Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

NOTE: This study was conducted in accordance with the recommendation of the Guide for the Care and Use of Laboratory Animals of the National Institute of Health. The animal protocol was approved by the University of Wisconsin-Madison, Institutional Animal Care and Use Committee. Primary Astrocyte Culture protocol that is presented here is adopted from the protocols presented by Zhang Y19 et al. and Cengiz P20 et al. with some modifications.
1. Hippocampal Dissection and Astrocyte Culture
<ol>
	<li>Prepare all necessary reagents and materials including surgical scissors, smooth fine forceps, flat tip forceps, paper towels, waste bag, 70% ethanol and 2 dissecting dishes (3.5 cm diameter) on ice filled with 2 mL Hank&#39;s Balanced Salt Solution (HBSS) each. Make sure the surgical equipment&#39;s are sterile (autoclave) prior to procedure and use all other materials (Astrocyte plating medium: DMEM + 5% horse serum + 1% penicillin-streptomycin, horse serum, HBSS, 0.25% trypsin, glass coverslips, Petri dishes, 15/50 mL tubes, T25 flasks,&#160;etc.) as pre-sterile.</li>
	<li>Gently hold and spray the head and neck of mouse pup with 70% ethanol and decapitate using sharp sterile scissors [Figure 1 (1)].</li>
	<li>Perform a midline incision from posterior to anterior skull with small scissors along the scalp to expose the brain [Figure&#160;1 (2-3)].</li>
	<li>Cut the cranium carefully from the neck to the nose with small scissors. Then cut cranium anterior to the olfactory bulbs and inferior to the cerebellum to disconnect the cranium from the skull base.</li>
	<li>Make a small incision at the base of the skull and cut along the midline. Use sterile flat-tip forceps to peel away the skull. Remove the brain stem with the help of a curved forceps. Remove brain from the cranium and place into the first dissecting dish [Figure&#160;1 (4-9)]21.</li>
	<li>Using a curved forceps, flip the brain so that the ventral surface of the brain is facing up and then separate both hemispheres with a sharp sterile surgical blade [Figure&#160;1 (10,11)]</li>
	<li>Peel back the cerebral hemispheres and carefully remove the bulging midbrain and thalamic tissue with a sterile flat curved forceps to reveal the hippocampus, a small, seahorse-shaped structure in the medial temporal lobe [Figure&#160;1 (12-14)].</li>
	<li>Remove both the hippocampal lobes [Figure&#160;1 (15,16)] and carefully dissect the meninges from the lobes by pulling with the fine forceps. This step avoids contamination of the final astrocyte culture by meningeal cells and fibroblasts.</li>
	<li>Transfer the prepared hippocampal lobes into the second dish filled with HBSS and return it onto ice [Figure&#160;1 (17,18)]. Pool both hippocampal lobes from a single mouse (P0 - P2) for preparation of hippocampal astrocyte cultures. This gives the astrocyte proper density. Mince hippocampal lobes using a sharp sterile surgical blade (approximately 4 times).</li>
	<li>Aspirate HBSS from dish using a sterile tip attached to a 1 mL pipette&#160;and add 3&#160;mL of 0.25% trypsin, mix, transfer to a 15 mL sterile conical tube and incubate the tissue at 37 &#176;C for 20 min with gentle shaking.</li>
	<li>Centrifuge tube at 300 x g for 5 min. Aspirate supernatant carefully using a sterile glass pipette attached to a vacuum line. Add 10 mL astrocyte plating medium and triturate (20 - 30 times) using a fire polished glass pipette until tissue pieces homogenize.</li>
	<li>Centrifuge tube at 300 x g for 5 min. Aspirate supernatant and add 2 mL of fresh prewarmed astrocyte plating media. Pass cells through a 70 &#956;m mesh filter (cell strainer) into a new 50 mL&#160;conical tube.</li>
	<li>Plate entire cell suspension on a Poly-D-Lysine/Laminin coated sterile T25 culture flask containing 3 mL of astrocyte plating media, then incubate the flask at 37 &#176;C in a 5% CO2 incubator.</li>
	<li>Aspirate entire media at day-in-vitro (DIV) 1, DIV 3 and DIV 7, and replace with 2 mL of fresh astrocyte plating media. Observe the progression and astrocytic confluence under light microscope each time while replacing the astrocyte plating media. 
	NOTE: At DIV 1, all the viable astrocytes are attached to the surface of the culture flask and the dead or dying cells that include neurons are floating in the supernatant. At DIV 3, the attached cells start to divide to form astrocytic cell layer. In the absence of the supportive conditions, culture is almost devoid of any neuronal growth. At DIV 7, astrocyte layer is about 80 - 90% confluent and a few microglia as well as oligodendrocyte precursor cells are present on top of the astrocytic layer.</li>
	<li>Aspirate the plating medium from the flask, add 2 mL of fresh prewarmed astrocyte plating medium, rinse and remove again at DIV 11, when astrocytes are confluent and ready for sub culturing.</li>
	<li>Add 2 mL of 0.25% trypsin, gently rotate the flask a few times and aspirate trypsin using a sterile glass pipet.</li>
	<li>Add 2 mL of 0.25% trypsin and let the flask sit in the tissue culture hood for 4 - 5 min at RT.</li>
	<li>Remove the trypsin and keep the flask at 37 &#176;C in a 5% CO2 incubator for 10 min. Add 5 mL prewarmed astrocyte plating medium and detach the astrocytic layer by tapping the flask against the palm of your hand (3 - 4 times) followed by gentle trituration to achieve complete detachment and collect the astrocytes in a 15 mL conical tube.</li>
	<li>Centrifuge tube at 300 x g for 5 min, aspirate the supernatant, and add 1 mL fresh astrocyte plating medium.</li>
	<li>Add 10 &#956;L of the cell suspension to a hemocytometer and count the cells in the large central gridded area (1 mm2) using an inverted phase contrast microscope (10X objective). Multiply by 104 to estimate the number of cells per mL. One T25 flask will yield ~1 x 106 total dissociated cells. Seed ~1 x 105 cells in 2 mL astrocyte plating medium on a 12 mm diameter Poly-D-Lysine precoated glass coverslip in the well of a 24-well culture dish.</li>
	<li>Incubate at 37 &#176;C in a 5% CO2 incubator. Perform OGD/REOX at DIV 12 - 14 (section 2).</li>
	<li>Treat the astrocyte cultures at DIV 3 with 5 mM L-leucine Methyl Ester (LME) hydrochloride until DIV 11 if hippocampal cultures devoid of microglia are desired. After LME incubation, subject cultures to shaking (300 rpm for 1 h) to remove contaminating microglia. 
	NOTE: LME is a microglial cytotoxic agent that has been used extensively as a method to eliminate proliferating microglia22.</li>
</ol>
2. OGD/REOX Treatment
<ol>
	<li>Aspirate media from coverslip containing adherent astrocyte culture (DIV 12 - 14) and rinse 3 times&#160;by gently rotating the 24-well culture dish holding the coverslip a couple times with 1 mL isotonic OGD solution (pH 7.4) containing (in mM): 0 glucose, 21 NaHCO3, 120 NaCl, 5.36 KCl, 0.33 Na2HPO4, 0.44 KH2PO4, 1.27 CaCl2, and 0.81 MgSO4.</li>
	<li>Add 0.2 mL OGD solution to well to cover the coverslip and incubate for 2 h in a hypoxic incubator containing 94% N2, 1% O2, and 5% CO2. Gently mix with an orbital shaker (50 rpm) for the first 30 min of hypoxia to facilitate gas exchange.</li>
	<li>Incubate normoxic control cells for 2 h in 5% CO2 and atmospheric air in a buffer identical to the OGD solution except for the addition of 5.5 mM glucose.</li>
	<li>For REOX, aspirate OGD solution and add 2 mL&#160;of astrocyte plating medium. Incubate in 5% CO2 and atmospheric air at 37&#176;C for 5 h.</li>
</ol>
3. Immunocytochemical Staining
<ol>
	<li>Aspirate the culture media using a sterile glass pipette attached to a vacuum line and quickly rinse coverslip once by adding 1mL of 0.1 M Tris Buffered Saline (TBS) (154 mM NaCl, 16 mM Trizma Base, 84 mM Tris-HCl, pH 7.4) to the well. Aspirate and add 2 mL of 4% paraformaldehyde (PFA) in 1x Phosphate Buffered Saline (PBS). Incubate for 15 min at RT.</li>
	<li>Aspirate and add 1 mL of 0.1 M TBS, then place on a rocking shaker for 2 min. Repeat 3 times. Add 1 mL blocking solution (10% goat serum, 10 mg/mL BSA, 0.025% Triton X-100 in 0.1 M TBS) and incubate for 30 min at 37 &#176;C on a rocking shaker.</li>
	<li>Aspirate blocking solution and add primary mouse monoclonal anti-GFAP antibody (0.2 mL of a 1:500 dilution in blocking solution) and rabbit polyclonal anti-S100B (1:500) or rabbit polyclonal anti-HIF1&#945; (1:200) for 60 min at 37 &#176;C on a rocking shaker.</li>
	<li>Alternately, some astrocytes are incubated with rabbit polyclonal anti-IBA1 (1:200) and mouse monoclonal anti-MAP2 to access culture purity.</li>
	<li>Aspirate primary antibody and rinse coverslip by adding 1 mL of 0.1 M TBS and placing on a rocking shaker for 2 min and then aspirate. Repeat twice.</li>
	<li>Add 0.2 mL of a 1:200 dilution of the secondary goat anti-rabbit 488-conjugated and anti-mouse 568-conjugated antibodies in blocking solution for 60 min at 37 &#176;C on a rocking shaker.</li>
	<li>Aspirate secondary antibody and rinse coverslip by adding 1 mL of 0.1 M TBS and place on a rocking shaker for 2 min and then aspirate. Repeat twice.</li>
	<li>Remove coverslip from well and dry by placing on a slide positioned on a slide-drier. Mount coverslip on a new slide by inverting on a single drop of VECTASHIELD hardset mounting medium with DAPI (1.5 ng/&#956;L).</li>
	<li>Image coverslips on a confocal microscope using either 20X dry or 60X oil objective. Acquire images (512 x 512) for DAPI (405 nm ex / 450 nm em) and fluorochrome 488 tagged GFAP antibody (488 nm ex / 515 nm em). Keep acquisition parameters constant within the 20X and 60X groups.</li>
</ol>
4. Sex Determination Using PCR
<ol>
	<li>Heat pup toe or finger clippings at 95 &#176;C for 45 min in 50 mM NaOH and neutralize with equal volume of 1 M Tris, pH 6.8.</li>
	<li>Add 1 &#956;L of the extracted DNA solution to 19 &#956;L of the following mixture: 5 pmoles of primers for the Myog and Sry genes, 1x reaction buffer, 0.2 mM each deoxynucleotide and 8 U Taq polymerase.</li>
	<li>Use primers sequences; Sry 5&#39;TCATGAGACTGCCAACCACAG3&#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; and Myog 5&#39;TTACGTCCATCGTGGACAGC3&#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39;23.</li>
	<li>Perform the following PCR protocol: 95 &#176;C for 3 min then 30 cycles of denaturation at 95 &#176;C for 15 s, annealing at 58 &#176;C for 15 s, and elongation at 72 &#176;C for 1 min. Following this 30 cycles, the reaction concludes with a final 72 &#176;C elongation for 1 min.</li>
	<li>Separate PCR products electrophoretically on an ethidium bromide-containing 2% agarose gel and visualize under UV illumination. (Figure 2A.) CAUTION! Ethidium bromide is a potential carcinogen and must be handled carefully and disposed of properly as per institution&#39;s regulations.</li>
</ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

None of the authors have competing&#160;or conflicting interests.

In order to study the sex differences in the properties and function of astrocytes under physiological and pathological conditions, preparation of sexed primary astrocytes in cell culture is an important tool to utilize. In the present study we report a highly efficient and a reproducible method to culture a highly enriched homogeneous population of sexed hippocampal astrocytes from newborn (P0-P2) C57Bl/6 (wild type) or K19F (GFAP null) mouse pups in-vitro. Establishing this methodology helps the investigators understand the physiological and pathological functions of sexed hippocampal astrocytes after in-vitro ischemia.
There are two critical steps in establishing this methodology including the maintenance of sterility and adequate digestion of hippocampal lobes during trypsinization followed by trituration of the digested tissue in order to achieve the single cell suspension. Prevention of primary astrocytes from getting contaminated is one of the biggest challenges throughout the culture process. Bacterial and/or fungal are two common modes of contamination that can render the cultured cells useless if proper care is not adopted while performing the technique. Hence, in order to ensure experimental success, it is imperative to perform the process under a sterile work setting that includes, disinfecting the work place prior to use, using sterile surgical equipment and materials, avoid contact of sterile materials with nonsterile surfaces, using a laminar flow hood and avoid taking uncapped culture flasks out of the laminar hood. In addition, during enzymatic dissociation, longer incubation of hippocampal tissue with trypsin followed by extensive physical trituration can lead to its over-digestion resulting in poor cell viability and inefficient attachment of dissociated cells to culture flasks.
On the contrary, underdigestion of the brain tissue provides insufficient dissociation of glia cells thereby resulting in poor yield and seeding of cells as large clumps. Therefore, in order to obtain healthy astrocyte cultures, it is necessary to optimize trypsin concentration, incubation time and trituration to achieve optimum digestion of the hippocampal tissue. In our hands, incubation of hippocampal lobes with the working concentration of 0.25% trypsin for 20 min at RT followed by gentle trituration for 20 - 30 times yielded strong adherent, healthy and highly reproducible astrocyte cultures. Also, repeated freezing and thawing of reagents prior to use every time may reduce their effectiveness. Therefore, it is very important to aliquot reagents in small desirable quantities and freeze. For example, store trypsin, penicillin/streptomycin as 5 mL aliquots and fetal bovine serum as 50 mL aliquots in numerous sterile conical tubes at -20 &#176;C until use. We advise not to use antibiotics beyond the expiration date.
GFAP is a well-characterized marker of reactive fibrous astrocytes. Following OGD/REOX, upregulation of GFAP expression in response to reactive astrogliosis has been reported20. Although, it has been proposed that GFAP overexpression could be used as specific target for neuronal repair strategies27 its role in hippocampal damage after HI in neonates is still unclear. Immunohistochemical staining of astrocytes with GFAP enables us to identify and characterize these cells under the physiological and pathological conditions. GFAP staining like any other marker has some limitations that need to be recognized. One of the limitations of the GFAP staining of astrocytes is that not all the astrocytes express GFAP under physiological conditions. Especially the immature astrocyte expression rate of GFAP does not exceed 40% under physiological conditions28. Depending on the age- and type-specific use of astrocytes, other markers of choice can be considered such as GLAST, ALDH1L1, BLBP, Aquaporin-4 and S100B29.
Moreover, presence of NSCs&#160;disguised as astrocytes in the primary cultures cannot be ruled out. These NSCs have been shown to present phenotypical and ultrastructural characteristics similar to mature astrocytes including the expression of GFAP. Therefore, identification of molecular markers that are specific for fully differentiated and matured astrocytes is a must. Astrocytes were reported to expressed S100B at their later fully differentiated developmental stages. Recently, it has been reported that neonatal cortical GFAP+ astrocytes lose their progenitor stem cell potential with the onset of S100B expression that happen around DIV 15 26. Similarly, in our culture conditions at DIV 14, 91% of GFAP expressing cells were found to coexpress S100B, which suggest that the cultures consist of primarily terminally differentiated matured hippocampal astrocytes.
It is almost impossible to obtain pure primary hippocampal astrocyte cultures totally devoid of contaminating microglial cells that reside above and below the astrocyte monolayer. Therefore, it is important to know the proportion of contaminating microglia in astroglial cultures and also to keep this proportion as low as possible. In the present study we stained astrocyte cultures with microglia specific marker IBA1 or neuronal marker MAP2 in order to determine the presence of any microglia or neurons as potential contaminants. The proportion of microglia in rodent astrocyte culture may vary from 1% to 30% depending upon several factors that include animal age, species, region, culture medium, subculturing method and shaking30. In our cultures we observed approximately 6% of microglial contamination which is comparable with other reports25. If the intended use of the astrocyte culture is to study the role of hippocampal astrocytes in inflammation it is imperative to treat the cultures with 5 mM LME for 10 d to eliminate possible microglial contamination in the astrocyte cultures starting from DIV 3. LME is a microglial cytotoxic agent that has been used extensively as a method to remove proliferating microglia20,22. In addition, LME-treated cultures should be subjected to a shaking protocol (300 rpm for 1 h).
Another technical challenge in performing OGD/REOX is to determine if a sufficient degree of hypoxia has been achieved to induce astrogliosis. Markers for hypoxia in astrocytes include the up-regulation of GFAP and the induction of HIF-1&#945;. Thus, in this study hypoxia was confirmed by the increase in GFAP immunoreactivity (data not shown) and the upregulation of HIF1-&#945; staining (Figure 4).
In summary, the results obtained from sexed neonatal hippocampal astrocyte cultures showed successful cell attachment with healthy homogeneous astrocyte layer displaying typical morphology on coverslips and the expression of the major reactive astrocytic markers GFAP and S100B upon induction of in-vitro ischemia. We believe that the protocol adopted here has the potential to answer important mechanistic and translational questions pertaining to the role of astrocytes in developing male and female brains. The entire culturing procedure as opposed to the majority of existing techniques generates mature and confluent sexed hippocampal astrocytes in two weeks, granting a rapid turnaround of experiments and the simplicity of the technique will facilitate the use of astrocytic culturing method as a tool to study the sex specific role of glia cells in developing brain thereby allowing its wide dissemination in brain research.

Astrocytes are one of the most important key players in the central nervous system (CNS). Growing body of evidence indicates that the roles of astrocytes are more than providing&#160;neuronal support. In fact, the roles of astrocytes under physiological conditions can be very complex, such as guiding the migration of the developing axons1, regulating CNS blood flow2, maintaining the pH homeostasis of the synaptic interstitial fluid3, and participating in the blood brain barrier4 and synaptic transmission5. Under pathological conditions, astrocytes respond to injury with a process called reactive astrogliosis in which the morphology, number, location, topography (with respect to distance from insult) and function of the astrocytes may change in a heterogeneous way6,7. Astrogliosis seen following neonatal hypoxic ischemic encephalopathy maybe contributing to the morbidity and mortality of neonates8.
Recent clinical and experimental studies indicate that the severity of brain injury appears to be sex-dependent and that the male neonates are more susceptible to the effects of hypoxia/ischemia (HI)-related brain injury, resulting in more severe neurological outcomes as compared to females with comparable brain injuries9-11. Although the localization of the injury depends on the gestational age and the&#160;duration and the severity of the insult, hippocampus is one of the most commonly effected regions in the CNS after term neonatal HI,&#160;and increased hippocampal astrogliosis has been confirmed by up-regulation of the Glial Fibrillary Acidic Protein (GFAP) 3 d&#160;after the neonatal HI7,10,12,13. Sex differences in astrocyte function were shown in both neonates and adult rodents after cerebral ischemia14,15. In addition, male astrocytic susceptibility to in-vitro ischemia was shown by increased cell death compared to female cortical astrocytes in culture16.
Sex differences start in-utero and continue until death17. Over the last decade, the importance of including the sexes in experimental conditions in cell culture and in-vivo&#160;studies have been the emphasis of the Institute of Medicine and NIH to seek fundamental knowledge in the sex differences seen in physiological and pathological conditions17,18. Development of reliable methods to isolate and maintain populations of sexed hippocampal astrocytes is essential to understand the cellular basis of sex differences in the pathological consequences of neonatal HI. The present study was designed to provide the techniques to prepare enriched sex-specific hippocampal astrocyte cultures from newborn mice in order to assess the roles of GFAP-immunoreactive astrocytes following Oxygen/Glucose Deprivation (OGD) and reoxygenation (REOX),&#160;inducing&#160;HI in cell culture environment. This technique can be used to test any hypothesis pertaining to hippocampal astrocytes in neonatal males and females under normoxic and ischemic conditions.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Astrocyte culture media</td>
		</tr>
		<tr>
			<td>DMEM, high glucose</td>
			<td>cellgro</td>
			<td>10-013-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Horse serum</td>
			<td>Gibco</td>
			<td>26050-070</td>
			<td>Final Concentration: 10%</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin</td>
			<td>Cellgro&#160;</td>
			<td>30-002-CI</td>
			<td>Final Concentration: 1%</td>
		</tr>
		<tr>
			<td rowspan="2">L-Leucine methyl ester hydrochloride</td>
			<td rowspan="2">Aldrich</td>
			<td rowspan="2">L1002-25G</td>
			<td rowspan="2">Final Concentration: 5 mM</td>
		</tr>
		<tr>
		</tr>
		<tr>
			<td colspan="4">Solution for brain tissue digestion</td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>Life Technologies</td>
			<td>14170-088</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin</td>
			<td>cellgro</td>
			<td>25-050-CI</td>
			<td>Final Concentration: 0.25%</td>
		</tr>
		<tr>
			<td colspan="4">Other</td>
		</tr>
		<tr>
			<td>70% (vol/vol) ethanol</td>
			<td>Roth</td>
			<td>9065.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-D-Lysine 12mm round coverslips&#160;</td>
			<td>Corning</td>
			<td>354087</td>
			<td></td>
		</tr>
		<tr>
			<td>Water</td>
			<td>Sigma</td>
			<td>W3500</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>cellgro</td>
			<td>21-040-CV</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA&#160;</td>
			<td>Life Technologies</td>
			<td>25300-062</td>
			<td></td>
		</tr>
		<tr>
			<td>70 &#956;m Sterile cell strainer&#160;</td>
			<td>Fisher scientific</td>
			<td>22363548</td>
			<td></td>
		</tr>
		<tr>
			<td>3.5 cm petri dish</td>
			<td>BD Falcon</td>
			<td>353001</td>
			<td></td>
		</tr>
		<tr>
			<td>15 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352096</td>
			<td></td>
		</tr>
		<tr>
			<td>50 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352070</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps, fine&#160;</td>
			<td>Dumont</td>
			<td>2-1032; 2-1033</td>
			<td># 3c; # 5</td>
		</tr>
		<tr>
			<td>Forceps, flat tip</td>
			<td>KLS Martin</td>
			<td>12-120-11</td>
			<td></td>
		</tr>
		<tr>
			<td>13 cm surgical scissors</td>
			<td>Aesculap</td>
			<td>BC-140-R</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal Microscope</td>
			<td>Nikon</td>
			<td>A1RSi&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5805000.017</td>
			<td>Centrifuge5804R</td>
		</tr>
		<tr>
			<td>Orbital Shaker</td>
			<td>Thermo Scientific</td>
			<td>SHKE 4450-1CE</td>
			<td>MaxQ 4450&#160;</td>
		</tr>
		<tr>
			<td>Anti-IBA1</td>
			<td>Wako</td>
			<td>019-19741</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-MAP2</td>
			<td>Sigma</td>
			<td>M2320</td>
			<td>Mouse monoclonal</td>
		</tr>
		<tr>
			<td>Anti-HIF1alpha</td>
			<td>abcam</td>
			<td>ab179483</td>
			<td>rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-S100B</td>
			<td>Sigma</td>
			<td>HPA015768</td>
			<td>Rabbit polyclonal</td>
		</tr>
		<tr>
			<td>Anti-GFAP (cocktail)</td>
			<td>Biolegend</td>
			<td>837602</td>
			<td></td>
		</tr>
		<tr>
			<td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td>
			<td>Vector Labs</td>
			<td>PK-6101</td>
			<td>Contains 4 Reagents&#160;</td>
		</tr>
		<tr>
			<td>Goat Anti Rabbit Alexa-Fluor 488</td>
			<td>Invitrogen</td>
			<td>A11070</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat Anti Mouse Alexa-Fluor 568</td>
			<td>Invitrogen</td>
			<td>A11004</td>
			<td></td>
		</tr>
	</tbody>
</table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies indicate that the severity of brain injury appear to be sex dependent, and that the male neonates are more susceptible to the effects of HI-related brain injury, resulting in more severe neurological outcomes as compared to females with comparable brain injuries. The development of reliable methods to isolate and maintain highly enriched populations of sexed hippocampal astrocytes is essential to understand the cellular basis of sex differences in the pathological consequences of neonatal HI. In this study, we describe a method for creating sex specific hippocampal astrocyte cultures that are subjected to a model of in-vitro ischemia, oxygen-glucose deprivation, followed by reoxygenation. Subsequent reactive astrogliosis was examined by immunostaining for the Glial Fibrillary Acidic Protein (GFAP) and S100B. This method provides a useful tool to study the role of male and female hippocampal astrocytes following neonatal HI, separately.

Understanding the roles of sexed astrocyte functions under physiologic or pathophysiological conditions have been immensely elucidated by culturing these cells under in vitro conditions. The important aspect of performing sexed culturing is to determine the sex of the mouse pup prior to its use. We determined the sex of the mouse genetically by PCR and by visual assessment (Figure 2)16. The methodology of sex determination using PCR was adopted with modifications from McClive and Sinclair, is quick, simple, and highly reproducible method23. Figure 2A&#160;shows the representative results of sex determination using PCR. PCR products were generated with DNA extracted from two representative P1 male and female tail snips. The reaction includes multiplexed primer pairs for Sry and Myog genes that generate male specific bands of 441 bp and female specific bands of 245 bp, respectively. Visual determination of neonatal (P 1 - 3) mouse sex with naked eye was established by looking for the presence of small darkened spot between anogenital openings only in males (Figure 2B)16,24.
Although, culturing of astrocytes is convenient and relatively easy to establish under laboratory set up, this advantage can be hindered by its contamination primarily with microglia or neurons to a lesser extent. Contamination of the astrocytes can be easily determined by immunolabeling of the cultured cells with cell specific markers for either microglia (IBA1) or neurons (MAP2). In the present study, hippocampal astrocytes growing in primary monolayer cultures were observed to have ~6% of contaminating microglia at DIV 14, as suggested by a few cells that expressed IBA1 (Figure 3). On the contrary, none of the cells were found to express MAP2 suggesting the culture was totally devoid of any neuronal contamination (Figure 3). The minor microglial contamination observed in our cultures is in accordance with other reports, wherein the authors reported a 5% microglial contamination in their primary cortical astrocyte cultures derived from 1 - 3-day-old mouse pups25. Astrocytes possess a specific cytoarchitecture that allow them to respond to changes in their microenvironment including hypoxia. In order to determine any sex specific astrocytic response to in-vitro ischemia, we subjected sexed hippocampal astrocytes to OGD/REOX. Successful induction of OGD/REOX was determined by the increased nuclear expression of hypoxia inducible factor 1 alpha (HIF1&#945; observed in GFAP+ astrocytes subjected to 2 h OGD followed by 5 h REOX as compared to the HIF1&#945; expressions in cells under normoxic conditions (Figure 4).
Immunocytochemical staining of sexed hippocampal cultured astrocytes with GFAP or S100B (mature astrocyte marker) resulted in a highly selective and reproducible staining pattern (Figure 5). GFAP and S100B were colocalized in the cytoplasm and cell bodies of astrocytes, characterizing a matured astrocytic developmental stage where these cells tend to lose their Neural Stem Cell (NSC) potential 26. The morphology and density of GFAP or S100B immunoreactivities were similar in both male and female astrocyte cultures as observed in their respective normoxic and OGD/REOX treatment groups. Under normoxic conditions, hippocampal astrocytes presented a polygonal to fusiform and flat morphology [Figure 5A, B (normoxia 60X; arrow)], as evaluated using confocal microscopy. These cells were able to divide until confluent for approximately 2 weeks prior to the induction of OGD/REOX. After 2 h OGD and 5 h REOX, astrocytes exhibited classical reactive astrocyte morphology displaying retracted primary processes, hypertrophy of the soma and processes, and increased expression of GFAP or S100B [Figure 5A, B&#160;(OGD/REOX, 60X; arrowhead)]. Following the OGD/REOX, the GFAP/S100B staining also exhibited an extensive meshwork extending across the cytoplasm in both the male and female hippocampal astrocytes. Lack of GFAP staining observed in the cultured hippocampal astrocytes from GFAP null mice served as a negative control (Figure 5B, inset). The above results provide direct evidence that the morphology of GFAP/S100B-immunoreactive astrocytes undergoes significant changes when subjected to OGD-REOX.
<img alt="Figure 1" src="/files/ftp_upload/53695/53695fig1.jpg" /> 
Figure 1. Illustrations of the Hippocampal Removal Technique from P1 Mice. 1. Decapitate pup to remove the head. 2, 3. Using fine scissors, make a midline incision of the skin, posterior to anterior, and peel back the skin with the help of a flat-tip forceps. 4, 5, 6. Make a small incision at the base of the skull. Cut the skull along the midline and peel away two halves to expose the brain. 7, 8. Remove cerebellum with the help of a curved forceps. 9. Carefully remove brain from the cranium and place into a sterile Petri dish. 10, 11. Flip the brain so that the ventral surface of the brain is facing up using a curved forceps, then separate both hemispheres with a sharp sterile surgical blade. 12, 13, 14. Remove the bulging midbrain and thalamic tissue leaving the intact underlying hemisphere and revealing the hippocampus. 15, 16. Remove the hippocampus (small C-shaped structure). 17, 18. Immediately place the hippocampal lobes obtained from both of the hemispheres in a separate Petri dish containing sterile HBSS. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53695/53695fig2.jpg" /> 
Figure 2. Sex Determination of Neonatal Mice. A. Mouse sex was genetically determined by PCR with primers specific to the Myog (X chromosome) and Sry (Y chromosome) genes using DNA extracted from finger or toe clippings (F1; M1). The bands of PCR were visualized on a 2% agarose gel with Ethidium Bromide under UV illumination. F2 and M2 served as positive controls for female and male, respectively. B. Visual determination of male from female was established by identifying a darkened spot between the anogenital openings (arrow). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53695/53695fig3.jpg" /> 
Figure 3. Purity of the Primary Mouse Hippocampal Astrocyte Culture. Immunostaining of astrocyte culture with neuronal marker MAP2 (red) and microglia marker IBA1 (green). Nuclei are stained with 4&#39;,6&#39;-diamidino-2-phenylindole (DAPI) (blue). Arrow indicates microglia contamination. Scale bar: 50 &#956;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53695/53695fig4.jpg" /> 
Figure 4. HIF1&#945; Expression Was Increased in Cultured Hippocampal Astrocytes Exposed to OGD/REOX. Representative immunofluorescent images showing GFAP (red) and HIF1&#945; (green) labeling in astrocytes subjected to (A) normoxia or (B) OGD (2 h)/REOX (5 h). Nuclei are stained with 4&#39;,6&#39;-diamidino-2-phenylindole (DAPI) (blue). Arrow, low HIF1&#945; expression; arrowhead, elevated HIF1&#945; nuclear expression. Scale bar: 25 &#956;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53695/53695fig5.jpg" /> 
Figure 5. Up-regulation of S100B or GFAP Expression in Sexed Hippocampal Astrocyte Cultures following OGD-REOX. Sexed cultured hippocampal astrocytes were stained for S110b or GFAP expression under normoxic conditions or after 2 h OGD followed by 5 h of REOX (OGD/REOX). Inset: 60X image from hippocampal astrocytes cultured from GFAP null mice. Scale bar: 30 &#956;m.

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrocytes are one of the most important key players in the central nervous system (CNS). Here, we are reporting a practical method of sexed hippocampal astrocyte culture protocol in order to study the mechanisms underlying the astrocyte function in male and female neonate pups after in-vitro ischemia.

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Nanyang Technological University

Research

JoVE Journal

Neuroscience

13.3K Views.  University of Wisconsin. Astrocytes are one of the most important key players in the central nervous system (CNS). Here, we are reporting a practical method of sexed hippocampal astrocyte culture protocol in order to study the mechanisms underlying the astrocyte function in male and female neonate pups after in-vitro ischemia.

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Fluorescence Recovery After Photobleaching (FRAP) of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached in the region of interest. The fluorescence of the region recovers when the unbleached GFP-tagged protein from outside of the region diffuses into the region of interest. The mobility of the protein is then analyzed by measuring the fluorescence recovery rate. This technique could be used to characterize protein mobility and turnover rate.
In this study, we express the (enhanced green fluorescent protein) EGFP vector in cultured hippocampal neurons. Using the Zeiss 710 confocal microscope, we photobleach the fluorescence signal of the GFP protein in a single spine, and then take time lapse images to record the fluorescence recovery after photobleaching. Finally, we estimate the percentage of mobile and immobile fractions of the GFP in spines, by analyzing the imaging data using ImageJ and Graphpad softwares.
This FRAP protocol shows how to perform a basic FRAP experiment as well as how to analyze the data.

Fluorescence Recovery After Photobleaching FRAP of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of Green Fluorescence Protein (GFP)-tagged proteins in cultured cells. We examined the mobile/immobile fractions of the GFP by analyzing the fluorescence recovery percentage after photobleaching. In this study, FRAP was performed at spines of hippocampal neurons.

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached ...

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease pathogenesis and their utility for preclinical drug development. In order to design a better model system for these applications, phenotypically wild-type cortical astrocytes and neural stem cells (NSC) from conditional, genetically engineered mice (GEM) that harbor various combinations of floxed oncogenic alleles were harvested and grown in culture. Genetic recombination was induced in vitro using adenoviral Cre-mediated recombination, resulting in expression of mutated oncogenes and deletion of tumor suppressor genes. The phenotypic consequences of these mutations were defined by measuring proliferation, transformation, and drug response in vitro. Orthotopic allograft models, whereby transformed cells are stereotactically injected into the brains of immune-competent, syngeneic littermates, were developed to define the role of oncogenic mutations and cell type on tumorigenesis in vivo. Unlike most established human glioblastoma cell line xenografts, injection of transformed GEM-derived cortical astrocytes into the brains of immune-competent littermates produced astrocytomas, including the most aggressive subtype, glioblastoma, that recapitulated the histopathological hallmarks of human astrocytomas, including diffuse invasion of normal brain parenchyma. Bioluminescence imaging of orthotopic allografts from transformed astrocytes engineered to express luciferase was utilized to monitor in vivo tumor growth over time. Thus, astrocytoma models using astrocytes and NSC harvested from GEM with conditional oncogenic alleles provide an integrated system to study the genetics and cell biology of astrocytoma pathogenesis in vitro and in vivo and may be useful in preclinical drug development for these devastating diseases.

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Phenotypically wild-type astrocytes and neural stem cells harvested from mice engineered with floxed, conditional oncogenic alleles and transformed via viral Cre-mediated recombination can be used to model astrocytoma pathogenesis in vitro and in vivo by orthotopic injection of transformed cells into brains of syngeneic, immune-competent littermates.

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease ...

Immunohistochemical Visualization of Hippocampal Neuron Activity After Spatial Learning in a Mouse Model of Neurodevelopmental Disorders

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we describe a pERK immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. Specifically, we used pERK immunostaining to study neuronal activation following Morris water maze (MWM, a classical hippocampal-dependent learning task) in Engrailed-2 knockout (En2-/-) mice, a model of autism spectrum disorders (ASD). As compared to wild-type (WT) controls, En2-/- mice showed significant spatial learning deficits in the MWM. After MWM, significant differences in the number of pERK-positive neurons were detected in specific hippocampal subfields of En2-/- mice, as compared to WT animals. Thus, our protocol can robustly detect differences in pERK-positive neurons associated to hippocampal-dependent learning impairment in a mouse model of ASD. More generally, our protocol can be applied to investigate the profile of hippocampal neuron activation in both genetic or pharmacological mouse models characterized by cognitive deficits.

We describe an immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. This protocol can be applied to both genetic or pharmacological mouse models characterized by cognitive deficits.

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we ...

Protocol for Three-dimensional Confocal Morphometric Analysis of Astrocytes

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify their functional and structural properties, a condition called reactive astrogliosis. Here, a protocol for assessment of the morphological properties of astrocytes is presented. This protocol includes quantification of 12 different parameters i.e. the surface area and volume of the tissue covered by an astrocyte (astrocyte territory), the entire astrocyte including branches, cell body, and nucleus, as well as total length and number of branches, the intensity of fluorescence immunoreactivity of antibodies used for astrocyte detection, and astrocyte density (number/1,000 &#181;m2). For this purpose three-dimensional (3D) confocal microscopic images were created, and 3D image analysis software such as Volocity 6.3 was used for measurements. Rat brain tissue exposed to amyloid beta1-40 (A&#946;1-40) with or without a therapeutic&#160;intervention was used to present the method. This protocol can also be used for 3D morphometric analysis of other cells from either in vivo or in vitro conditions.

Astrocytes in the CNS change their functional and structural properties in response to harmful stimuli. This report presents a protocol for assessment of three-dimensional astrocyte morphology in diseased conditions or after therapeutic interventions.

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify ...

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent improvements in methodologies and applications for the study of theta oscillations. A simple characterization of the isolated hippocampal preparation is presented whereby the relationship between internal hippocampal theta oscillators is examined together with the activity of pyramidal cells, and GABAergic interneurons, of the cornu ammonis-1 (CA1) and subiculum (SUB) areas. Overall, we show that the isolated hippocampus is capable of generating intrinsic theta oscillations in vitro and that rhythmicity generated within the hippocampus can be precisely manipulated by optogenetic stimulation of parvalbumin-positive (PV) interneurons. The in vitro isolated hippocampal preparation offers a unique opportunity to use simultaneous field and intracellular patch-clamp recordings from visually-identified neurons to better understand the mechanisms underlying theta rhythm generation.

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

Here, we present a protocol for recording rhythmic neuronal network theta and gamma oscillations from an isolated whole hippocampal preparation. We describe the experimental steps from extraction of the hippocampus to details of field, unitary and whole-cell patch clamp recordings as well as optogenetic pacing of the theta rhythm.

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent ...

In Utero Electroporation of Multiaddressable Genome-Integrating Color (MAGIC) Markers to Individualize Cortical Mouse Astrocytes

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at adult stages. Thus far, no immunostaining strategy can single them out and segment their morphology in mature animals and over the course of corticogenesis. Cortical PrA originate from progenitors located in the dorsal pallium and can easily be targeted using in utero electroporation of integrative vectors. A protocol is presented here to label these cells with the multiaddressable genome-integrating color (MAGIC) Markers strategy, which relies on piggyBac/Tol2 transposition and Cre/lox recombination to stochastically express distinct fluorescent proteins (blue, cyan, yellow, and red) addressed to specific subcellular compartments. This multicolor fate mapping strategy enables to mark in situ nearby cortical progenitors with combinations of color markers prior to the start of gliogenesis and to track their descendants, including astrocytes, from embryonic to adult stages at the individual cell level. Semi-sparse labeling achieved by adjusting the concentration of electroporated vectors and color contrasts provided by the Multiaddressable Genome-Integrating Color Markers (MAGIC Markers or MM) enable to individualize astrocytes and single out their territory and complex morphology despite their dense anatomical arrangement. Presented here is a comprehensive experimental workflow including the details of the electroporation procedure, multichannel image stacks acquisition by confocal microscopy, and computer-assisted three-dimensional segmentation that will enable the experimenter to assess individual PrA volume and morphology. In summary, electroporation of MAGIC Markers provides a convenient method to individually label numerous astrocytes and gain access to their anatomical features at different developmental stages. This technique will be useful to analyze cortical astrocyte morphological properties in various mouse models without resorting to complex crosses with transgenic reporter lines.

In Utero Electroporation of Multiaddressable Genome-Integrating Color MAGIC Markers to Individualize Cortical Mouse Astrocytes

Astrocytes tile the cerebral cortex uniformly, making the analysis of their complex morphology challenging at the cellular level. The protocol provided here uses multicolor labeling based on in utero electroporation to single out cortical astrocytes and analyze their volume and morphology with a user-friendly image analysis pipeline.

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at ...

Neuronal Differentiation from Mouse Embryonic Stem Cells In vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and potentially aid in regenerative medicine. Here, we established an efficient and low cost method for neuronal differentiation from mESCs in vitro, using the strategy of combinatorial screening. Under the conditions defined here, the 2-day embryoid body formation + 6-day retinoic acid induction protocol permits fast and efficient differentiation from mESCs into neural precursor cells (NPCs), as seen by the formation of well-stacked and neurite-like A2lox and 129 derivatives that are Nestin positive. The healthy state of embryoid bodies and the timepoint at which retinoic acid (RA) is applied, as well as the RA concentrations, are critical in the process. In the subsequent differentiation from NPCs into neurons, N2B27 medium II (supplemented by Neurobasal medium) could better support the long term maintenance and maturation of neuronal cells. The presented method is highly efficiency, low cost and easy to operate, and can be a powerful tool for neurobiology and developmental biology research.

Here, we established a low cost and easy to operate method that directs fast and efficient differentiation from embryonic stem cells into neurons. This method is suitable for popularization among laboratories and can be a useful tool for neurological research.

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and ...