This work was supported by the NIH grants R01-DK100584 and China State Key Laboratory of Oral Diseases Open Funding SKLOD2015OF01 (RB). We thank Wenping Zhao, Tadatoshi Sato, and Kelly Lauter for help.

This study has been approved by the Institutional Animal Care and Use Committee (IACUC) of the Massachusetts General Hospital. Obtain appropriate institutional approval for this animal study before beginning. Some techniques might have to be adjusted according to local IACUC requirements.
1. GFP-PTX Mice
<ol>
	<li>Obtain PTHcre+ mice and Rosa-mTmG mice at 8 - 10 weeks old for further mating.</li>
	<li>Backcross the PTHcre+ mice (mixed 129;FVB background) with C57BL/6 mice for 6 generations to obtain mice with C57BL/6 background.</li>
	<li>Inbreed PTHcre+ mice to obtain PTHcre+/+ mice17. 
	NOTE: To perform genotyping, extract the DNA from the tip of the tail and use it for PCR. The PCR primers to check for heterozygosity and homozygosity of the PTHcre transgene are as follows: forward primer A, CCTGTCAAGGATGTGGAAGA, reverse primer A&#39;, TCAGATCACACCACACAGCA, forward primer B, CAGTTGTCTTTAGTTTACTCAGCATCAG, reverse primer B&#39;, GATAATCGCGAACATCTTCAGGTT17.</li>
	<li>Cross PTHcre+/+ mice16 with Rosa-mTmG mice18. Wean PTHcre;mTmG pups when 4 weeks old.</li>
	<li>Anesthetize 8 - 10 weeks old PTHcre;mTmG mice by i.p. injection of tribromoethanol (Avertin) at 0.6 mg/g body weight, or other agents such as ketamine/xylazine.&#160;Use buprenorphine 0.1 mg/kg s.c. every 12 h as an analgesic for 48 h after surgery according to an approved protocol.&#160;&#160;Ensure appropriate depth of anesthesia by the toe pinch withdrawal reflex or other means. Place the animal in the supine position.</li>
	<li>Extend and prepare the ventral neck region by shaving the skin using single edge blades. Disinfect the shaved skin with a povidone iodine antiseptic pad.</li>
	<li>Cover the animal with sterile surgical drapes to reduce contamination of the surgical site and use autoclaved microsurgical instruments for the surgical procedure.</li>
	<li>Cut a 2 cm longitudinal incision in the skin with a surgical scalpel. Dissect fascia and push the salivary glands to the side by blunt dissection with curved serrated forceps.</li>
	<li>Under the dissection microscope using halogen light and a 4 - 5X magnification, cut and separate the paratracheal muscles using sharp forceps tips and expose the trachea.</li>
	<li>Identify the thyroid gland with the right and left lobe located next to the trachea.</li>
	<li>Switch the light source to fluorescent light and visualize the two green-fluorescing parathyroid glands. 
	NOTE: Typically, the two parathyroid glands are located at or near the surface of the thyroid glands, but occasionally, they are located further away.</li>
	<li>Carefully remove the green parathyroid glands using surgical forceps and scissor. Use sterile gauze for hemostasis and carefully check along the trachea to ensure that all green tissue has been removed.</li>
	<li>Close the paratracheal muscles by interrupted suture using 6-0 polyglactin 910 sutures. Close the skin incision by Halsted suture using 6-0 polyglactin 910 sutures.</li>
	<li>Optional: Inject 10 &#181;L/g body weight sterile normal 0.9% sodium chloride solution to the mice for fluid replacement.</li>
	<li>Place postsurgical animals to a separate cage on a warm incubator (37 &#176;C) for body temperature recovery. Once the mice are awake and in the recumbent position, put pellet chow and water with some gelatin food on the cage floor.</li>
	<li>After a postsurgical observation period of 2 h, return mouse to the animal facility and follow local requirements for postsurgical care.</li>
	<li>3 days after parathyroidectomy, obtain 10 &#181;L tail blood and measure blood ionized Ca++ using an analyzer such as the blood gas system Ca++/pH analyzer. Successful parathyroidectomy results in blood ionized Ca++ equal or lower than -2SD of sham-operated control mice (1.20 mmol/L in our experiments of n = 30).</li>
</ol>
2. PTH-cre-iDTR Mice
<ol>
	<li>Obtain PTHcre+ and DTRfl/fl mice at 8 - 10 weeks old for mating.</li>
	<li>Backcross the PTHcre mice (mixed 129;FVB background) with C57BL/6 mice for 6 generations to obtain mice with C57BL/6 background.</li>
	<li>Inbreed the PTHcre+ (C57BL/6 background) mice to obtain PTHcre+/+ mice17. 
	NOTE: To perform genotyping, DNA from mice tail tips was extracted and used for PCR. Genotyping Primers: forward primer A, CCTGTCAAGGATGTGGAAGA, reverse primer A&#39;, TCAGATCACACCACACAGCA, forward primer B, CAGTTGTCTTTAGTTTACTCAGCATCAG, reverse primer B&#39;, GATAATCGCGAACATCTTCAGGTT17.</li>
	<li>Mate PTHcre+/+ mice16 with DTRfl/fl mice19 to obtain PTHcre-iDTR mice.</li>
	<li>Prepare DT solution by diluting diphtheria toxin powder with sterile saline to a concentration of 0.5 &#181;g/mL. Sterile filter, and store aliquots at -80 &#176;C.</li>
	<li>Choose 8 - 10 weeks old PTHcre-iDTR mice for injection experiment. Thaw DT aliquot to room temperature, administer DT intraperitoneally at 5 &#181;g/kg (10 &#181;L/g) bodyweight of the animal. For maximal efficiency and least toxicity, DT administration is repeated for a total of 2 injections in a 3-day interval17.</li>
	<li>3 days after the second injection, take 10 &#181;L tail blood from each PTHcre-iDTR/PTHcre-iDTR-mTmG mouse and measure blood Ca++ using a Blood Gas System Ca++/pH analyzer. 
	NOTE: We define mice with blood ionized Ca++ lower than 1.18 mmol/L as hypoparathyroid mice, which equals 2SD below the mean of vehicle-injected control mice (n = 22).</li>
</ol>

<ol>
	<li>Brandi, M. L., Brown, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Hypoparathyroidism. , (2015).</li><li>van Abel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+control+of+renal+Ca(2+)+transport+proteins+by+parathyroid+hormone.">Coordinated control of renal Ca(2+) transport proteins by parathyroid hormone.</a> Kidney Int. 68, 1708-1721 (2005).</li><li>Sebastian, E. M., Suva, L. J., Friedman, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+effects+of+intermittent+PTH(1-34)+and+PTH(7-34)+on+bone+microarchitecture+and+aortic+calcification+in+experimental+renal+failure.">Differential effects of intermittent PTH(1-34) and PTH(7-34) on bone microarchitecture and aortic calcification in experimental renal failure.</a> Bone. 43, 1022-1030 (2008).</li><li>Rodriguez-Ortiz, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+deficiency+reduces+circulating+levels+of+FGF23.">Calcium deficiency reduces circulating levels of FGF23.</a> J Am Soc Nephrol. 23, 1190-1197 (2012).</li><li>Liao, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relationship+between+Fibroblast+Growth+Factor+23+and+Biochemical+and+Bone+Histomorphometric+Alterations+in+a+Chronic+Kidney+Disease+Rat+Model+Undergoing+Parathyroidectomy.">Relationship between Fibroblast Growth Factor 23 and Biochemical and Bone Histomorphometric Alterations in a Chronic Kidney Disease Rat Model Undergoing Parathyroidectomy.</a> PloS one. 10, e0133278 (2015).</li><li>Fox, J., Care, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+low+calcium+and+low+phosphorus+diets+on+the+intestinal+absorption+of+water+in+intact+and+parathyroidectomized+pigs.">Effect of low calcium and low phosphorus diets on the intestinal absorption of water in intact and parathyroidectomized pigs.</a> Calcif Tissue Int. 31, 253-255 (1980).</li><li>Finco, D. R., Brown, S. A., Ferguson, D. C., Crowell, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+parathyroidectomy+of+the+dog.">Selective parathyroidectomy of the dog.</a> Can J Vet Res. 57, 288-292 (1993).</li><li>Can, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+allotransplantation+in+rabbits+without+cultivation.">Parathyroid allotransplantation in rabbits without cultivation.</a> Int J Clin Exp Med. 7, 280-284 (2014).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> j Natl Cancer Inst. 10, 725-733 (1949).</li><li>Sakai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osteoclast+development+in+immobilized+bone+is+suppressed+by+parathyroidectomy+in+mice.">Osteoclast development in immobilized bone is suppressed by parathyroidectomy in mice.</a> J Bone Miner Metab. 23, 8-14 (2005).</li><li>Miao, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Skeletal+abnormalities+in+Pth-null+mice+are+influenced+by+dietary+calcium.">Skeletal abnormalities in Pth-null mice are influenced by dietary calcium.</a> Endocrinology. 145, 2046-2053 (2004).</li><li>Gunther, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+ablation+of+parathyroid+glands+reveals+another+source+of+parathyroid+hormone.">Genetic ablation of parathyroid glands reveals another source of parathyroid hormone.</a> Nature. 406, 199-203 (2000).</li><li>Hough, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+calcium-sensing+receptor+mutation+in+the+mouse+is+associated+with+cataracts+and+ectopic+calcification.">Activating calcium-sensing receptor mutation in the mouse is associated with cataracts and ectopic calcification.</a> Proc Natl Acad Sci U S A. 101, 13566-13571 (2004).</li><li>Hannan, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Calcilytic+Agent+NPS+2143+Rectifies+Hypocalcemia+in+a+Mouse+Model+With+an+Activating+Calcium-Sensing+Receptor+(CaSR)+Mutation:+Relevance+to+Autosomal+Dominant+Hypocalcemia+Type+1+(ADH1).">The Calcilytic Agent NPS 2143 Rectifies Hypocalcemia in a Mouse Model With an Activating Calcium-Sensing Receptor (CaSR) Mutation: Relevance to Autosomal Dominant Hypocalcemia Type 1 (ADH1).</a> Endocrinology. 156, 3114-3121 (2015).</li><li>Libutti, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+gland-specific+deletion+of+the+mouse+Men1+gene+results+in+parathyroid+neoplasia+and+hypercalcemic+hyperparathyroidism.">Parathyroid gland-specific deletion of the mouse Men1 gene results in parathyroid neoplasia and hypercalcemic hyperparathyroidism.</a> Cancer Res. 63, 8022-8028 (2003).</li><li>Bi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diphtheria+Toxin-+and+GFP-Based+Mouse+Models+of+Acquired+Hypoparathyroidism+and+Treatment+with+a+Long-Acting+Parathyroid+Hormone+Analog.">Diphtheria Toxin- and GFP-Based Mouse Models of Acquired Hypoparathyroidism and Treatment with a Long-Acting Parathyroid Hormone Analog.</a> J Bone Miner Res. , (2015).</li><li>Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+global+double-fluorescent+Cre+reporter+mouse.">A global double-fluorescent Cre reporter mouse.</a> Genesis. 45, 593-605 (2007).</li><li>Buch, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Cre-inducible+diphtheria+toxin+receptor+mediates+cell+lineage+ablation+after+toxin+administration.">A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration.</a> Nat Methods. 2, 419-426 (2005).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> J Natl Cancer Inst. 10, 725-733 (1949).</li></ol>

The authors declare that they have no competing financial interests.

We demonstrate the technique of GFP-guided parathyroidectomy using transgenic mice with GFP expression selectively in the parathyroid glands. In the PTHcre;mTmG mice, the double fluorescence (the green GFP in Cre-expressed cells and red Tomato in non-Cre expressed cells) enabled us to clearly identify, and to precisely remove all parathyroid glands without removing the thyroids. While we prefer the use of the double-fluorescence mTmG mice for the ability to identify fluorescent red non-parathyroid tissue, our procedure should also work well using single fluorescent animals such as the tomato red (B6.Cg-Ct(ROSA)26Sortm14(CAG-tdTomato)Hze/J) mouse. The procedure is relatively easy to perform, requires about 20 min per mouse, and results in a severe and sustained hypoparathyroid phenotype.
In addition, another advantage of the GFP-positive parathyroid glands is the ease of detection of aberrant parathyroid glands. Our studies demonstrate mislocalization of the parathyroids in about a quarter of B6 mice (Figure 1), which are readily detected in our mouse model by the green fluorescence. Contrary to thyro-parathyroidectomy, our technique avoids the removal of the thyroid with subsequent need for thyroid hormone replacement and the unknown effect of removal of calcitonin-producing thyroid C-cells. Fluorescently labeled parathyroid glands could be also used for other investigations that require the isolation of the parathyroid glands. The limitation of this model includes the requirement for surgery. Basic microsurgery skills and a dissection microscope with a fluorescent light source are required.
A second technique for generating hypoparathyroid mice that eliminates the need for surgery is demonstrated. Diphtheria toxin-treated PTHcre-iDTR mice exhibit a milder hypoparathyroidism phenotype, but simply require injecting DT intraperitoneally into the mouse. The critical part for generating this model was the optimization of the dose and dosing regimen. High doses of DT led to toxicity but low doses decreased the efficacy of the approach. We determined that the dose regiment of 2 injections at 5 &#181;g/kg, administered 3 days apart, resulted in reliable and stable hypocalcemia with no/minimal mortality.
Ultimately, we hope that these two approaches provide useful mouse models for acquired hypoparathyroidism. Using a novel long-acting PTH, we reported the first use of both of these models in determining the efficacy of new drugs for hypoparathyroidism17.

Since the first systematic description of the parathyroid glands in human and in several other species by Sandstr&#246;m in 1880 1, understanding the significance of this small endocrine organ for human physiology and disease has continuously improved. Parathyroid glands secrete parathyroid hormone (PTH), the principal regulator of calcium metabolism. PTH is also an important hormone for phosphate homeostasis and bone turnover 1,2. Accidental removal or damage of the parathyroids during neck surgery is the most common cause of hypoparathyroidism, a disease characterized by low blood calcium, low PTH, and elevated phosphorus 1.
To better study acquired hypoparathyroidism and test novel therapies, reliable and easily accessible mouse models are required. Mice are widely used in research because a wide variety of genetic tools are available in this species permitting sophisticated mechanistic studies in vivo. However, while surgical parathyroidectomy (PTX) can be used in rats 2,3,4,5, and larger mammals 6,7,8, it is technically very challenging in mice because of the small size of the glands and their variable anatomic distribution 9. Therefore, thyro-parathyroidectomy (TPTX) is typically performed in mice, in which the thyroid and parathyroid glands are removed together 10. However, low thyroid hormone levels are a potential confounder in experiments, complicating this model. In addition, C-cells within the thyroid gland, which produce calcitonin, a hormone important in calcium homeostasis in rodents, are also lost upon removal of the thyroids 11.
Several genetic mouse models of hypoparathyroidism exist, which include the PTH-null mouse 12, the GCM2-null mouse 13, and the Nuf mouse with an activating mutation in the calcium-sensing receptor (CaSR) 14,15. However, these genetic defects are already present during embryonic development, and the function of the parathyroids is therefore already impaired during embryogenesis. This can affect the development of organs such as the skeleton. This contrasts with patients with postsurgical hypoparathyroidism who acquire the disease later in life. Moreover, some of these mouse models exhibit early lethality and reduced fertility, which further complicates their use 12,13,14.
We developed two new mouse models for acquired hypoparathyroidism. Using genetically engineered mice that express GFP specifically in the parathyroids allows the parathyroid glands to be easily identified for surgical removal without removing the thyroid gland. This mouse was generated by crossing the PTH-Cre mouse, which expresses Cre recombinase under the control of the 5.5 kb PTH promoter 16 with the ROSAmTmG mouse. The resulting PTHcre;mTmG mice express green fluorescent protein specifically in parathyroid cells. The second mouse model uses the same PTH-Cre, this time to remove a STOP cassette from the inducible DTR mouse, resulting in expression of the diphtheria toxin receptor specifically in the parathyroids. Systemic administration of DT destroys parathyroid cells, rendering the animals hypoparathyroid without surgery.
The two mouse models presented in this study demonstrate a stable hypocalcemic phenotype over the three-month observation period. The procedures are easy to perform, the phenotype is reproducible, and the hypoparathyroid mice exhibit a high survival rate 17.

<table><tbody><tr><td>ROSA&lt;sup&gt;mT/mG&lt;/sup&gt; mice</td><td>The Jackson Laboratory</td><td>7676</td><td></td></tr><tr><td>PTH-Cre mice</td><td>The Jackson Laboratory</td><td>5989</td><td></td></tr><tr><td>iDTRmice</td><td>The Jackson Laboratory</td><td>7900</td><td></td></tr><tr><td>6-0 polyglactin 910 suture with needle</td><td>Ethicon, Inc</td><td>J510G</td><td></td></tr><tr><td>Safety Single Edge Razor Blades</td><td>American Safety Razor Company</td><td>66-0089</td><td></td></tr><tr><td>Disposable Scalpel</td><td>Feather Safety Razor Co., LTD</td><td>72042-11</td><td></td></tr><tr><td>Povidone-Iodine Prep Pads</td><td>Dynarex Corporation</td><td>1108</td><td></td></tr><tr><td>Ply gauze</td><td>Busse. Inc</td><td>BHD707</td><td></td></tr><tr><td>0.9% Sodium Chloride Solution</td><td>HOSPIRA Worldwide, Inc</td><td>07983-09</td><td></td></tr><tr><td>1 mL 29 G Insulin Syringe</td><td>BECTON DICKINSON</td><td>329622</td><td></td></tr><tr><td>Surgical Incise Drapes</td><td>3M</td><td>6640EZ</td><td></td></tr><tr><td>Dumstar Biology forceps</td><td>Roboz Surgical Instrument Co., Inc</td><td>RS-4984</td><td></td></tr><tr><td>Micro Dissecting Spring Scissors</td><td>Roboz Surgical Instrument Co., Inc</td><td>RS-5605</td><td></td></tr><tr><td>Needle Holder</td><td>MILTEX.,Inc</td><td>V98-42</td><td></td></tr><tr><td>2,2,2-Tribromethanol</td><td>Sigma-Aldrich</td><td>T48402</td><td></td></tr><tr><td>2-Methyl-2-Butanol</td><td>Sigma-Aldrich</td><td>152463</td><td>For dissolve the 2,2,2-Tribromethanol</td></tr><tr><td>Diphtheria Toxin Powder</td><td>Sigma-Aldrich</td><td>D0564</td><td>Dissolve in 0.9% sodium chloride solution at 1 mg/mL as the stock solution in -80 &amp;#176;C</td></tr><tr><td>Multicap Blood Collection Capillary tubes</td><td>Siemens Healthcare Diagnostics Ltd</td><td>855578</td><td>For collecting blood in iCa&lt;sup&gt;2+&lt;/sup&gt; analysis using RapidLab 348 Ca&lt;sup&gt;2+&lt;/sup&gt;/pH analyzer</td></tr><tr><td>RapidLab 348 Ca&lt;sup&gt;2+&lt;/sup&gt;/pH analyzer</td><td>Siemens Healthcare</td><td></td><td>For iCa&lt;sup&gt;2+&lt;/sup&gt; analysis</td></tr></tbody></table>

two techniques to create hypoparathyroid mice: parathyroidectomy using gfp glands and diphtheria-toxin-mediated parathyroid ablation

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most common cause of the disease is accidental removal of the parathyroid glands during thyroid surgery. Novel therapies for HP are needed, but testing them requires reliable animal models of acquired HP. 
Here, we demonstrate the generation of two mouse models of acquired HP. In the GFP-PTX model, mice with green fluorescent protein (GFP) expressed specifically in the parathyroids (PTHcre-mTmG) were created by crossing PTHcre+ mice with Rosa-mTmGfl/fl mice. Green fluorescing parathyroid glands are easily identified under a fluorescence dissecting microscope and parathyroidectomy is performed in less than 20 min. After fluorescence-guided surgery, mice are profoundly hypocalcemic. Contrary to the traditional thyro-parathyroidectomy, this precise surgical approach leaves thyroid glands and thyroid function intact. The second model, which does not require surgery, is based on a diphtheria-toxin approach. PTHcre-iDTR mice, which express the diphtheria toxin (DT) receptor specifically in the parathyroids, were generated by crossing the inducible DTR mouse with the PTHcre mouse. Parathyroid cells are thus rendered sensitive to diphtheria toxin (DT) and can be selectively destroyed by systemically injecting mice with DT. The resulting hypocalcemic phenotype is stable.

Location of the Parathyroid Glands
First, we recorded the distribution of the parathyroid glands of 54 PTHcre-mTmG mice as observed under the fluorescent dissection microscope. 74% (40/54) mice had two green parathyroid glands (Figure 1A, C, E), 26% (14/54) mice had an additional third parathyroid gland (Figure 1B, D, F). No mouse with a single gland or more than three glands were observed. Usually, parathyroid glands were located near the superior border of the thyroid gland (58%, 71/122; Figure 1A(1,2), B(1,2), C(2), D(1,2), E(2), F(3)). 27% (33/122) glands were located near the inferior border of the thyroid gland (Figure 1C(1), D(3), F(1)), and 13% (16/122) were located away from the thyroid gland (Figure 1B(3), E(1), F(2)). Our findings are consistent with and extend previous findings of varying locations of the parathyroid glands20.
GFP-PTX Mice
The entire surgery from anesthesia to closing the skin incision took approximately 20 min per mouse. The survival rate of postsurgical mice over a 3-month observation period was 96.3% (53/55). 92.4% (49/53) GFP-PTX mice exhibited ionized calcium levels that were 2 SD below the mean of sham-operated control mice or lower. The hypoparathyroid phenotype in the GFP-PTX mice (hypocalcemia, low PTH and elevated serum phosphate) was stable for the entire observation time of 3 months. Importantly, thyroid function was not different from sham-operated animals 3 months after surgery (TSH = 42 &#177; 24 vs. 30 &#177; 15 mU/L, p = 0.171; T4 = 3.0 &#177; 0.6 vs. 3.1 &#177; 0.9 &#181;g/dL, p = 0.707 (Figure 2).
PTH-cre-iDTR Mice
DT injected PTH-Cre-iDTR mice developed hypoparathyroidism (low blood ionized calcium, elevated blood phosphorus, and inappropriately low-normal PTH levels). We have previously reported that a few PTH positive cells escape the ablation by diphtheria toxin, explaining the measurable circulating PTH and the therefore the somewhat milder phenotype of these mice17.
Hypoparathyroidism in GFP-PTX Mice and PTH-cre-iDTR Mice
Significant reductions of blood Ca++ and serum PTH levels were observed in GFP-PTX mice 3 days after surgery, compared to levels found in sham-operated mice (Ca++ = 1.05 &#177; 0.40 vs. 1.30 &#177; 0.03 mmol/L, p &#60; 0.05; PTH=32 &#177; 22 vs. 580 &#177; 137 pg/mL, p &#60; 0.05). The hypoparathyroidism phenotype was stable over the 3-month observation period (Figure 3A, reprinted with permission from (reference#17)). After 2 injections of 5 &#181;g/kg DT at 3 days interval, a dose and regimen optimized to use the least amount of DT to give the maximal hypoparathyroid phenotype, the DT injected PTH-cre-iDTR mice showed significant hypocalcemia and reduced PTH compared to vehicle control mice, which persisted over the 90 days observation period (Ca++ = 1.10 &#177; 0.07 mmol/L vs. 1.26 &#177; 0.05 mmol/L, p &#60; 0.05; PTH = 218 &#177; 156 pg/mL vs. 572 &#177; 164 pg/mL, p &#60; 0.05) (Figure 3B, reprinted with permission from (reference#17)).
<img alt="Figure 1" src="/files/ftp_upload/55010/55010fig1.jpg" /> 
Figure 1: Representative Images of the Various Locations of the Parathyroid Glands in 54 PTHcre-mTmG Mice under Fluorescent Dissection Microscope. Mice had either two (A, C, E) or three (B, D, F) green parathyroid glands. Most parathyroid glands were located near the superior border (A(1,2), B(1,2), C(2), D(1,2), E(2), F(3) or near the inferior border of the thyroid gland (C(1), D(3), F(1)). In rare cases, some were located ectopically (B(3), E(1), F(2)). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55010/55010fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55010/55010fig2.jpg" /> 
Figure 2: TSH and T4 Level of GFP-PTX Mice. 3 months after GFP-PTX, serum was obtained for TSH and T4 measurements. GFP-PTX mice showed TSH concentrations (42 &#177; 24 mU/L) (A) and T4 concentrations (3.0 &#177; 0.6 &#956;g/dL) (B) that were not different from control mice (TSH = 30 &#177; 15 mU/L, p = 0.171, n =11, T4 = 3.1 &#177; 0.9, p = 0.707, n = 11). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55010/55010fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55010/55010fig3.jpg" /> 
Figure 3: Blood Ca++ and PTH Levels in GFP-PTX Mice and DT Injected PTH-cre-iDTR Mice. Both GFP-PTX mice (A) and DT injected PTH-cre-iDTR mice (B) exhibited stable hypocalcemia and reduced PTH levels over 3 month observation period (N = 6 - 8, ***p &#60; 0.001) (re-printed with permission from reference#17). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55010/55010fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation at JoVE.com

Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most ...

two-techniques-to-create-hypoparathyroid-mice-parathyroidectomy-using

Nanyang Technological University

Research

JoVE Journal

Medicine

14.4K Views.  Harvard Medical School. Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Video: Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Fluorescent Orthotopic Mouse Model of Pancreatic Cancer

Pancreatic cancer remains one of the cancers for which survival has not improved substantially in the last few decades. Only 7% of diagnosed patients will survive longer than five years. In order to understand and mimic the microenvironment of pancreatic tumors, we utilized a murine orthotopic model of pancreatic cancer that allows non-invasive imaging of tumor progression in real time. Pancreatic cancer cells expressing green fluorescent protein (PANC-1 GFP) were suspended in basement membrane matrix, high concentration, (e.g., Matrigel HC) with serum-free media and then injected into the tail of the pancreas via laparotomy. The cell suspension in the high concentration basement membrane matrix becomes a gel-like substance once it reaches room temperature; therefore, it gels when it comes in contact with the pancreas, creating a seal at the injection site and preventing any cell leakage. Tumor growth and metastasis to other organs are monitored in live animals by using fluorescence. It is critical to use the appropriate filters for excitation and emission of GFP. The steps for the orthotopic implantation are detailed in this article so researchers can easily replicate the procedure in nude mice. The main steps of this protocol are preparation of the cell suspension, surgical implantation, and whole body fluorescent in vivo imaging. This orthotopic model is designed to investigate the efficacy of novel therapeutics on primary and metastatic tumors.

A procedure to implant green fluorescent protein-expressing pancreatic cancer cells (PANC-1 GFP) orthotopically into the pancreas of Balb-c Ola Hsd-Fox1nu mice to assess tumor progression and metastasis is presented here.

Pancreatic cancer remains one of the cancers for which survival has not improved substantially in the last few decades. Only 7% of diagnosed patients will ...

Cancer Research

Two-step Approach to Explore Early- and Late-stages of Organ Formation in the Avian Model: The Thymus and Parathyroid Glands Organogenesis Paradigm

The avian embryo, as an experimental model, has been of utmost importance for seminal discoveries in developmental biology. Among several approaches, the formation of quail-chicken chimeras and the use of the chorioallantoic membrane (CAM) to sustain the development of ectopic tissues date back to the last century. Nowadays, the combination of these classical techniques with recent in vitro methodologies offers novel prospects to further explore organ formation.
Here we describe a two-step approach to study early- and late-stages of organogenesis. Briefly, the embryonic region containing the presumptive territory of the organ is isolated from quail embryos and grown in vitro in an organotypic system (up to 48 h). Cultured tissues are subsequently grafted onto the CAM of a chicken embryo. After 10 days of in ovo development, fully formed organs are obtained from grafted tissues. This method also allows the modulation of signaling pathways by the regular administration of pharmacological agents and tissue genetic manipulation throughout in vitro and in ovo developmental steps. Additionally, developing tissues can be collected at any time-window to analyze their gene-expression profile (using quantitative PCR (qPCR), microarrays, etc.) and morphology (assessed with conventional histology and immunochemistry).
The described experimental procedure can be used as a tool to follow organ formation outside the avian embryo, from the early stages of organogenesis to fully formed and functional organs.

This article provides an updated approach to the classical quail-chicken chimera system to study organ formation, by combining novel in vitro and in ovo experimental procedures.

The avian embryo, as an experimental model, has been of utmost importance for seminal discoveries in developmental biology. Among several approaches, the ...

Developmental Biology

A Co-Culture Method to Study Neurite Outgrowth in Response to Dental Pulp Paracrine Signals

Tooth innervation allows teeth to sense pressure, temperature and inflammation, all of which are crucial to the use and maintenance of the tooth organ. Without sensory innervation, daily oral activities would cause irreparable damage. Despite its importance, the roles of innervation in tooth development and maintenance have been largely overlooked. Several studies have demonstrated that DP cells secrete extracellular matrix proteins and paracrine signals to attract and guide TG axons into and throughout the tooth. However, few studies have provided detailed insight into the crosstalk between the DP mesenchyme and neuronal afferents. To address this gap in knowledge, researchers have begun to utilize co-cultures and a variety of techniques to investigate these interactions. Here, we demonstrate the multiple steps involved in co-culturing primary DP cells with TG neurons dispersed on an overlying transwell filter with large diameter pores to allow axonal growth through the pores. Primary DP cells with the gene of interest flanked by loxP sites were utilized to facilitate gene deletion using an Adenovirus-Cre-GFP recombinase system. Using TG neurons from the Thy1-YFP mouse allowed for precise afferent imaging, with expression well above background levels by confocal microscopy. The DP responses can be investigated via protein or RNA collection and analysis, or alternatively, through immunofluorescent staining of DP cells plated on removable glass coverslips. Media can be analyzed using techniques such as proteomic analyses, although this will require albumin depletion due to the presence of fetal bovine serum in the media. This protocol provides a simple method that can be manipulated to study the morphological, genetic, and cytoskeletal responses of TG neurons and DP cells in response to the controlled environment of a co-culture assay.

We describe the isolation, dispersion and plating of dental pulp (DP) primary cells with trigeminal (TG) neurons cultured atop overlying transwell filters. Cellular responses of DP cells can be analyzed with immunofluorescence or RNA/protein analysis. Immunofluorescence of neuronal markers with confocal microscopy permits the analysis of neurite outgrowth responses.

Tooth innervation allows teeth to sense pressure, temperature and inflammation, all of which are crucial to the use and maintenance of the tooth organ. ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Biology

Generation of a Mouse Spontaneous Autoimmune Thyroiditis Model

In recent years, Hashimoto's thyroiditis (HT) has become the most common autoimmune thyroid disease. It is characterized by lymphocyte infiltration and the detection of specific serum autoantibodies. Although the potential mechanism is still not clear, the risk of Hashimoto's thyroiditis is related to genetic and environmental factors. At present, there are several types of models of autoimmune thyroiditis, including experimental autoimmune thyroiditis (EAT) and spontaneous autoimmune thyroiditis (SAT).
EAT in mice is a common model for HT, which is immunized with lipopolysaccharide (LPS) combined with thyroglobulin (Tg) or supplemented with complete Freund's adjuvant (CFA). The EAT mouse model is widely established in many types of mice. However, the disease progression is more likely associated with the Tg antibody response, which may vary in different experiments.
SAT is also widely used in the study of HT in the NOD.H-2h4 mouse. The NOD.H2h4 mouse is a new strain obtained from the cross of the nonobese diabetic (NOD) mouse with the B10.A(4R), which is significantly induced for HT with or without feeding iodine. During the induction, the NOD.H-2h4 mouse has a high level of TgAb accompanied by lymphocyte infiltration in the thyroid follicular tissue. However, for this type of mouse model, there are few studies to comprehensively evaluate the pathological process during the induction of iodine.
A SAT mouse model for HT research is established in this study, and the pathologic changing process is evaluated after a long period of iodine induction. Through this model, researchers can better understand the pathological development of HT and screen new treatment methods for HT.

Several types of animal models of Hashimoto's thyroiditis have been established, as has spontaneous autoimmune thyroiditis in the NOD mouse. H-2h4 mice are a simple and reliable model for HT induction. This article describes this approach and evaluates the pathological process for a better understanding of the SAT murine model.

In recent years, Hashimoto's thyroiditis (HT) has become the most common autoimmune thyroid disease. It is characterized by lymphocyte infiltration and ...

Immunology and Infection

Establishment of a Simple and Effective Rat Model for Intraoperative Parathyroid Gland Imaging

Parathyroid gland (PG) identification is a critical unmet need in thyroidectomy. The identification of the PG is challenging in thyroid surgery as it is similar in color to the thyroid gland. The lack of effective animal models in preclinical research is a severe limitation for the development of PG identification techniques. This protocol allows for the establishment of a simple and effective rat model for PG identification. In this model, black iron oxide nanoparticles (IONPs) are injected locally in the thyroid gland and rapidly diffuse within the thyroid gland but not the PG. A negatively stained PG and a positively stained thyroid gland can be easily identified by the naked eye without requiring external microscopes. The position of the PG can be identified by increasing the color contrast between the thyroid gland and the PG, based on the color of the black IONPs. This rat model is low-cost and convenient for PG identification, and the IONPs are a novel PG contrast agent.

To date, the development of parathyroid gland (PG) identification methods is limited by the lack of animal models in preclinical research. Here, we establish a simple and effective rat model for intraoperative PG imaging and evaluate its effectiveness by using iron oxide nanoparticles as a novel PG contrast agent.

Parathyroid gland (PG) identification is a critical unmet need in thyroidectomy. The identification of the PG is challenging in thyroid surgery as it is ...

Generation of Hypoparathyroid Rats via Carbon-Nanoparticle-Assisted Parathyroidectomy

Hypoparathyroidism (HypoPT) is a rare disease involving the parathyroid glands that is characterized by a reduced secretion or potency of the parathyroid hormone (PTH), which leads to high serum phosphorus levels and low serum calcium levels. HypoPT most commonly results from accidental damage to the glands or their removal during thyroid or other anterior neck surgery. Parathyroid/thyroid surgery has become more common in recent years, with a corresponding rise in the occurrence of HypoPT as a postoperative complication. There is a critical need for a HypoPT animal model to better understand the mechanisms underlying the effects of HypoPT on mineral ion homeostasis and to verify the therapeutic effectiveness of novel treatments. Here, a technique is reported to create acquired HypoPT in male rats by performing parathyroidectomy (PTX) using carbon nanoparticles. The rat model shows great promise over the mouse models of hypoparathyroidism.&#160;Importantly, the human PTH receptor binding region has an 84.2% sequence similarity with that of the rat, which is higher than the 73.7% similarity shared with mice. Moreover, the effects of estrogen, which can affect the PTH/PTHrP receptor signaling pathway, have not been fully investigated in male rats. Carbon nanoparticles are lymphatic tracers that stain the thyroid lymph nodes black without affecting their function, but they do not stain the parathyroid glands, which makes them easy to identify and remove. In this study, serum PTH levels were undetectable after PTX, and this resulted in significant hypocalcemia and hyperphosphatemia. Thus, the clinical state of postoperative HypoPT can be remarkably represented in the rat model. Carbon-nanoparticle-assisted PTX can, therefore, serve as an extraordinarily effective and readily implementable model for studying the pathogenesis, treatment, and prognosis of HypoPT.

Generation of Hypoparathyroid Rats via Carbon-Nanoparticle-Assisted Parathyroidectomy

An animal model of acquired hypoparathyroidism (HypoPT) is crucial to understanding how HypoPT affects mineral ion homeostasis and to verify the effectiveness of novel treatments. Here, a technique is presented to generate an acquired hypoparathyroidism (AHypoPT) rat model by parathyroidectomy (PTX) using carbon nanoparticles.

Hypoparathyroidism (HypoPT) is a rare disease involving the parathyroid glands that is characterized by a reduced secretion or potency of the parathyroid ...

Isolating and Imaging Live, Intact Pacemaker Regions of Mouse Renal Pelvis by Vibratome Sectioning

The renal pelvis (RP) is a funnel-shaped, smooth muscle structure that facilitates normal urine transport from the kidney to the ureter by regular, propulsive contractions. Regular RP contractions rely on pacemaker activity, which originates from the most proximal region of the RP at the pelvis-kidney junction (PKJ). Due to the difficulty in accessing and preserving intact preparations of the PKJ, most investigations on RP pacemaking have focused on single-cell electrophysiology and Ca2+ imaging experiments. Although important revelations on RP pacemaking have emerged from such work, these experiments have several intrinsic limitations, including the inability to accurately determine cellular identity in mixed suspensions and the lack of in situ imaging of RP pacemaker activity. These factors have resulted in a limited understanding of the mechanisms that underlie normal rhythmic RP contractions. In this paper, a protocol is described to prepare intact segments of mouse PKJ using a vibratome sectioning technique. By combining this approach with mice expressing cell-specific reporters and genetically encoded Ca2+ indicators, investigators may be able to more accurately study the specific cell types and mechanisms responsible for peristaltic RP contractions that are vital for normal urine transport.

The goal of this protocol is to isolate intact pacemaker regions of the mouse renal pelvis using vibratome sectioning. These sections can then be used for in situ Ca2+ imaging to elucidate Ca2+ transient properties of pacemaker cells and other interstitial cells in vibratome slices.

The renal pelvis (RP) is a funnel-shaped, smooth muscle structure that facilitates normal urine transport from the kidney to the ureter by regular, ...

Orthotopic Inoculation of Thyroid Cancer Cells into Murine Thyroid: A Procedure to Establish Orthotopic Thyroid Cancer Mouse Model

Source: Julia Ramirez-Moya, et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/59322" target="_blank">In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice.</a> J. Vis. Exp. (2019)
This video describes the procedure for orthotopic inoculation of thyroid cancer cells into the thyroid gland of mouse models, which may then serve as a valuable platform to assess carcinogenesis and discover potential treatment strategies.

Source: Julia Ramirez-Moya, et al. In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice. J. Vis. Exp. (2019)
This video describes the procedure ...

JoVE Encyclopedia of Experiments

Head and Neck Cancer

In vivo studies

Orthotopic Homograft Tumor Transplantation: A Technique to Generate Pancreatic Tumor Mouse Models

Source: An, X. et al.&#160;<a href="https://www-jove-com.remotexs.ntu.edu.sg/v/57460/" target="_blank">Immunophenotyping of Orthotopic Homograft (Syngeneic) of Murine Primary KPC Pancreatic Ductal Adenocarcinoma by Flow Cytometry</a>. J. Vis. Exp. (2018)
The video explains a stepwise surgical method for orthotopic implantation of a tumor fragment from a cancerous donor to the pancreas of a non-cancerous recipient mice for development of pancreatic cancer. Orthotopically implanted PDAC could recapture the tissue microenvironment of human pancreatic cancers than conventional subcutaneous (SC) models more accurately.

Source: An, X. et al.&#160;Immunophenotyping of Orthotopic Homograft (Syngeneic) of Murine Primary KPC Pancreatic Ductal Adenocarcinoma by Flow Cytometry. ...

Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Summary

Explore More Videos

Chapters in this video

Fluorescent Orthotopic Mouse Model of Pancreatic Cancer

Two-step Approach to Explore Early- and Late-stages of Organ Formation in the Avian Model: The Thymus and Parathyroid Glands Organogenesis Paradigm

A Co-Culture Method to Study Neurite Outgrowth in Response to Dental Pulp Paracrine Signals

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Generation of a Mouse Spontaneous Autoimmune Thyroiditis Model

Establishment of a Simple and Effective Rat Model for Intraoperative Parathyroid Gland Imaging

Generation of Hypoparathyroid Rats via Carbon-Nanoparticle-Assisted Parathyroidectomy

Isolating and Imaging Live, Intact Pacemaker Regions of Mouse Renal Pelvis by Vibratome Sectioning

Orthotopic Inoculation of Thyroid Cancer Cells into Murine Thyroid: A Procedure to Establish Orthotopic Thyroid Cancer Mouse Model

Orthotopic Homograft Tumor Transplantation: A Technique to Generate Pancreatic Tumor Mouse Models