This work was supported by the NIH grants R01-DK100584 and China State Key Laboratory of Oral Diseases Open Funding SKLOD2015OF01 (RB). We thank Wenping Zhao, Tadatoshi Sato, and Kelly Lauter for help.

This study has been approved by the Institutional Animal Care and Use Committee (IACUC) of the Massachusetts General Hospital. Obtain appropriate institutional approval for this animal study before beginning. Some techniques might have to be adjusted according to local IACUC requirements.
1. GFP-PTX Mice
<ol>
	<li>Obtain PTHcre+ mice and Rosa-mTmG mice at 8 - 10 weeks old for further mating.</li>
	<li>Backcross the PTHcre+ mice (mixed 129;FVB background) with C57BL/6 mice for 6 generations to obtain mice with C57BL/6 background.</li>
	<li>Inbreed PTHcre+ mice to obtain PTHcre+/+ mice17. 
	NOTE: To perform genotyping, extract the DNA from the tip of the tail and use it for PCR. The PCR primers to check for heterozygosity and homozygosity of the PTHcre transgene are as follows: forward primer A, CCTGTCAAGGATGTGGAAGA, reverse primer A&#39;, TCAGATCACACCACACAGCA, forward primer B, CAGTTGTCTTTAGTTTACTCAGCATCAG, reverse primer B&#39;, GATAATCGCGAACATCTTCAGGTT17.</li>
	<li>Cross PTHcre+/+ mice16 with Rosa-mTmG mice18. Wean PTHcre;mTmG pups when 4 weeks old.</li>
	<li>Anesthetize 8 - 10 weeks old PTHcre;mTmG mice by i.p. injection of tribromoethanol (Avertin) at 0.6 mg/g body weight, or other agents such as ketamine/xylazine.&#160;Use buprenorphine 0.1 mg/kg s.c. every 12 h as an analgesic for 48 h after surgery according to an approved protocol.&#160;&#160;Ensure appropriate depth of anesthesia by the toe pinch withdrawal reflex or other means. Place the animal in the supine position.</li>
	<li>Extend and prepare the ventral neck region by shaving the skin using single edge blades. Disinfect the shaved skin with a povidone iodine antiseptic pad.</li>
	<li>Cover the animal with sterile surgical drapes to reduce contamination of the surgical site and use autoclaved microsurgical instruments for the surgical procedure.</li>
	<li>Cut a 2 cm longitudinal incision in the skin with a surgical scalpel. Dissect fascia and push the salivary glands to the side by blunt dissection with curved serrated forceps.</li>
	<li>Under the dissection microscope using halogen light and a 4 - 5X magnification, cut and separate the paratracheal muscles using sharp forceps tips and expose the trachea.</li>
	<li>Identify the thyroid gland with the right and left lobe located next to the trachea.</li>
	<li>Switch the light source to fluorescent light and visualize the two green-fluorescing parathyroid glands. 
	NOTE: Typically, the two parathyroid glands are located at or near the surface of the thyroid glands, but occasionally, they are located further away.</li>
	<li>Carefully remove the green parathyroid glands using surgical forceps and scissor. Use sterile gauze for hemostasis and carefully check along the trachea to ensure that all green tissue has been removed.</li>
	<li>Close the paratracheal muscles by interrupted suture using 6-0 polyglactin 910 sutures. Close the skin incision by Halsted suture using 6-0 polyglactin 910 sutures.</li>
	<li>Optional: Inject 10 &#181;L/g body weight sterile normal 0.9% sodium chloride solution to the mice for fluid replacement.</li>
	<li>Place postsurgical animals to a separate cage on a warm incubator (37 &#176;C) for body temperature recovery. Once the mice are awake and in the recumbent position, put pellet chow and water with some gelatin food on the cage floor.</li>
	<li>After a postsurgical observation period of 2 h, return mouse to the animal facility and follow local requirements for postsurgical care.</li>
	<li>3 days after parathyroidectomy, obtain 10 &#181;L tail blood and measure blood ionized Ca++ using an analyzer such as the blood gas system Ca++/pH analyzer. Successful parathyroidectomy results in blood ionized Ca++ equal or lower than -2SD of sham-operated control mice (1.20 mmol/L in our experiments of n = 30).</li>
</ol>
2. PTH-cre-iDTR Mice
<ol>
	<li>Obtain PTHcre+ and DTRfl/fl mice at 8 - 10 weeks old for mating.</li>
	<li>Backcross the PTHcre mice (mixed 129;FVB background) with C57BL/6 mice for 6 generations to obtain mice with C57BL/6 background.</li>
	<li>Inbreed the PTHcre+ (C57BL/6 background) mice to obtain PTHcre+/+ mice17. 
	NOTE: To perform genotyping, DNA from mice tail tips was extracted and used for PCR. Genotyping Primers: forward primer A, CCTGTCAAGGATGTGGAAGA, reverse primer A&#39;, TCAGATCACACCACACAGCA, forward primer B, CAGTTGTCTTTAGTTTACTCAGCATCAG, reverse primer B&#39;, GATAATCGCGAACATCTTCAGGTT17.</li>
	<li>Mate PTHcre+/+ mice16 with DTRfl/fl mice19 to obtain PTHcre-iDTR mice.</li>
	<li>Prepare DT solution by diluting diphtheria toxin powder with sterile saline to a concentration of 0.5 &#181;g/mL. Sterile filter, and store aliquots at -80 &#176;C.</li>
	<li>Choose 8 - 10 weeks old PTHcre-iDTR mice for injection experiment. Thaw DT aliquot to room temperature, administer DT intraperitoneally at 5 &#181;g/kg (10 &#181;L/g) bodyweight of the animal. For maximal efficiency and least toxicity, DT administration is repeated for a total of 2 injections in a 3-day interval17.</li>
	<li>3 days after the second injection, take 10 &#181;L tail blood from each PTHcre-iDTR/PTHcre-iDTR-mTmG mouse and measure blood Ca++ using a Blood Gas System Ca++/pH analyzer. 
	NOTE: We define mice with blood ionized Ca++ lower than 1.18 mmol/L as hypoparathyroid mice, which equals 2SD below the mean of vehicle-injected control mice (n = 22).</li>
</ol>

<ol>
	<li>Brandi, M. L., Brown, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Hypoparathyroidism. , (2015).</li><li>van Abel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+control+of+renal+Ca(2+)+transport+proteins+by+parathyroid+hormone.">Coordinated control of renal Ca(2+) transport proteins by parathyroid hormone.</a> Kidney Int. 68, 1708-1721 (2005).</li><li>Sebastian, E. M., Suva, L. J., Friedman, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+effects+of+intermittent+PTH(1-34)+and+PTH(7-34)+on+bone+microarchitecture+and+aortic+calcification+in+experimental+renal+failure.">Differential effects of intermittent PTH(1-34) and PTH(7-34) on bone microarchitecture and aortic calcification in experimental renal failure.</a> Bone. 43, 1022-1030 (2008).</li><li>Rodriguez-Ortiz, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+deficiency+reduces+circulating+levels+of+FGF23.">Calcium deficiency reduces circulating levels of FGF23.</a> J Am Soc Nephrol. 23, 1190-1197 (2012).</li><li>Liao, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relationship+between+Fibroblast+Growth+Factor+23+and+Biochemical+and+Bone+Histomorphometric+Alterations+in+a+Chronic+Kidney+Disease+Rat+Model+Undergoing+Parathyroidectomy.">Relationship between Fibroblast Growth Factor 23 and Biochemical and Bone Histomorphometric Alterations in a Chronic Kidney Disease Rat Model Undergoing Parathyroidectomy.</a> PloS one. 10, e0133278 (2015).</li><li>Fox, J., Care, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+low+calcium+and+low+phosphorus+diets+on+the+intestinal+absorption+of+water+in+intact+and+parathyroidectomized+pigs.">Effect of low calcium and low phosphorus diets on the intestinal absorption of water in intact and parathyroidectomized pigs.</a> Calcif Tissue Int. 31, 253-255 (1980).</li><li>Finco, D. R., Brown, S. A., Ferguson, D. C., Crowell, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+parathyroidectomy+of+the+dog.">Selective parathyroidectomy of the dog.</a> Can J Vet Res. 57, 288-292 (1993).</li><li>Can, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+allotransplantation+in+rabbits+without+cultivation.">Parathyroid allotransplantation in rabbits without cultivation.</a> Int J Clin Exp Med. 7, 280-284 (2014).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> j Natl Cancer Inst. 10, 725-733 (1949).</li><li>Sakai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osteoclast+development+in+immobilized+bone+is+suppressed+by+parathyroidectomy+in+mice.">Osteoclast development in immobilized bone is suppressed by parathyroidectomy in mice.</a> J Bone Miner Metab. 23, 8-14 (2005).</li><li>Miao, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Skeletal+abnormalities+in+Pth-null+mice+are+influenced+by+dietary+calcium.">Skeletal abnormalities in Pth-null mice are influenced by dietary calcium.</a> Endocrinology. 145, 2046-2053 (2004).</li><li>Gunther, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+ablation+of+parathyroid+glands+reveals+another+source+of+parathyroid+hormone.">Genetic ablation of parathyroid glands reveals another source of parathyroid hormone.</a> Nature. 406, 199-203 (2000).</li><li>Hough, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+calcium-sensing+receptor+mutation+in+the+mouse+is+associated+with+cataracts+and+ectopic+calcification.">Activating calcium-sensing receptor mutation in the mouse is associated with cataracts and ectopic calcification.</a> Proc Natl Acad Sci U S A. 101, 13566-13571 (2004).</li><li>Hannan, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Calcilytic+Agent+NPS+2143+Rectifies+Hypocalcemia+in+a+Mouse+Model+With+an+Activating+Calcium-Sensing+Receptor+(CaSR)+Mutation:+Relevance+to+Autosomal+Dominant+Hypocalcemia+Type+1+(ADH1).">The Calcilytic Agent NPS 2143 Rectifies Hypocalcemia in a Mouse Model With an Activating Calcium-Sensing Receptor (CaSR) Mutation: Relevance to Autosomal Dominant Hypocalcemia Type 1 (ADH1).</a> Endocrinology. 156, 3114-3121 (2015).</li><li>Libutti, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parathyroid+gland-specific+deletion+of+the+mouse+Men1+gene+results+in+parathyroid+neoplasia+and+hypercalcemic+hyperparathyroidism.">Parathyroid gland-specific deletion of the mouse Men1 gene results in parathyroid neoplasia and hypercalcemic hyperparathyroidism.</a> Cancer Res. 63, 8022-8028 (2003).</li><li>Bi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diphtheria+Toxin-+and+GFP-Based+Mouse+Models+of+Acquired+Hypoparathyroidism+and+Treatment+with+a+Long-Acting+Parathyroid+Hormone+Analog.">Diphtheria Toxin- and GFP-Based Mouse Models of Acquired Hypoparathyroidism and Treatment with a Long-Acting Parathyroid Hormone Analog.</a> J Bone Miner Res. , (2015).</li><li>Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+global+double-fluorescent+Cre+reporter+mouse.">A global double-fluorescent Cre reporter mouse.</a> Genesis. 45, 593-605 (2007).</li><li>Buch, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Cre-inducible+diphtheria+toxin+receptor+mediates+cell+lineage+ablation+after+toxin+administration.">A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration.</a> Nat Methods. 2, 419-426 (2005).</li><li>Dunn, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoblasts+in+the+stroma+of+the+parathyroid+glands+of+strain+C58+mice.">Melanoblasts in the stroma of the parathyroid glands of strain C58 mice.</a> J Natl Cancer Inst. 10, 725-733 (1949).</li></ol>

The authors declare that they have no competing financial interests.

We demonstrate the technique of GFP-guided parathyroidectomy using transgenic mice with GFP expression selectively in the parathyroid glands. In the PTHcre;mTmG mice, the double fluorescence (the green GFP in Cre-expressed cells and red Tomato in non-Cre expressed cells) enabled us to clearly identify, and to precisely remove all parathyroid glands without removing the thyroids. While we prefer the use of the double-fluorescence mTmG mice for the ability to identify fluorescent red non-parathyroid tissue, our procedure should also work well using single fluorescent animals such as the tomato red (B6.Cg-Ct(ROSA)26Sortm14(CAG-tdTomato)Hze/J) mouse. The procedure is relatively easy to perform, requires about 20 min per mouse, and results in a severe and sustained hypoparathyroid phenotype.
In addition, another advantage of the GFP-positive parathyroid glands is the ease of detection of aberrant parathyroid glands. Our studies demonstrate mislocalization of the parathyroids in about a quarter of B6 mice (Figure 1), which are readily detected in our mouse model by the green fluorescence. Contrary to thyro-parathyroidectomy, our technique avoids the removal of the thyroid with subsequent need for thyroid hormone replacement and the unknown effect of removal of calcitonin-producing thyroid C-cells. Fluorescently labeled parathyroid glands could be also used for other investigations that require the isolation of the parathyroid glands. The limitation of this model includes the requirement for surgery. Basic microsurgery skills and a dissection microscope with a fluorescent light source are required.
A second technique for generating hypoparathyroid mice that eliminates the need for surgery is demonstrated. Diphtheria toxin-treated PTHcre-iDTR mice exhibit a milder hypoparathyroidism phenotype, but simply require injecting DT intraperitoneally into the mouse. The critical part for generating this model was the optimization of the dose and dosing regimen. High doses of DT led to toxicity but low doses decreased the efficacy of the approach. We determined that the dose regiment of 2 injections at 5 &#181;g/kg, administered 3 days apart, resulted in reliable and stable hypocalcemia with no/minimal mortality.
Ultimately, we hope that these two approaches provide useful mouse models for acquired hypoparathyroidism. Using a novel long-acting PTH, we reported the first use of both of these models in determining the efficacy of new drugs for hypoparathyroidism17.

Since the first systematic description of the parathyroid glands in human and in several other species by Sandstr&#246;m in 1880 1, understanding the significance of this small endocrine organ for human physiology and disease has continuously improved. Parathyroid glands secrete parathyroid hormone (PTH), the principal regulator of calcium metabolism. PTH is also an important hormone for phosphate homeostasis and bone turnover 1,2. Accidental removal or damage of the parathyroids during neck surgery is the most common cause of hypoparathyroidism, a disease characterized by low blood calcium, low PTH, and elevated phosphorus 1.
To better study acquired hypoparathyroidism and test novel therapies, reliable and easily accessible mouse models are required. Mice are widely used in research because a wide variety of genetic tools are available in this species permitting sophisticated mechanistic studies in vivo. However, while surgical parathyroidectomy (PTX) can be used in rats 2,3,4,5, and larger mammals 6,7,8, it is technically very challenging in mice because of the small size of the glands and their variable anatomic distribution 9. Therefore, thyro-parathyroidectomy (TPTX) is typically performed in mice, in which the thyroid and parathyroid glands are removed together 10. However, low thyroid hormone levels are a potential confounder in experiments, complicating this model. In addition, C-cells within the thyroid gland, which produce calcitonin, a hormone important in calcium homeostasis in rodents, are also lost upon removal of the thyroids 11.
Several genetic mouse models of hypoparathyroidism exist, which include the PTH-null mouse 12, the GCM2-null mouse 13, and the Nuf mouse with an activating mutation in the calcium-sensing receptor (CaSR) 14,15. However, these genetic defects are already present during embryonic development, and the function of the parathyroids is therefore already impaired during embryogenesis. This can affect the development of organs such as the skeleton. This contrasts with patients with postsurgical hypoparathyroidism who acquire the disease later in life. Moreover, some of these mouse models exhibit early lethality and reduced fertility, which further complicates their use 12,13,14.
We developed two new mouse models for acquired hypoparathyroidism. Using genetically engineered mice that express GFP specifically in the parathyroids allows the parathyroid glands to be easily identified for surgical removal without removing the thyroid gland. This mouse was generated by crossing the PTH-Cre mouse, which expresses Cre recombinase under the control of the 5.5 kb PTH promoter 16 with the ROSAmTmG mouse. The resulting PTHcre;mTmG mice express green fluorescent protein specifically in parathyroid cells. The second mouse model uses the same PTH-Cre, this time to remove a STOP cassette from the inducible DTR mouse, resulting in expression of the diphtheria toxin receptor specifically in the parathyroids. Systemic administration of DT destroys parathyroid cells, rendering the animals hypoparathyroid without surgery.
The two mouse models presented in this study demonstrate a stable hypocalcemic phenotype over the three-month observation period. The procedures are easy to perform, the phenotype is reproducible, and the hypoparathyroid mice exhibit a high survival rate 17.

<table border="0" cellpadding="0" cellspacing="0" width="676">
	<tbody>
		<tr height="26">
			<td height="26" style="height:26px;width:188px;">ROSAmT/mG mice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">7676</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">PTH-Cre mice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">5989</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">iDTRmice</td>
			<td style="width:183px;">The Jackson Laboratory</td>
			<td align="right" style="width:108px;">7900</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">6-0 polyglactin 910 suture with needle</td>
			<td style="width:183px;">Ethicon, Inc</td>
			<td style="width:108px;">J510G</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Safety Single Edge Razor Blades</td>
			<td style="width:183px;">American Safety Razor Company</td>
			<td style="width:108px;">66-0089</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Disposable Scalpel</td>
			<td style="width:183px;">Feather Safety Razor Co., LTD</td>
			<td style="width:108px;">72042-11</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Povidone-Iodine Prep Pads</td>
			<td style="width:183px;">Dynarex Corporation</td>
			<td align="right" style="width:108px;">1108</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Ply gauze</td>
			<td style="width:183px;">Busse. Inc</td>
			<td style="width:108px;">BHD707</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">0.9% Sodium Chloride Solution</td>
			<td style="width:183px;">HOSPIRA Worldwide, Inc</td>
			<td style="width:108px;">07983-09</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">1mL 29G Insulin Syringe</td>
			<td style="width:183px;">BECTON DICKINSON</td>
			<td align="right" style="width:108px;">329622</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Surgical Incise Drapes</td>
			<td style="width:183px;">3M</td>
			<td style="width:108px;">6640EZ</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Dumstar Biology forceps</td>
			<td style="width:183px;">Roboz Surgical Instrument Co., Inc</td>
			<td style="width:108px;">RS-4984</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">Micro Dissecting Spring Scissors</td>
			<td style="width:183px;">Roboz Surgical Instrument Co., Inc</td>
			<td style="width:108px;">RS-5605</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">Needle Holder</td>
			<td style="width:183px;">MILTEX.,Inc</td>
			<td style="width:108px;">V98-42</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:188px;">2,2,2-Tribromethanol</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:108px;">T48402</td>
			<td style="width:197px;"></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:188px;">2-Methyl-2-Butanol</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td align="right" style="width:108px;">152463</td>
			<td style="width:197px;">For dissolve the 2,2,2-Tribromethanol</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:188px;">Diphtheria Toxin Powder</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:108px;">D0564</td>
			<td style="width:197px;">Dissolve in 0.9% sodium chloride solution at 1mg/mL as the stock solution in -80C</td>
		</tr>
		<tr height="72">
			<td height="72" style="height:72px;width:188px;">Multicap Blood Collection Capillary tubes</td>
			<td style="width:183px;">Siemens Healthcare Diagnostics Ltd</td>
			<td align="right" style="width:108px;">855578</td>
			<td style="width:197px;">For collecting blood in iCa2+ analysis using RapidLab 348 Ca2+/pH analyzer</td>
		</tr>
		<tr height="47">
			<td height="47" style="height:47px;width:188px;">RapidLab 348 Ca2+/pH analyzer</td>
			<td style="width:183px;">Siemens Healthcare</td>
			<td style="width:108px;"></td>
			<td style="width:197px;">For iCa2+ analysis</td>
		</tr>
	</tbody>
</table>

two techniques to create hypoparathyroid mice: parathyroidectomy using gfp glands and diphtheria-toxin-mediated parathyroid ablation

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most common cause of the disease is accidental removal of the parathyroid glands during thyroid surgery. Novel therapies for HP are needed, but testing them requires reliable animal models of acquired HP. 
Here, we demonstrate the generation of two mouse models of acquired HP. In the GFP-PTX model, mice with green fluorescent protein (GFP) expressed specifically in the parathyroids (PTHcre-mTmG) were created by crossing PTHcre+ mice with Rosa-mTmGfl/fl mice. Green fluorescing parathyroid glands are easily identified under a fluorescence dissecting microscope and parathyroidectomy is performed in less than 20 min. After fluorescence-guided surgery, mice are profoundly hypocalcemic. Contrary to the traditional thyro-parathyroidectomy, this precise surgical approach leaves thyroid glands and thyroid function intact. The second model, which does not require surgery, is based on a diphtheria-toxin approach. PTHcre-iDTR mice, which express the diphtheria toxin (DT) receptor specifically in the parathyroids, were generated by crossing the inducible DTR mouse with the PTHcre mouse. Parathyroid cells are thus rendered sensitive to diphtheria toxin (DT) and can be selectively destroyed by systemically injecting mice with DT. The resulting hypocalcemic phenotype is stable.

Location of the Parathyroid Glands
First, we recorded the distribution of the parathyroid glands of 54 PTHcre-mTmG mice as observed under the fluorescent dissection microscope. 74% (40/54) mice had two green parathyroid glands (Figure 1A, C, E), 26% (14/54) mice had an additional third parathyroid gland (Figure 1B, D, F). No mouse with a single gland or more than three glands were observed. Usually, parathyroid glands were located near the superior border of the thyroid gland (58%, 71/122; Figure 1A(1,2), B(1,2), C(2), D(1,2), E(2), F(3)). 27% (33/122) glands were located near the inferior border of the thyroid gland (Figure 1C(1), D(3), F(1)), and 13% (16/122) were located away from the thyroid gland (Figure 1B(3), E(1), F(2)). Our findings are consistent with and extend previous findings of varying locations of the parathyroid glands20.
GFP-PTX Mice
The entire surgery from anesthesia to closing the skin incision took approximately 20 min per mouse. The survival rate of postsurgical mice over a 3-month observation period was 96.3% (53/55). 92.4% (49/53) GFP-PTX mice exhibited ionized calcium levels that were 2 SD below the mean of sham-operated control mice or lower. The hypoparathyroid phenotype in the GFP-PTX mice (hypocalcemia, low PTH and elevated serum phosphate) was stable for the entire observation time of 3 months. Importantly, thyroid function was not different from sham-operated animals 3 months after surgery (TSH = 42 &#177; 24 vs. 30 &#177; 15 mU/L, p = 0.171; T4 = 3.0 &#177; 0.6 vs. 3.1 &#177; 0.9 &#181;g/dL, p = 0.707 (Figure 2).
PTH-cre-iDTR Mice
DT injected PTH-Cre-iDTR mice developed hypoparathyroidism (low blood ionized calcium, elevated blood phosphorus, and inappropriately low-normal PTH levels). We have previously reported that a few PTH positive cells escape the ablation by diphtheria toxin, explaining the measurable circulating PTH and the therefore the somewhat milder phenotype of these mice17.
Hypoparathyroidism in GFP-PTX Mice and PTH-cre-iDTR Mice
Significant reductions of blood Ca++ and serum PTH levels were observed in GFP-PTX mice 3 days after surgery, compared to levels found in sham-operated mice (Ca++ = 1.05 &#177; 0.40 vs. 1.30 &#177; 0.03 mmol/L, p &#60; 0.05; PTH=32 &#177; 22 vs. 580 &#177; 137 pg/mL, p &#60; 0.05). The hypoparathyroidism phenotype was stable over the 3-month observation period (Figure 3A, reprinted with permission from (reference#17)). After 2 injections of 5 &#181;g/kg DT at 3 days interval, a dose and regimen optimized to use the least amount of DT to give the maximal hypoparathyroid phenotype, the DT injected PTH-cre-iDTR mice showed significant hypocalcemia and reduced PTH compared to vehicle control mice, which persisted over the 90 days observation period (Ca++ = 1.10 &#177; 0.07 mmol/L vs. 1.26 &#177; 0.05 mmol/L, p &#60; 0.05; PTH = 218 &#177; 156 pg/mL vs. 572 &#177; 164 pg/mL, p &#60; 0.05) (Figure 3B, reprinted with permission from (reference#17)).
<img alt="Figure 1" src="/files/ftp_upload/55010/55010fig1.jpg" /> 
Figure 1: Representative Images of the Various Locations of the Parathyroid Glands in 54 PTHcre-mTmG Mice under Fluorescent Dissection Microscope. Mice had either two (A, C, E) or three (B, D, F) green parathyroid glands. Most parathyroid glands were located near the superior border (A(1,2), B(1,2), C(2), D(1,2), E(2), F(3) or near the inferior border of the thyroid gland (C(1), D(3), F(1)). In rare cases, some were located ectopically (B(3), E(1), F(2)). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55010/55010fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55010/55010fig2.jpg" /> 
Figure 2: TSH and T4 Level of GFP-PTX Mice. 3 months after GFP-PTX, serum was obtained for TSH and T4 measurements. GFP-PTX mice showed TSH concentrations (42 &#177; 24 mU/L) (A) and T4 concentrations (3.0 &#177; 0.6 &#956;g/dL) (B) that were not different from control mice (TSH = 30 &#177; 15 mU/L, p = 0.171, n =11, T4 = 3.1 &#177; 0.9, p = 0.707, n = 11). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55010/55010fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55010/55010fig3.jpg" /> 
Figure 3: Blood Ca++ and PTH Levels in GFP-PTX Mice and DT Injected PTH-cre-iDTR Mice. Both GFP-PTX mice (A) and DT injected PTH-cre-iDTR mice (B) exhibited stable hypocalcemia and reduced PTH levels over 3 month observation period (N = 6 - 8, ***p &#60; 0.001) (re-printed with permission from reference#17). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55010/55010fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation at JoVE.com

Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Hypoparathyroidism (HP) is a disorder characterized by low levels of PTH which lead to hypocalcemia, hyperphosphatemia, and low bone turnover. The most ...

two-techniques-to-create-hypoparathyroid-mice-parathyroidectomy-using

Nanyang Technological University

Research

JoVE Journal

Medicine

14.4K Views.  Harvard Medical School. Mice with acquired hypoparathyroidism would be useful for studying novel drug therapies for hypoparathyroidism. Two procedures to create such mice are demonstrated. The GFP-PTX mouse is generated by surgical parathyroidectomy guided by green fluorescing parathyroid glands. A second, non-surgical approach is based on parathyroid-specific expression of the diphtheria toxin receptor.

Video: Two Techniques to Create Hypoparathyroid Mice: Parathyroidectomy Using GFP Glands and Diphtheria-Toxin-Mediated Parathyroid Ablation

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque formation and stenosis, as observed for example in ischemic heart disease. Two highly reproducible mouse models&#160;&#8211;&#160;both resulting in artery stenosis but each underlying a different pathway of development&#160;&#8211; are introduced here. The models represent the two most common causes of artery stenosis; namely one mouse model for each myointimal hyperplasia, and atherosclerosis are shown. To induce myointimal hyperplasia, a balloon catheter injury of the abdominal aorta is performed. For the development of atherosclerotic plaque, the ApoE -/- mouse model in combination with western fatty diet is used. Different model-adapted options for the measurement and evaluation of the results are named and described in this manuscript. The introduction and comparison of these two models provides information for scientists to choose the appropriate artery stenosis model in accordance to the scientific question asked.

This video shows two models of intimal plaque development in murine arteries and emphasizes the differences in myointimal hyperplasia and atherosclerosis.

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Acute Brain Trauma in Mice Followed By Longitudinal Two-photon Imaging

Although acute brain trauma often results from head damage in different accidents and affects a substantial fraction of the population, there is no effective treatment for it yet. Limitations of currently used animal models impede understanding of the pathology mechanism. Multiphoton microscopy allows studying cells and tissues within intact animal brains longitudinally under physiological and pathological conditions. Here, we describe two models of acute brain injury studied by means of two-photon imaging of brain cell behavior under posttraumatic conditions. A selected brain region is injured with a sharp needle to produce a trauma of a controlled width and depth in the brain parenchyma. Our method uses stereotaxic prick with a syringe needle, which can be combined with simultaneous drug application. We propose that this method can be used as an advanced tool to study cellular mechanisms of pathophysiological consequences of acute trauma in mammalian brain in vivo. In this video, we combine acute brain injury with two preparations: cranial window and skull thinning. We also discuss advantages and limitations of both preparations for multisession imaging of brain regeneration after trauma.

Acute brain trauma is a severe injury that has no adequate treatment to date. Multiphoton microscopy allows studying longitudinally the process of acute brain trauma development and probing therapeutical strategies in rodents. Two models of acute brain trauma studied with in vivo two-photon imaging of brain are demonstrated in this protocol.

Although acute brain trauma often results from head damage in different accidents and affects a substantial fraction of the population, there is no ...

Robotic Ablation of Atrial Fibrillation

Background: Pulmonary vein isolation (PVI) is an established treatment for atrial fibrillation (AF). During PVI an electrical conduction block between pulmonary vein (PV) and left atrium (LA) is created. This conduction block prevents AF, which is triggered by irregular electric activity originating from the PV. However, transmural atrial lesions are required which can be challenging. Re-conduction and AF recurrence occur in 20 - 40% of the cases. Robotic catheter systems aim to improve catheter steerability. Here, a procedure with a new remote catheter system (RCS), is presented. Objective of this article is to show feasibility of robotic AF ablation with a novel system. Materials and Methods: After interatrial trans-septal puncture is performed using a long sheath and needle under fluoroscopic guidance. The needle is removed and a guide wire is placed in the left superior PV. Then an ablation catheter is positioned in the LA, using the sheath and wire as guide to the LA. LA angiography is performed over the sheath. A circular mapping catheter is positioned via the long sheath into the LA and a three-dimensional (3-D) anatomical reconstruction of the LA is performed. The handle of the ablation catheter is positioned in the robotic arm of the Amigo system and the ablation procedure begins. During the ablation procedure, the operator manipulates the ablation catheter via the robotic arm with the use of a remote control. The ablation is performed by creating point-by-point lesions around the left and right PV ostia. Contact force is measured at the catheter tip to provide feedback of catheter-tissue contact. Conduction block is confirmed by recording the PV potentials on the circular mapping catheter and by pacing maneuvers. The operator stays out of the radiationfield during ablation. Conclusion: The novel catheter system allows ablation with high stability on low operator fluoroscopy exposure.

Pulmonary vein isolation (PVI) with an ablation catheter is a curative treatment for atrial fibrillation (AF). Robotic catheter systems aim to improve catheter steerability. Here, a procedure with a new robotic catheter system is presented. The goal of the procedure is electrical block between pulmonary vein and left atrium.

Background: Pulmonary vein isolation (PVI) is an established treatment for atrial fibrillation (AF). During PVI an electrical conduction block between ...

A Simple Mechanical Procedure to Create Limbal Stem Cell Deficiency in Mouse

Limbal stem cell deficiency (LSCD) is a state of malfunction or loss of limbal epithelial stem cells, after which the corneal epithelium is replaced with conjunctiva. Patients suffer from recurrent corneal defects, pain, inflammation, and loss of vision.
Previously, a murine model of LSCD was described and compared to two other models. The goal was to produce a consistent mouse model of LSCD that both mimics the phenotype in humans and lasts long enough to make it possible to study the disease pathophysiology and to evaluate new treatments. Here, the technique is described in more detail.
A motorized tool with a rotating burr has been designed to remove the rust rings from the corneal surface or to smooth the pterygium bed in patients. It is a suitable device to create the desired LSCD model. It is a readily available, easy-to-use tool with a fine tip that makes it appropriate for working on small eyes, as in mice. Its application prevents unnecessary trauma to the eye and it does not result in unwanted injuries, as often is the case with chemical injury models. As opposed to a blunt scraper, it removes the epithelium with the basement membrane. In this protocol, the limbal area was abraded two times, and then the whole corneal epithelium was shaved from limbus to limbus. To avoid stroma injury, care was taken not to brush the corneal surface once the epithelium was already removed.

The following article provides an easy, reproducible technique to effectively create a sustainable mouse model of limbal stem cell deficiency (LSCD). This animal model is useful in testing and comparing the efficacy of treatments for limbal stem cell diseases.

Limbal stem cell deficiency (LSCD) is a state of malfunction or loss of limbal epithelial stem cells, after which the corneal epithelium is replaced with ...

Techniques of Sleeve Gastrectomy and Modified Roux-en-Y Gastric Bypass in Mice

Obesity is a major public health issue, with a prevalence of 4 to 28% for men and 6.2 to 36.5% for women in Europe (from 2003 to 2008). Morbid obesity is frequently associated with metabolic complications, such as type 2 diabetes, hypertension, and dyslipidemia, reducing life expectancy and quality. In the absence of any effective noninvasive treatments, bariatric surgery is a valuable therapeutic option for patients with morbid obesity (body mass index (BMI) &#62;40 kg/m2), leading to long-term, sustained weight loss and improvements in metabolic complications. However, the underlying cellular and molecular mechanisms sustaining the beneficial effects of bariatric surgery are not yet fully understood. Due to the numerous genetically-modified strains available, the mouse model is the most convenient animal model to explore the molecular mechanisms behind the pleiotropic beneficial effects of bariatric surgeries. Here, we detailed the optimized healthcare methods and surgical protocols in mice for the two most widely-used bariatric surgeries: the sleeve gastrectomy and the modified Roux-en-Y gastric bypass. Deciphering the molecular mechanisms underlying the therapeutic effects of bariatric surgeries offers the promise of identifying new therapeutics targets.

Bariatric surgery is the most efficient way to reduce body weight and the deadly metabolic complications (diabetes, obesity, and dyslipidemia) frequently associated with morbid obesity. Mouse models of bariatric surgery represent a unique asset for deciphering molecular mechanisms behind the beneficial effects of these surgeries on diabetes, hypertension, and dyslipidemia.

Obesity is a major public health issue, with a prevalence of 4 to 28% for men and 6.2 to 36.5% for women in Europe (from 2003 to 2008). Morbid obesity is ...

In Vivo Imaging of Cx3cr1gfp/gfp Reporter Mice with Spectral-domain Optical Coherence Tomography and Scanning Laser Ophthalmoscopy

Spectral domain optical coherence tomography (SD-OCT) and scanning laser ophthalmoscopy (SLO) are extensively used in experimental ophthalmology. In the present protocol, mice expressing green fluorescent protein (gfp) under the promoter of Cx3cr1 (BALB/c-Cx3cr1gfp/gfp) were used to image microglia cells in vivo in the retina. Microglia are resident macrophages of the retina and have been implicated in several retinal diseases1,2,3,4,5,6. This protocol provides a detailed approach for generation of retinal B-scans, with SD-OCT, and imaging of microglia cell distribution in Cx3cr1gfp/gfp mice with SLO in vivo, using an ophthalmic imaging platform system. The protocol can be used in several reporter mouse lines. However, there are some limitations to the protocol presented here. First, both SLO and SD-OCT, when used in the high-resolution mode, collect data with high axial resolution but the lateral resolution is lower (3.5 &#181;m and 6 &#181;m, respectively). Moreover, the focus and saturation level in SLO is highly dependent on parameter selection and correct alignment of the eye. Additionally, using devices designed for human patients in mice is challenging due to the higher total optical power of the mouse eye compared to the human eye; this can lead to lateral magnification inaccuracies7, which are also dependent on the magnification by the mouse lens among others. However, despite that the axial scan position is dependent upon lateral magnification, the axial SD-OCT measurements are accurate8.

In Vivo Imaging of Cx3cr1gfp/gfp Reporter Mice with Spectral-domain Optical Coherence Tomography and Scanning Laser Ophthalmoscopy

This protocol describes how high-resolution imaging techniques such as spectral domain optical coherence tomography and scanning laser ophthalmoscopy can be utilized in small rodents, using an ophthalmic imaging platform system, to obtain information on retinal thickness and microglial cell distribution, respectively.

Spectral domain optical coherence tomography (SD-OCT) and scanning laser ophthalmoscopy (SLO) are extensively used in experimental ophthalmology. In the ...

Ablation of Ischemic Ventricular Tachycardia Using a Multipolar Catheter and 3-dimensional Mapping System for High-density Electro-anatomical Reconstruction

Ventricular tachycardia (VT) in patients with ischemic cardiomyopathy mainly results from endocardial scars after myocardial infarction; those scars represent zones of slow conduction that allow the occurrence and maintenance of reentrant circuits. Catheter ablation enables substrate modification of those low voltage areas and thus can help to alter the scar tissue in such a way that arrhythmias cannot appear anymore. Hospitalizations of concerned patients decrease, quality of life and outcome rise. Consequently, VT ablation represents a growing field in electrophysiology, especially for patients with endocardial scars in ischemic heart disease after myocardial infarction. However, ablation of ventricular tachycardia remains one of the most challenging procedures in the electrophysiology lab. Precise scar definition and localization of abnormal potentials are critical for ablation success. The following manuscript describes the use of a multipolar mapping catheter and 3-dimensional (3D) mapping system to create a high density electro-anatomical map of the left ventricle including a precise scar representation as well as mapping of fractionated and late potentials in order to allow a highly accurate substrate modification.

With the following protocol, we provide an approach to Ventricular Tachycardia (VT) ablation using high density mapping with a multipolar catheter and 3D mapping system enhancing the success of the procedure.

Ventricular tachycardia (VT) in patients with ischemic cardiomyopathy mainly results from endocardial scars after myocardial infarction; those scars ...

Protocol to Create Chronic Wounds in Diabetic Mice

Chronic wounds develop as a result of defective regulation in one or more complex cellular and molecular processes involved in proper healing. They impact ~6.5M people and cost ~$40B/year in the US alone. Although a significant effort has been invested in understanding how chronic wounds develop in humans, fundamental questions remain unanswered. Recently, we developed a novel mouse model for diabetic chronic wounds that have many characteristics of human chronic wounds. Using db/db-/- mice, we can generate chronic wounds by inducing high levels of oxidative stress (OS) in the wound tissue immediately after wounding, using a one-time treatment with inhibitors specific to the antioxidant enzymes catalase and glutathione peroxidase. These wounds have high levels of OS, develop biofilm naturally, become fully chronic within 20 days after treatment and can remain open more for more than 60 days. This novel model has many features of diabetic chronic wounds in humans and therefore can contribute significantly to advancing fundamental understanding of how wounds become chronic. This is a major breakthrough because chronic wounds in humans cause significant pain and distress to patients and result in amputation if unresolved. Moreover, these wounds are very expensive and time-consuming to treat, and lead to significant loss of personal income to patients. Advancements in this field of study through the use of our chronic wound model can significantly improve health care for millions who suffer under this debilitating condition. In this protocol, we describe in great detail the procedure to cause acute wounds to become chronic, which has not been done before.

Chronic wounds are developed from acute wounds on a diabetic mouse model by inducing high levels of oxidative stress after a full-thickness cutaneous wound. The wound is treated with inhibitors for catalase and glutathione peroxidase, resulting in impaired healing and biofilm development by bacteria present in the skin microbiome.

Chronic wounds develop as a result of defective regulation in one or more complex cellular and molecular processes involved in proper healing. They impact ...

Two-Dimensional X-Ray Angiography to Examine Fine Vascular Structure Using a Silicone Rubber Injection Compound

Angiography is an essential tool for the study of vascular structures in various research fields. The aim of this study is to introduce a simple angiographic method for examining the fine vascular structure of unfixed, fresh tissue using a silicone rubber injection compound and soft tissue X-ray system. This study is especially focused on flap territories used in reconstructive surgery. This study employs angiography with a silicone rubber injection compound in various experimental conditions using Sprague-Dawley rats. First, 15 mL of MV compound and 15 mL of diluent is mixed. Then, 1.5 mL of the curing agent is prepared, and a 24G catheter is cannulated in the common carotid artery of the rat. A three-way stopcock is then connected to a catheter, and the radiopaque agent, after being mixed with the prepared curing agent, is injected immediately without spillage. Finally, as the agent solidifies, the specimen is harvested, and an angiographic image is obtained using a soft tissue X-ray system. This method indicates that high-quality angiography showing fine vascular structures can be easily and simply obtained within in a short period of time.

This study presents a simple two-dimensional angiographic method to examine fine vascular structures using a silicone rubber injection compound and soft tissue X-ray system.

Angiography is an essential tool for the study of vascular structures in various research fields. The aim of this study is to introduce a simple ...

Sleeve Gastrectomy in Mice using Surgical Clips

The number of people who are overweight and obese is continually increasing both in the adult and adolescent populations. This coincides with the increased universal phenomenon of type 2 diabetes (T2D) and other metabolic problems. Bariatric surgery, such as SG, is currently one of the most effective and commonly used long-term treatment for obesity and T2D, but the association between them is not completely explored yet. The mechanisms underlying the outcomes seen after bariatric surgery in humans can be investigated based on preclinical animal studies. The SG reduces body weight, glucose levels and many metabolic parameters, and is easy to perform with a low incidence of complications. The goal of this work is to provide a simple method and an uncomplicated preclinical model of bariatric surgery in animals for researchers.

The prevalence of diabetes and obesity is continuously increasing worldwide. The mechanisms between diabetes, obesity and their associated mortality and co-morbidities need to be further investigated. Here, we present a protocol for sleeve gastrectomy (SG) in animals as an uncomplicated preclinical model of bariatric surgery.