Name: sex differences in mouse hippocampal astrocytes after in-vitro ischemia
Uploaded: 2016-10-25T12:30:00.000+00:00
Duration: 8 min 32 s
Description: Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

참고 :이 연구는 국립 보건 연구소의 실험 동물의 관리를위한 가이드의 추천 및 사용에 따라 실시 하였다. 동물 프로토콜은 위스콘신 - 매디슨, 기관 동물 관리 및 사용위원회의 대학에 의해 승인되었다. 여기에 제시되는 기본 성상 세포 배양 프로토콜은 장 Y (19) 등. 그리고 젠 기스 20 쪽 등에 의해 제시된 프로토콜에서 채택된다. 일부의 수정. 1. 해마 해부 및 성상 세포 문화 <ol><li> 2 mL의 행크의 균형 소금 솔루션 (HBSS) 각 가득 얼음에 수술 가위, 부드러운 미세 집게, 플랫 팁 집게, 종이 수건, 쓰레기 봉투, 70 % 에탄올, 2 해부 요리 (3.5 cm 직경)를 포함하여 필요한 모든 시약 및 재료를 준비합니다 . 있는지 확인 수술 장비의이다 (오토 클레이브) 이전 절차와 성상 세포 배지 도금 (다른 모든 재료를 사용하여 멸균 : DMEM + 5 % 말 혈청 +1 % 사전 멸균 등의 페니실린 - 스트렙토 마이신, 말 혈청, HBSS, 0.25 % 트립신, 커버 글라스, 페트리 접시, 50분의 15 ML의 튜브, T25 플라스크 등). </li><li> 부드럽게 유지하고 70 % 에탄올로 머리와 마우스 강아지의 목 스프레이 날카로운 멸균 가위를 사용하여 목을 벨 [그림 1 (1)]. </li><li> 뇌 [그림 1 (2-3)] 노출 두피를 따라 작은 가위로 머리를 전방에 후방에서 중간 선 절개를 수행합니다. </li><li> 작은 가위로 코 목에서 조심스럽게 두개골을 잘라. 그런 두개골베이스에서 두개골을 분리하는 소뇌에 두개골 후각 전구에 앞쪽과 열등를 잘라. </li><li> 두개골의 바닥에 작은 절개를 확인하고 중간 선을 따라 절단. 두개골을 벗겨 멸균 평면 팁 집게를 사용합니다. 곡선 집게의 도움으로 뇌 줄기를 제거합니다. 두개골에서 뇌를 제거하고 첫 해부 접시에 배치 [그림 1 (4-9)] (2)1. </li><li> 곡선 집게를 사용하면, 뇌의 복부면이 위를 향하도록 뇌를 반전하고 날카로운 멸균 수술 블레이드 [그림 1 (10, 11)]와 두 반구를 분리 </li><li> 껍질 다시 대뇌 반구 조심스럽게 해마, 내측 측두엽 [그림 1 (12 ~ 14)]에있는 작은, 해마 모양의 구조를 나타 내기 위해 멸균 평면 곡선 집게로 돌출 중뇌와 시상 조직을 제거합니다. </li><li> 모두 해마 로브 [그림 1 (15, 16)]를 제거하고주의 깊게 미세 집게로 잡아 당겨 로브에서 수막을 해부하다. 이 단계는 수막 세포와 섬유 아세포에 의해 최종 성상 세포 문화의 오염을 방지 할 수 있습니다. </li><li> HBSS로 채워진 두 번째 접시에 준비된 해마 로브를 전송하고 얼음 [그림 1 (17, 18)]에 반환. 하마의 준비를위한 - 한 번의 마우스에서 풀을 모두 해마 로브 (P2 P0)campal의 성상 세포 배양. 이 성상 세포 적절한 밀도를 제공한다. 날카로운 멸균 수술 블레이드 (약 4 시간)을 사용하여 해마 로브를 말하다. </li><li> 대기음 HBSS 15 mL의 멸균 원뿔 튜브로 전송하고 부드러운 흔들림과 함께 20 분 동안 37 ° C에서 조직을 품어, 혼합, 접시에서 1 mL를 피펫에 부착 된 멸균 팁을 사용하고 0.25 % 트립신의 3 mL를 넣고. </li><li> 5 분 300 XG에 원심 분리기 튜브. 대기음 상등액을 조심스럽게 진공 라인에 연결된 멸균 유리 피펫을 사용. (- 30 ~ 20 배) 조직 조각 균질화 될 때까지 화재 광택 유리 피펫을 사용하여 매체와 씹다 도금 10 ML의 성상 세포를 추가합니다. </li><li> 5 분 300 XG에 원심 분리기 튜브. 기음 뜨는 및 신선한 데워진 성상 세포 도금 미디어의 2 mL를 넣어. 새로운 50 ML 원뿔 튜브에 70 μm의 메쉬 필터 (셀 스트레이너)를 통해 세포를 전달합니다. </li><li> 3 mL를 함유하는 폴리 D 라이신 / 라미닌 코팅 멸균 T25 플라스크 배양 접시 전체 세포 현탁액성상 미디어 도금 후, 5 % CO 2 인큐베이터에서 37 ° C로 플라스크를 배양한다. </li><li> 기념일에 기음 전체 미디어 내가 N-시험 관내 (DIV) 1, DIV 3 DIV 7, 신선한 성상 세포 도금 미디어의 2 mL로 교체합니다. 성상 세포 도금 미디어를 교체하는 동안 광학 현미경마다 진행 및 성상 세포 합류를 관찰한다. 참고 : DIV 1에서 모든 가능한 성상 세포는 배양 플라스크의 표면과 신경 세포가 뜨는에 떠있다 포함 죽었거나 죽어가는 세포에 부착된다. DIV 3에서, 부착 된 세포는 성상 세포 층을 형성하도록 분할하는 시작한다. 지지 기대 조건이없는 경우, 배양은 신경 세포의 성장이 거의없는 상태이다. 90 % 합류 몇 미세 아교 세포뿐만 아니라 희소 돌기 아교 세포 전구체 셀 성상 층의 상부에 존재 - DIV 7에서 성상 세포 층은 80이다. </li><li> 린스, 플라스크에서 도금 매체를 대기음 신선한 데워진 성상 세포 도금 배지 2 ㎖를 추가성상 세포가 합류하고 배양을 서브 할 준비가되면 차, DIV (11)에 다시 제거합니다. </li><li> 조심스럽게 플라스크를 몇 번 회전 흡인 트립신은 멸균 유리 피펫을 사용하여, 0.25 % 트립신의 2 ML을 추가합니다. </li><li> 0.25 % 트립신 2 mL를 넣고 플라스크 4의 조직 문화 후드에 앉아 보자 - RT에서 5 분. </li><li> 트립신을 제거하고 10 분 동안 5 % CO 2 인큐베이터에서 37 ° C로 플라스크를 유지한다. 5 ㎖ 중간 도금 성상 세포를 데워진 추가하고 당신의 손의 손바닥에 플라스크를 터치하여 성상 세포 층을 분리 - 완전한 분리를 달성하고 15 ML 원뿔 튜브의 성상 세포를 수집하기 위해 부드러운 저작하여 (3 ~ 4 회). </li><li> 원심 분리기 튜브는 5 분 300 XG에, 뜨는을 대기음, 1 mL의 신선한 성상 세포 도금 매체를 추가 할 수 있습니다. </li><li> 혈구에 세포 현탁액 10 μL를 추가하고 역 위상차 현미경 (10X 대물 렌즈)를 사용하여 대형 중앙 리딩 된 영역 (1 ㎜ × 2)의 세포 수를 계산. 도난tiply 104 mL로하여 당 세포의 수를 추정한다. 하나 T25 플라스크 ~ 1 × 106 총 해리 세포를 얻을 것입니다. 씨 ~ 1 × 24 웰 배양 접시의 우물에서 12mm 직경 폴리 - D - 라이신 예비 코팅 유리 커버 슬립 2 ML의 성상 세포 도금 배지에서 5 세포. </li><li> 5 % CO 2 인큐베이터에서 37 ℃에서 인큐베이션. 14 (2 절) - DIV 12 OGD / REOX을 수행합니다. </li><li> 미세 아교 세포없는 해마 문화가 원하는 경우 DIV (11)까지 5 MM의 L - 류신 메틸 에스테르 (LME) 하이드로 클로라이드와 DIV 3에서 성상 세포 배양을 취급합니다. LME 배양 한 후, (1 시간 동안 300 rpm으로)을 흔들어에 따라 문화 미세 아교 세포를 오염 제거합니다. 주 : LME는 미세 아교 세포 (22) 증식 제거하는 방법으로 광범위하게 사용 된 소교 세포 독성 제입니다. </li></ol> 2. OGD / REOX 치료 <ol><li> 대기음 부착 성상 세포 배양을 포함하는 커버 슬립의 미디어 (DIV 12-14)와 린스 3 회부드럽게 커버 슬립을 (MM에) 포함 1 mL의 등장 OGD 용액 (pH를 7.4)와 몇 번 잡고 24 웰 배양 접시 돌려 : 0 포도당을, 21의 NaHCO3, 120 염화나트륨, 5.36의 KCl, 0.33 나 2 HPO 4, 0.44 KH 2 PO 4, 1.27 염화칼슘 2, 0.81 황산. </li><li> CO 2 커버 슬립 커버 및 94 % N 2, 1 % O 2를 함유하는 저산소 배양기에서 2 시간 동안 배양하고, 5 % 웰에 0.2 ㎖의 OGD 용액을 추가한다. 부드럽게 가스 교환을 촉진하기 저산소증의 처음 30 분 동안 진탕 기 (50 RPM)로 혼합한다. </li><li> 5.5 mM의 포도당을 첨가 제외한 OGD 용액을 동일한 완충액에서 5 % CO 2 및 대기압에서 2 시간 동안 정상 산소의 대조군 세포를 인큐베이션. </li><li> 및 REOX, 흡인 OGD 솔루션의 매체를 도금 성상 세포의 2 mL를 넣어. 5 시간 동안 37 ℃에서 5 % CO 2 대기에서 인큐베이션. </li></ol> 3. 면역 세포 화학 염색법 &lt;/ P&gt; <ol><li> 진공 라인에 연결된 멸균 유리 피펫을 사용하여 배양 배지를 흡인하고 신속 0.1 M 트리스 완충액 (TBS) 1ml를 추가하여 커버 슬립을 한번 씻어 (154 mM의 염화나트륨, 16 mM의 후, Trizma 자료, 84 mM 트리스 - 염산, pH 7.4의) 잘합니다. 대기음 1X 인산 완충 생리 식염수 (PBS) 중 4 % 파라 포름 알데히드 (PFA) 2 mL를 넣고. 실온에서 15 분 동안 품어. </li><li> 대기음 및 0.1 M TBS의 1 mL를 넣고는, 다음 2 분 동안 흔들 통에 넣습니다. 3 번 반복합니다. 용액 (10 % 염소 혈청, 0.1 M TBS에서 10 ㎎ / ㎖ BSA, 0.025 % 트리톤 X-100)를 차단 한 ML을 추가하고 흔들 통에 37 ° C에서 30 분 동안 품어. </li><li> 대기음이 솔루션을 차단하고 기본 마우스 단일 클론 항 GFAP 항체 추가 60 분 : 안티 - HIF1α (200 1) 또는 토끼 폴리 클로 날 (1 0.2 mL의 : 차단 솔루션에 500 희석)와 토끼 다 클론 항 S100B (500 1) 흔들 통에 37 ° C에서. </li><li> 마우스 월 : 대안 적으로, 일부 성상은 토끼 다 클론 안티 IBA1 (200 1)와 인큐베이션oclonal 방지 MAP2 문화의 순도에 액세스 할 수 있습니다. </li><li> 대기음 차 항체 0.1 M TBS 1 ㎖를 추가하고 2 분 후 흡인을위한 흔들 통에 넣어 coverslip에 린스. 두 번 반복합니다. </li><li> 흔들 통에 37 ° C에서 60 분 동안 차단 솔루션에 보조 염소 항 - 토끼 488 - 복합 및 항 - 마우스 568 - 복합 항체의 200 희석 : 1의 0.2 ML을 추가합니다. </li><li> 대기음 차 항체와 2 분 후 흡인을위한 흔들 통에 0.1 M TBS 1 ㎖를 추가하고 장소로 coverslip에 린스. 두 번 반복합니다. </li><li> 슬라이드 건조기에 위치 슬라이드에 배치하여 잘 건조에서 커버 슬립을 제거합니다. VECTASHIELD의 한 방울에 반전하여 새 슬라이드 마운트 커버 슬립은 DAPI (1.5 NG / μL)를 설치 매체를 hardset. </li><li> 하나 20X 건조 또는 60X 오일 목표를 사용하여 공 초점 현미경에 이미지 된 커버. DAPI (405 나노 예 / 450 나노 미터 EM) 및 형광 색소 488에 대한 이미지 (X 512 512)를 취득는 GFAP 항체 태그 (488 나노 예 / 515 nm의여자 이름). 20X 및 60X 그룹 내에서 일정한 획득 매개 변수를 유지합니다. </li></ol> PCR을 사용하여 4 성 결정 <ol><li> 열 강아지 발가락 또는 50 mM의 NaOH를 45 분 동안 95 ° C에서 손가락 스크랩와 1 M 트리스, 산도 6.8의 동일한 볼륨으로 중화. </li><li> Myog 및 SRY 유전자에 대한 프라이머의 5 pmole의, 1 배 반응 완충액, 0.2 mM의 각각의 데 옥시 뉴클레오티드와 8 U Taq 중합 효소 : 다음 혼합물의 19 μL에 추출 된 DNA 용액 1 μL를 추가합니다. </li><li> 프라이머 시퀀스를 사용하여; SRY 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39;와 Myog 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39;23. </li><li> 1 분 동안 72 ° C에서 15 초 동안 58 ° C에서 15 초, 어닐링 95 ℃에서 3 분 동안 변성 한 후 30 사이클을 95 ° C, 신도 다음 PCR 프로토콜을 수행한다. 이 30 사이클 후, 반응물을 1 분 동안 최종 72 ° C의 신장율로 종결. </li><li> 별도의 PCR 제품은 전기 영동에 티듐 브로마이드 함유의 2 % 아가로 오스 겔상에서와 UV 조명 하에서 가시화. (그림 2A.)주의! 에티 디움 브로마이드는 잠재적 인 발암 물질이며주의 깊게 취급 기관의 규정에 따라 적절하게 폐기해야합니다. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

저자의 아무도는 경쟁하거나 충돌하는 이해했다.

생리적 및 병리 적 조건에서 아스트로 성 특성의 차이 및 기능을 연구하기 위해, 세포 배양에서 거세 일차 성상의 제조 활용하는 중요한 도구이다. 본 연구에서 우리는 체외 신생아에서 성별화 된 해마 성상 세포의 고농축 균질 인구 (P0-P2) C57BL / 6 (야생형) 또는 K19F (GFAP 널) 마우스 새끼 고효율과 문화에 재현 방법을보고합니다. 이 방법을 설정하면 연구자는 시험관 허혈 후 성별화 된 해마 성상 세포의 생리 학적 및 병리학 적 기능을 이해하는 데 도움이됩니다. 단일 세포 현탁액을 달성하기 위해서는 소화 조직 저작하여 트립신 동안 멸균 및 해마 로브 적절한 소화의 유지를 포함하여이 방법을 설정하는 두 개의 중요한 단계가있다. 에서 차 성상 교세포의 예방오염 점점 배양 과정 전반에 걸쳐 가장 큰 도전 중 하나입니다. 적절한 치료를 채용하지 않은 경우 기술을 수행하는 동안 배양 세포 쓸모 렌더링 할 수있는 오염 물질의 두 가지 일반적인 형태는 세균 및 / 또는 균류이다. 따라서, 실험적인 성공을 보장하기 위해서는,을 사용 전에 무균 수술 장비 및 재료를 사용하여, 사용하는 작업장 소독 포함 무균 작업 환경 하에서 처리를 행하는 비 멸균 표면 살균 물질의 접촉을 방지하기 위해 필수적이다 층류 후드는 층류 후드에서 상한선 배양 플라스크를 복용하지 않도록합니다. 또한, 효소 분해 동안 광범위한 물리적 저작하여 트립신과 해마 조직의 이상 배양은 가난한 세포 생존 및 배양 플라스크에 해리 세포의 비효율적 첨부의 결과는 오버 소화 될 수 있습니다. 반대로, 뇌 조직 underdigestion 불충분 제공이에 의해 불량한 수율 및 큰 덩어리로서 세포의 파종 결과 신경교 세포의 분리. 따라서, 건강 성상 세포 배양 물을 얻기 위해서는, 해마 조직 최적 소화를 달성하기 위해 트립신 농도, 인큐베이션 시간, 분쇄를 최적화 할 필요가있다. 우리의 손에, 20 부드러운 분쇄 한 다음 실온에서 20 분 동안 0.25 % 트립신의 작용 농도 해마 로브의 배양 - 30 배 강한 접착, 건강하고 재현성이 높은 성상 세포 배양을 얻었다. 또한, 냉동 제품의 효과를 감소시킬 때마다, 사용 전에 시약의 해동을 반복했다. 따라서 작은 것이 바람직 수량 및 동결에 나누어지는 시약에 매우 중요합니다. 예를 들어, 사용할 때까지 -20 ℃에서 다양한 멸균 원추형 튜브에 50 ㎖ 분취 량으로서 5 ㎖ 씩 태아 소 혈청 등의 점포 트립신, 페니실린 / 스트렙토 마이신. 우리는 만료일 이상의 항생제를 사용하지 부탁. GFAP는 아입니다반응성 섬유 성상 세포의 마커를 ELL-특징. 다음 OGD / REOX, 반응 astrogliosis의 질문에 답변 GFAP 발현의 상향 조절 (20)를보고되었다. 이 GFAP 과발현은 신생아 HI 후 신경 복구 전략에 대한 특정 대상으로 해마 손상 27의 역할에 사용될 수 있음이 제안되었다 비록 여전히 불분명하다. GFAP와 성상 세포의 면역 조직 화학 염색은 생리 학적 및 병리학 적 조건 하에서이 세포를 식별하고 특성화하기 위해 우리를 할 수 있습니다. 다른 마커 같은 GFAP 염색 인식해야 할 몇 가지 제한 사항이 있습니다. 성상 세포의 GFAP 염색의 한계 중 하나는 모든 아스트로 생리적 조건 하에서 GFAP를 표현한다는 것이다. 특히 GFAP의 미성숙 성상 발현율은 생리 학적 조건 하에서 (28)의 40 %를 초과하지 않는다. 성상 세포의 연령 및 유형 특정 용도에 따라, 다른 선택 마커 등 GLAST, ALD로 간주 될 수있다H1L1, BLBP, 아쿠아 포린-4 및 S100B 29. 차 문화 성상 세포는 배제 할 수 없다 더욱이, NSCs의 존재는 위장. 이러한 NSCs의은 GFAP 발현 포함한 아스트로 성숙 유사한 표현형 및 미세 구조 특성을 제공하는 것으로 나타났다. 따라서, 완전히 차별화되고 성숙 된 성상 세포에 대한 특정 분자 마커의 식별은 필수입니다. 성상 세포들은 나중에 완전히 차별화 된 발달 단계에서 표현 S100B에보고되었다. 최근에,이 신생 피질 GFAP + 아스트로 주위 DIV 15 26 일 S100B 발현 개시 그들의 선조 줄기 세포 잠재력을 잃게보고되어있다. 마찬가지로, DIV 14에서 우리의 배양 조건에서, GFAP 발현 세포의 91 %가 나타났다 문화는 주로 말기 차별화 된 성숙 해마 성상 세포로 구성하는 것이 좋습니다 같이 발현 S100B. 성상 세포 단층 상하 상주 소교 세포 오염 전혀없는 순수한 차 해마 성상 세포 배양 물을 구하는 것은 거의 불가능하다. 따라서, 미세 아교 세포의 배양 astroglial 오염 또한 가능한 한 낮은,이 비율을 유지하는 비율을 아는 것이 중요하다. 본 연구에서 우리는 잠재적 인 오염물 같은 미세 아교 세포 또는 신경 세포의 존재를 결정하기 위해 미세 아교 세포 특이 마커 IBA1 또는 신경 마커 MAP2와 성상 세포 배양 물을 염색. 설치류 성상 세포 배양 미세 아교 세포의 비율은 동물의 연령, 종, 지역, 문화 매체, 방법을 계대 배양 및 30을 흔들어을 포함 여러 가지 요인에 따라 1 %에서 30 %로 다를 수 있습니다. 우리의 문화에서 우리는 다른 보고서 (25)와 비교할 소교 오염의 약 6 %를 관찰했다. 성상 세포 배양의 용도는 염증 해마 성상 세포의 역할을 연구하는 경우에는 필수적이다DIV 3. LME에서 시작 성상 세포 배양에서 가능한 소교 오염을 제거하기 위해 10 일 동안 5 mM의 LME와 문화를 치료하는 것은 미세 아교 세포 (20, 22)를 증식 제거하는 방법으로 광범위하게 사용 된 소교 세포 독성 제입니다. 또한, LME 처리 된 문화는 흔들림 프로토콜 (1 시간 동안 300 rpm으로)을 실시한다. OGD / REOX을 수행하는 또 다른 기술적 과제는 저산소증 충분한 정도 astrogliosis을 유도 달성되었는지 여부를 결정하는 것이다. 성상 세포에서 저산소증에 대한 마커 GFAP의 업 규제와 HIF-1α의 유도를 포함한다. 따라서, 본 연구에서 저산소증 GFAP 면역 반응의 증가로 확인 하였다 (도 4) (데이터는 도시하지 않음) HIF1-α의 상향 조절 염색. 요약하면, 거세 신생아 해마 성상 세포 배양으로부터 얻어진 결과는 건강 균질 성상 층 디 성공적인 세포 부착을 보였다시험관 허혈의 유도에 전형적인 된 커버의 형태와 주요 반응성 성상 세포 마커 GFAP의 발현 및 S100B을 플레잉. 우리는 여기에서 채택 된 프로토콜은 남성과 여성의 두뇌를 개발 성상 세포의 역할에 관한 중요한 기계론과 병진 질문에 대답 할 수있는 잠재력을 가지고 있다고 생각합니다. 기존 기술들의 대다수는 대조적으로 전체 배양 과정 성을 연구 도구로서 성상 세포 배양 방법의 사용을 용이하게 실험을 빠르게 턴어라운드 및 기술의 단순함을 부여 2 주 성숙 융합 거세 해마 아스트로 생성 따라서 두뇌 개발 뇌 연구의 폭 넓은 보급을 허용에 아교 세포의 특정 역할.

성상 세포는 중추 신경계 (CNS)에서 가장 중요한 핵심 선수 중 하나이다. 증거의 성장 몸은 성상 세포의 역할이 신경 지원을 제공보다 더 있음을 나타냅니다. 사실, 생리 학적 조건에서 아스트로 사이트의 역할은, CNS 혈류량이 조절 현상 축삭 (1)의 이동을 안내하는 시냅스 간질 액 (3)의 pH의 항상성을 유지하고, 혈액 뇌 장벽에 참여 같이 매우 복잡 할 수있다 4 시냅스 전달 (5). 병적 인 조건에서 성상 세포는 성상 세포와 기능 (모욕으로부터의 거리에 대한) 형태, 수, 위치, 지형이 이종 방법 6,7에서 변경 될 수있는 반응 astrogliosis라는 과정을 부상으로 반응한다. 아마 신생아의 이환율과 사망률에 기여 신생아 저산소 성 허혈성 뇌증 다음 볼 Astrogliosis <s&gt; 8입니다. 최근의 임상 및 실험적 연구는 뇌 손상의 정도를 비교하여 수형 신생아는 심한 신경 결과 결과 저산소증 / 허혈 (HI) - 관련 뇌 손상의 영향에 더 민감하다 섹스 의존적으로 나타나고 있음을 나타낸다 비교 뇌 손상 9-11와 여성. 부상의 위치 파악은 임신 기간 및 지속 기간 및 모독의 정도에 따라 다르지만, 해마 용어 신생아 HI 후 CNS에서 가장 흔히 영향 영역 중 하나이며, 해마 astrogliosis가 상향 조절로 확인되었다 증가 아교 섬유 성 산성 단백질 (GFAP) 신생아 HI 7,10,12,13 후 3 일. 성상 세포 기능의 성별 차이는 뇌허혈 14, 15 후 모두 신생아와 성인 설치류에 나타내었다. 또한, 체외 허혈에 남성 성상 세포 감수성이 증가 CEL으로 나타났다문화 (16) 여성 대뇌 피질 성상 세포에 비해 리터의 죽음. 성별 차이에-자궁 시작과 죽음 (17)까지 계속. 지난 10 년간, 세포 배양 및 생체 내 연구 실험 조건에서 남녀 등의 중요성은 의학 및 NIH 연구소의 강조는 생리적, 병리 적 상태 (17, 18)을 볼 성별의 차이에 기초 지식을 추구 할 수 있었다 . 분리하고 성별화 된 해마 성상 세포의 인구를 유지하기 위해 신뢰할 수있는 방법의 개발은 신생아 HI의 병리 결과에서 성별 차이의 세포 기초를 이해하는 것이 필수적이다. 본 연구는 산소가 / 포도당 박탈 (OGD) 및 재산 소화 (REOX), 유도 다음 GFAP 면역 성상 세포의 역할을 평가하기 위해 신생아 쥐에서 농축 성 별 해마 성상 세포 배양을 준비하기 위해 기술을 제공하도록 설계되었습니다세포 배양 환경에서 HI. 이 기술은 정상 산소 및 허혈성 조건 신생아 암수 해마 성상에 속하는 모든 가설을 테스트하기 위해 사용될 수있다.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

저산소증 / 국소 빈혈 (HI) - 관련 뇌 손상 다음 Astrogliosis는 신생아의 증가 이환율과 사망률의 역할을한다. 최근의 임상 연구는 뇌 손상의 정도 섹스 의존적으로 나타난 나타내고, 수형 신생아는 유사한 뇌 손상과 여자에 비해 더 심한 신경 결과 결과 HI 관련된 뇌 손상의 영향에 더 민감하다있다. 분리하고 성별화 된 해마 성상 세포의 매우 풍부한 인구를 유지하기 위해 신뢰할 수있는 방법의 개발은 신생아 HI의 병리 결과에서 성별 차이의 세포 기초를 이해하는 것이 필수적이다. 본 연구에서는 재산 소화 하였다 시험관 허혈, 산소 - 글루코스 부족의 모델을 거치게되는 특정한 성별 해마 성상 세포 배양 물을 생성하는 방법을 설명한다. 이후 반응 astrogliosis는 immunostai에 의해 조사 하였다아교 섬유 성 산성 단백질 (GFAP) 및 S100B에 대한 닝. 이 방법은 개별적으로, 신생아 HI 다음 남성과 여성의 해마 성상 세포의 역할을 연구하는 유용한 도구를 제공합니다.

생리 학적 또는 병태 생리 학적 조건에서 거세 성상 세포 기능의 역할을 이해하는 것은 대단히 관내 조건 하에서이 세포를 배양하여 규명되었다. 성별화 된 배양을 수행의 중요한 측면은 이전의 사용에 마우스 강아지의 성별을 결정하는 것입니다. 우리는 유전자 PCR에 의해 시각적 평가 (그림 2) (16)에 의해 마우스의 성별을 결정했다. PCR을 사용하여 성 결정의 방법론은 McClive과 싱클레어에서 수정을 채택, 빠르고 간단하고 매우 재현 방법 23.도 2a는 PCR을 사용하여 성 결정의 대표 결과를 보여줍니다. PCR 생성물은 두 개의 대표 P1 남성과 여성의 꼬리 자르는로부터 추출 된 DNA와 함께 생성 하였다. 반응은 441 bp의과 여성과 특이 남성 특정 밴드를 생성 SRY 및 Myog 유전자 다중 프라이머 쌍을 포함각각 245 bp의의 IC 밴드. 신생아 (P 1-3)의 시각 결정 육안으로 마우스 성별은 남성 (그림 2B) 16, 24의 항문 구멍 사이의 작은 어두워 스팟의 존재를 찾고에 의해 설립되었습니다. 성상 세포의 배양이 설정 실험실에서 확립하기 편리하고 비교적 쉽게,하지만, 이러한 장점은 주로 낮은 정도에 미세 아교 세포 또는 뉴런과의 오염에 의해 방해 할 수 있습니다. 아스트로 사이트의 오염을 쉽게하거나 미세 아교 세포 (IBA1) 또는 뉴런 (MAP2)에 대한 셀 특정 적 마커 배양 세포 immunolabeling에 의해 결정될 수있다. IBA1 (그림 3) 표현 몇 가지 세포에 의해 제안 된 본 연구에서는 주요 단층 문화에서 성장 해마 성상 세포는 DIV (14)에 오염 된 미세 아교 세포의 ~ 6 %가 관찰되었다. 반대로, 셀 것도 제안 MAP2을 표현 발견되지문화는 신경 세포의 오염 (그림 3) 완전히없는 상태였다. 3 일 된 마우스 새끼 (25) - 우리의 문화에서 관찰 된 작은 소교 오염은 저자가 1에서 파생 된의 주요 피질 성상 세포 배양에 5 % 소교 오염을보고있어서, 다른 보고서에 따르면,에 있습니다. 성상 세포는 그들을 포함한 저산소 미세 환경의 변화에 ​​응답 할 수 있도록 특정 cytoarchitecture을 갖는다. 시험관 허혈에 대한 성별 특정 성상 세포 응답을 결정하기 위해, 우리는 OGD / REOX에 성별화 된 해마 성상 세포를 실시. 정상 산소의 조건 하에서 세포에 HIF1α 식 (도 4와 비교 OGD / REOX의 성공적인 도입은 저산소증 유도 성 인자 1 알파의 증가 핵 식에 의해 결정 하였다 (HIF1α 5 시간 REOX이어서 2 시간 OGD 실시 GFAP + 교세포에서 관찰 ). (그림 5). 이 세포들은 신경 줄기 세포 (NSC) 26 잠재력을 잃게하는 경향이 곳 GFAP 및 S100B는 성숙 성상 세포 발달 단계의 특성, 성상 세포의 세포질과 세포 기관에 colocalized했다. 각각의 정상 산소 및 OGD / REOX 치료 그룹에서 관찰 된 바와 같이 형태와 GFAP 또는 S100B의 면역 반응의 밀도는 모두 남성과 여성의 성상 세포 배양에서 유사 하였다. 공 초점 현미경을 사용하여 평가 된 바와 같이, 정상 산소의 조건 하에서 해마 성상은 방 추상하는 다각형 평면 형태 [화살표 (60X normoxia)도 5A, B]를 제시 하였다. 이 세포들은 이전 OGD / REOX의 유도에 약 2 주 동안 합류 할 때까지 분할 할 수 있었다. 2 시간 OGD 5 시간 REOX 후, 성상 세포는 고전를 Reacti을 전시성상 세포의 수축 기본 프로세스를 표시하는 형태, 소마와 프로세스의 비대 및 GFAP의 발현 증가 또는 S100B했습니다 [그림 5A를, B (OGD / REOX, 60X, 화살촉)]. OGD / REOX 따라 상기 GFAP / S100B 염색은 암수 해마 아스트로 모두 세포질 가로 질러 연장 광범위한 그물 세공을 나타냈다. GFAP 널 쥐에서 배양 된 해마 성상 세포에서 관찰 GFAP 염색의 부족은 음성 대조군 (그림 5B, 삽입)을 역임. 위의 결과는 OGD-REOX을받을 때 GFAP / S100B 면역 성상 세포의 형태가 큰 변화를 겪는 것이 직접적인 증거를 제공합니다. <img alt="그림 1" src="/files/ftp_upload/53695/53695fig1.jpg" /> 그림 P1 쥐의 해마 제거 기술 1. 삽화입니다. 1. 머리를 제거하는 강아지 목을 벨.미세 가위를 사용하여 2, 3. 피부의 중간 선 절개를, 후방은 전방 및 평면 팁 집게의 도움으로 피부를 벗겨. 4, 5, 6.의 바닥에 작은 절개를 만드는 방법 두개골. 정중선을 따라 두개골을 잘라 뇌를 노출 떨어져 두 반쪽 껍질. 7, 8. 곡선 집게의 도움으로 소뇌를 제거합니다. 9. 조심스럽게.. 멸균 페트리 접시에 10, 11 두개골과 장소에서 뇌를 제거 두뇌의 복부 표면이 곡선 집게를 사용하여 향하도록 한 다음 날카로운 멸균 수술 블레이드. (12) 두 반구를 분리하도록 뇌 플립, 13, 14. 볼록 중뇌와 시상 조직 그대로를 떠나 반구의 기초와 해마를 공개를 제거합니다. 15, 16. 제거 해마 (작은 C 모양의 구조). 17, 18 즉시 모두에서 얻은 해마 로브를 배치 A의 반구<html> 무균 HBSS 포함하는 별도의 페트리 접시. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53695/53695fig2.jpg" /> 신생아 쥐 그림 2. 섹스 결정.를했다. (; M 1 F 1) 마우스 섹스는 유 전적으로 Myog (X 염색체)와 손가락이나 발가락 스크랩에서 추출한 DNA를 이용하여 SRY (Y 염색체) 유전자에 특이 적 프라이머로 PCR에 의해 결정되었다. PCR의 밴드 UV 조명 하에서 에티 디움 브로마이드로 2 % 아가 로스 겔에서 가시화 하였다. F 2, M 2는 각각 여성과 남성에 대한 긍정적 컨트롤을 제공합니다. B를. 여성에서 남성의 시각 결정은 항문 구멍 (화살표) 사이의 어두운 지점을 식별하여 설립되었다.urce.jove.com/files/ftp_upload/53695/53695fig2large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 3" src="/files/ftp_upload/53695/53695fig3.jpg" /> 그림의 연결 마커 MAP2 (빨간색)와 미세 아교 세포 마커 IBA1 (녹색)와 성상 세포 배양의 기본 마우스 해마 성상 세포 문화. 면역 염색 3. 순도. 핵 4 &#39;, 6&#39;- diamidino-2-페닐 인돌 (DAPI) (파란색)로 염색된다. 화살표는 미세 아교 세포의 오염을 나타냅니다. 스케일 바 :. 50 μm의 <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/53695/53695fig4.jpg" /> 그림 4. HIF1α 식에 있었다GFAP (적색)와 (A) normoxia 또는 (B) OGD (2 시간) / REOX (5 시간)을 실시 성상 세포에서 HIF1α (녹색) 표시를 나타내는 OGD / REOX에 노출 된 배양 된 해마 성상에 주름. 대표적인 면역 형광 이미지. 핵 4 &#39;, 6&#39;- diamidino-2-페닐 인돌 (DAPI) (파란색)로 염색된다. 낮은 HIF1α 식을 화살표; 화살촉은 HIF1α 핵 발현을 증가. 스케일 바 :. 25 μm의 <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53695/53695fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/53695/53695fig5.jpg" /> 그림 5. 업 규제 OGD-REOX 다음 성별화 된 해마 성상 세포 배양에 S100B 또는 GFAP 식입니다. 성별화 된 배양 해마 성상 세포는 정상 산소 조건에서 또는 2 후에 S110b 또는 GFAP의 발현을 염색H는 OGD REOX 5 H (OGD / REOX) 하였다. 삽입은 : 해마 성상 세포에서 60X 이미지 GFAP 널 쥐에서 배양. 스케일 바 : 30 μm의.

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

성상 세포는 중추 신경계 (CNS)에서 가장 중요한 핵심 선수 중 하나이다. 여기서는 후 시험관 허혈 암수 신생아 새끼의 성상 세포 기능의 기초가되는 메카니즘을 연구하기 위해 거세 해마 성상 세포 배양 프로토콜의 구체적인 방법을보고하고있다.

마우스 해마 성상에서 섹스 차이점 후<em&gt; 인 체외</em&gt; 허혈

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Nanyang Technological University

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K 조회수.  University of Wisconsin.  성상 세포는 중추 신경계 (CNS)에서 가장 중요한 핵심 선수 중 하나이다. 여기서는 후 시험관 허혈 암수 신생아 새끼의 성상 세포 기능의 기초가되는 메카니즘을 연구하기 위해 거세 해마 성상 세포 배양 프로토콜의 구체적인 방법을보고하고있다. 

비디오: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

마우스 두피 Astrocytes의 분리와 문화

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

연구

신경과학

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

쥐의 해마 영역의 치아 이랑 (dentate gyrus)에서 수지상 Arborization의 평가

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

사이토 반응성 및 확산에서 체 외에 허 혈 성 같은 조건 모니터링

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

신생아 Hypoxic-허 혈 성 뇌 손상의 마우스 모델에서 Neurobehavioral 평가

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

Ex Vivo 가압 해모골 모세관-Parenchymal Arteriole 기능 적 연구를 위한 준비

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

이혈증에서 신경 신경-Glia 상호 작용의 역할을 공부 하기 위한 세포 배양 모델

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

성상 세포 영토 부피 분석 및 두꺼운 자유 부유 조직 절편의 타일링

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

허혈성 뇌졸중 마우스 모델을 개발하기 위한 원위 중동맥의 폐색

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

저자 스포트라이트: 뇌졸중 연구를 위해 마우스에서 신뢰할 수 있는 원위 MCA 폐색 모델 확립

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

원위 중동맥 폐색 기법을 사용한 마우스의 급성 허혈성 뇌졸중 유도

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

마우스 해마 성상에서 섹스 차이점 후

요약

더 많은 비디오 탐색

이 비디오의 챕터

마우스 두피 Astrocytes의 분리와 문화

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

쥐의 해마 영역의 치아 이랑 (dentate gyrus)에서 수지상 Arborization의 평가

사이토 반응성 및 확산에서 체 외에 허 혈 성 같은 조건 모니터링

신생아 Hypoxic-허 혈 성 뇌 손상의 마우스 모델에서 Neurobehavioral 평가

Ex Vivo 가압 해모골 모세관-Parenchymal Arteriole 기능 적 연구를 위한 준비

이혈증에서 신경 신경-Glia 상호 작용의 역할을 공부 하기 위한 세포 배양 모델

성상 세포 영토 부피 분석 및 두꺼운 자유 부유 조직 절편의 타일링

원위 중동맥 폐색 기법을 사용한 마우스의 급성 허혈성 뇌졸중 유도

원위 중동맥 폐색 기법을 사용한 마우스의 급성 허혈성 뇌졸중 유도