenetics", enables control over neural circuit activity with an unprecedented level of spatial and temporal resolution. Here we provide a protocol for integrating in vivo recording with optogenetic manipulation of genetically-defined subsets of prefrontal cortical and subicular pyramidal neurons.

Optogenetic methods  have emerged as a powerful tool for elucidating neural circuit activity  underlying a diverse set of behaviors across a broad range ...

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is required to perform functional studies. In this paper, we demonstrate the cerebroventricular microinjection (CVMI) technique as a means to modulate gene expression in the adult zebrafish brain. By using CVMI, substances can be administered into the cerebroventricular fluid and be thoroughly distributed along the rostrocaudal axis of the brain. We particularly focus on the use of antisense morpholino oligonucleotides, which are potent tools for knocking down gene expression in vivo. In our method, when applied, morpholino molecules are taken up by the cells lining the ventricular surface. These cells include the radial glial cells, which act as neurogenic progenitors. Therefore, knocking down gene expression in the radial glial cells is of utmost importance to analyze the widespread neurogenesis response in zebrafish, and also would provide insight into how vertebrates could sustain adult neurogenesis response. Such an understanding would also help the efforts for clinical applications in human neurodegenerative disorders and central nervous system regeneration. Thus, we present the cerebroventricular microinjection method as a quick and efficient way to alter gene expression and neurogenesis response in the adult zebrafish forebrain. We also provide troubleshooting tips and other useful information on how to carry out the CVMI procedure.

In this article, we demonstrate a method for manipulation of gene expression in the ventricular cells of the adult zebrafish telencephalon using antisense morpholino oligonucleotides. We present this method as an efficient and quick protocol that can be used for functional studies in the adult vertebrate brain.

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Laser-scanning Photostimulation of Optogenetically Targeted Forebrain Circuits

The sensory forebrain is composed of intricately connected cell types, of which functional properties have yet to be fully elucidated. Understanding the interactions of these forebrain circuits has been aided recently by the development of optogenetic methods for light-mediated modulation of neuronal activity. Here, we describe a protocol for examining the functional organization of forebrain circuits&#160;in vitro using laser-scanning photostimulation of channelrhodopsin, expressed optogenetically via viral-mediated transfection. This approach also exploits the utility of cre-lox recombination in transgenic mice to target expression in specific neuronal cell types. Following transfection, neurons are physiologically recorded in slice preparations using whole-cell patch clamp to measure their evoked responses to laser-scanning photostimulation of channelrhodopsin expressing fibers. This approach enables an assessment of functional topography and synaptic properties. Morphological correlates can be obtained by imaging the neuroanatomical expression of channelrhodopsin expressing fibers using confocal microscopy of the live slice or post-fixed tissue. These methods enable functional investigations of forebrain circuits that expand upon more conventional approaches.

We describe a method for characterizing the functional topography and synaptic properties of forebrain circuits using an optogenetic approach to photostimulate neuronal populations&#160;in vitro.

The sensory forebrain is composed of intricately connected cell types, of which functional properties have yet to be fully elucidated. Understanding the ...

Optogenetic Manipulation of Neuronal Activity to Modulate Behavior in Freely Moving Mice

Optogenetic modulation of neuronal circuits in freely moving mice affects acute and long-term behavior. This method is able to perform manipulations of single neurons and region-specific transmitter release, up to whole neuronal circuitries in the central nervous system, and allows the direct measurement of behavioral outcomes. Neurons express optogenetic tools via an injection of viral vectors carrying the DNA of choice, such as Channelrhodopsin2 (ChR2). Light is brought into specific brain regions via chronic optical implants that terminate directly above the target region. After two weeks of recovery and proper tool-expression, mice can be repeatedly used for behavioral tests with optogenetic stimulation of the neurons of interest.
Optogenetic modulation has a high temporal and spatial resolution that can be accomplished with high cell specificity, compared to the commonly used methods such as chemical or electrical stimulation. The light does not harm neuronal tissue and can therefore be used for long-term experiments as well as for multiple behavioral experiments in one mouse. The possibilities of optogenetic tools are nearly unlimited and enable the activation or silencing of whole neurons, or even the manipulation of a specific receptor type by light.
The results of such behavioral experiments with integrated optogenetic stimulation directly visualizes changes in behavior caused by the manipulation. The behavior of the same animal without light stimulation as a baseline is a good control for induced changes. This allows a detailed overview of neuronal types or neurotransmitter systems involved in specific behaviors, such as anxiety. The plasticity of neuronal networks can also be investigated in great detail through long-term stimulation or behavioral observations after optical stimulation. Optogenetics will help to enlighten neuronal signaling in several kinds of neurological diseases.

With optogenetic manipulation of specific neuronal populations or brain regions, behavior can be modified with high temporal and spatial resolution in freely moving animals. By using different optogenetic tools in combination with chronically implanted optical fibers, a variety of neuronal modulations and behavioral testing can be performed.

Optogenetic modulation of neuronal circuits in freely moving mice affects acute and long-term behavior. This method is able to perform manipulations of ...

A Simple Alternative to Stereotactic Injection for Brain Specific Knockdown of miRNA

MicroRNAs (miRNAs) are key regulators of gene expression. In the brain, vital processes like neurodevelopment and neuronal functions depend on the correct expression of microRNAs. Perturbation of microRNAs in the brain can be used to model neurodegenerative diseases by modulating neuronal cell death. Currently, stereotactic injection is used to deliver miRNA knockdown agents to specific location in the brain. Here, we discuss strategies to design antagomirs against miRNA with locked nucleotide modifications (LNA). Subsequently describe a method for brain specific delivery of antagomirs, uniformly across different regions of the brain. This method is simple and widely applicable since it overcomes the surgery, associated injury and limitation of local delivery in stereotactic injections. We prepared a complex of neurotropic, cell-penetrating peptide Rabies Virus Glycoprotein (RVG) with antagomir against miRNA-29 and injected through tail vein, to specifically deliver in the brain. The antagomir design incorporated features that allow specific targeting of the miRNA and formation of non-covalent complexes with the peptide. The knock-down of the miRNA in neuronal cells, resulted in apoptotic cell death and associated behavioural defects. Thus, the method can be used for acute models of neuro-degeneration through the perturbation of miRNAs.

MicroRNAs play crucial roles in the brain and are potential targets for modeling neuro-degeneration. However, perturbing miRNA levels is challenging due to the short length of miRNA and inaccessibility of the brain tissue. This video presents a method for antagomir design and brain specific delivery using a neuropeptide in mice.

MicroRNAs (miRNAs) are key regulators of gene expression.  In the brain, vital processes like neurodevelopment and neuronal functions depend on the ...

Assaying Circuit Specific Regulation of Adult Hippocampal Neural Precursor Cells

Adult neurogenesis is a dynamic process by which newly activated neural stem cells (NSCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate new neurons, which integrate into an existing neural circuit and contribute to specific hippocampal functions. Importantly, adult neurogenesis is highly susceptible to environmental stimuli, which allows for activity-dependent regulation of various cognitive functions. A vast range of neural circuits from various brain regions orchestrates these complex cognitive functions. It is therefore important to understand how specific neural circuits regulate adult neurogenesis. Here, we describe a protocol to manipulate neural circuit activity using designer receptor exclusively activated by designer drugs (DREADDs) technology that regulates NSCs and newborn progeny in rodents. This comprehensive protocol includes stereotaxic injection of viral particles, chemogenetic stimulation of specific neural circuits, thymidine analog administration, tissue processing, immunofluorescence labeling, confocal imaging, and imaging analysis of various stages of neural precursor cells. This protocol provides detailed instructions on antigen retrieval techniques used to visualize NSCs and their progeny and describes a simple, yet effective way to modulate brain circuits using clozapine N-oxide (CNO) or CNO-containing drinking water and DREADDs-expressing viruses. The strength of this protocol lies in its adaptability to study a diverse range of neural circuits that influence adult neurogenesis derived from NSCs.

The goal of this protocol is to describe an approach for analyzing behavior of adult neural stem/progenitor cells in response to chemogenetic manipulation of a specific local neural circuit.

Adult neurogenesis is a dynamic process by which newly activated neural stem cells (NSCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate ...

Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

The accumulation of unfolded proteins within the endoplasmic reticulum (ER), caused by any stress condition, triggers the unfolded protein response (UPR) through the activation of specialized sensors. UPR attempts first to restore homeostasis; but if damage persists the signaling induces apoptosis.
There is increasing evidence that sustained and unresolved ER stress contributes to many pathological conditions including neurodegenerative diseases. Because the UPR controls cell fate by switching between cytoprotective and apoptotic processes, it is essential to understand the events defining this transition, as well as the elements involved in its modulation.
Recently, we demonstrated that abnormal GM2 ganglioside accumulation causes depletion of ER Ca2+ content, which in turn activates PERK (PKR-like-ER kinase), one of the UPR sensors. Furthermore, PERK signaling participates in the neurite atrophy and apoptosis induced by GM2 accumulation. In this respect, we have established an experimental system that allows us to molecularly modulate the expression of downstream PERK components and thus change vulnerability of neurons to undergo neuritic atrophy.
We performed knockdown of calcineurin (cytoprotective) and CHOP (pro-apoptotic) expression in rat cortical neuronal cultures. Cells were infected with lentivirus-delivered specific shRNA and then treated with GM2 at different times, fixed and immunostained with anti-MAP2 (microtube-associated protein 2) antibody. Later, cell images were recorded using a fluorescence microscope and total neurite outgrowth was evaluated by using the public domain image processing software ImageJ. The inhibition of expression of those PERK signaling components clearly made it possible to either accelerate or delay the neuritic atrophy induced by ER stress.
This approach might be used in cell system models of ER stress to evaluate the vulnerability of neurons to neurite atrophy.

In the present study, the expression is knocked down of two downstream signaling components of the PERK pathway, the cytoprotective calcineurin and the pro-apoptotic CHOP, by using specific shRNAs. In opposite ways, these modulate the susceptibility of primary cortical neurons to neurite atrophy after induction of endoplasmic reticulum stress.

The accumulation of unfolded proteins within the endoplasmic reticulum (ER), caused by any stress condition, triggers the unfolded protein response (UPR) ...

Loss-of-Function Approach in the Embryonic Chick Retina by Using Tol2 Transposon-Mediated Transgenic Expression of Artificial microRNAs

The chick retina has long been an important model system in developmental neurobiology, with advantages including its large size, rapid development, and accessibility for visualization and experimental manipulations. However, its major technical limitation had been the lack of robust loss-of-function approaches for gene function analyses. This protocol describes a methodology of gene silencing in the developing chick retina that involves transgenic expression of artificial microRNAs (miRNAs) by using the Tol2 transposon system. In this approach, a Tol2 transposon plasmid that contains an expression cassette for the EmGFP (emerald green fluorescent protein) marker and artificial pre-miRNA sequences against a target gene is introduced into the embryonic chick retina with a Tol2 transposase expression construct by in ovo electroporation. In the transfected retinal cells, the transposase catalyzes the excision of the expression cassette from the transposon vector and its integration into host chromosomes, leading to the stable expression of miRNAs and the EmGFP protein. In our previous study, we have demonstrated that the expression of Nel, a glycoprotein that exerts multiple functions in neural development, can be significantly suppressed in the developing chick retina by using this technique. Our results indicate that this methodology induces a stable and robust suppression of gene expression and thus provides an efficient loss-of-function approach for studies of retinal development.

We have developed a novel loss-of-function approach that involves the introduction and genomic integration of artificial micro-RNA sequences into chick embryos by using in ovo electroporation and the Tol2 transposon system. This technique provides a robust and stable gene knockdown methodology for studies of gene function during development.

The chick retina has long been an important model system in developmental neurobiology, with advantages including its large size, rapid development, and ...

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex

Studying the physiological properties of specific synapses in the brain, and how they undergo plastic changes, is a key challenge in modern neuroscience. Traditional in vitro electrophysiological techniques use electrical stimulation to evoke synaptic transmission. A major drawback of this method is its nonspecific nature; all axons in the region of the stimulating electrode will be activated, making it difficult to attribute an effect to a particular afferent connection. This issue can be overcome by replacing electrical stimulation with optogenetic-based stimulation. We describe a method for combining optogenetics with in vitro patch-clamp recordings. This is a powerful tool for the study of both basal synaptic transmission and synaptic plasticity of precise anatomically defined synaptic connections and is applicable to almost any pathway in the brain. Here, we describe the preparation and handling of a viral vector encoding channelrhodopsin protein for surgical injection into a pre-synaptic region of interest (medial prefrontal cortex) in the rodent brain and making of acute slices of downstream target regions (lateral entorhinal cortex). A detailed procedure for combining patch-clamp recordings with synaptic activation by light stimulation to study short- and long-term synaptic plasticity is also presented. We discuss examples of experiments that achieve pathway- and cell-specificity by combining optogenetics and Cre-dependent cell labeling. Finally, histological confirmation of the pre-synaptic region of interest is described along with biocytin labeling of the post-synaptic cell, to allow further identification of the precise location and cell type.

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex

Here we present a protocol describing viral transduction of discrete brain regions with optogenetic constructs to permit synapse-specific electrophysiological characterization in acute rodent brain slices.

Studying the physiological properties of specific synapses in the brain, and how they undergo plastic changes, is a key challenge in modern neuroscience. ...

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Summary

Explore More Videos

Stereotactic Injection of MicroRNA-expressing Lentiviruses to the Mouse Hippocampus CA1 Region and Assessment of the Behavioral Outcome

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Laser-scanning Photostimulation of Optogenetically Targeted Forebrain Circuits

Optogenetic Manipulation of Neuronal Activity to Modulate Behavior in Freely Moving Mice

A Simple Alternative to Stereotactic Injection for Brain Specific Knockdown of miRNA

Assaying Circuit Specific Regulation of Adult Hippocampal Neural Precursor Cells

Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

Loss-of-Function Approach in the Embryonic Chick Retina by Using Tol2 Transposon-Mediated Transgenic Expression of Artificial microRNAs

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex