The authors gratefully acknowledge outstanding support of their lab, team members and work by the Cluster of Excellence CellNetworks at Heidelberg University as well as by the Chica and Heinz Schaller (CHS) foundation. We appreciate that molecular AAV evolution via DNA family shuffling has become a very active field since our initial publication three years ago and therefore apologize to all authors of relevant publications whose work could not be quoted here due to space constraints.

<ol>
	<li>Grimm, D., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+virus+evolution+to+vector+revolution:+use+of+naturally+occurring+serotypes+of+adeno-associated+virus+(AAV)+as+novel+vectors+for+human+gene+therapy.">From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy.</a> Curr. Gene Ther. 3, 281-304 (2003).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+methods+for+gene+transfer+vectors+based+on+adeno-associated+virus+serotypes.">Production methods for gene transfer vectors based on adeno-associated virus serotypes.</a> Methods. 28, 146-157 (2002).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+gene+therapy+vector+evolution+via+multispecies+interbreeding+and+retargeting+of+adeno-associated+viruses.">In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses.</a> J. Virol. 82, 5887-5911 (2008).</li><li>Muller, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nat. Biotechnol. 21, 1040-1046 (2003).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Mol. Ther. 8, 151-157 (2003).</li><li>Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+"humanized"+green+fluorescent+protein+cDNA+adapted+for+high-level+expression+in+mammalian+cells.">A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.</a> J. Virol. 70, 4646-4654 (1996).</li><li>Wobus, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+against+the+adeno-associated+virus+type+2+(AAV-2)+capsid:+epitope+mapping+and+identification+of+capsid+domains+involved+in+AAV-2-cell+interaction+and+neutralization+of+AAV-2+infection.">Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection.</a> J. Virol. 74, 9281-9293 (2000).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatality+in+mice+due+to+oversaturation+of+cellular+microRNA/short+hairpin+RNA+pathways.">Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways.</a> Nature. 441, 537-541 (2006).</li><li>Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unrestricted+hepatocyte+transduction+with+adeno-associated+virus+serotype+8+vectors+in+mice.">Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice.</a> J. Virol. 79, 214-224 (2005).</li><li>Koerber, J. T., Jang, J. H., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+shuffling+of+adeno-associated+virus+yields+functionally+diverse+viral+progeny.">DNA shuffling of adeno-associated virus yields functionally diverse viral progeny.</a> Mol. Ther. 16, 1703-1709 (2008).</li><li>Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+selection+of+shuffled+AAV+genomes:+a+new+strategy+for+producing+targeted+biological+nanoparticles.">Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles.</a> Mol. Ther. 16, 1252-1260 (2008).</li><li>Ward, P., Walsh, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+AAV+Cap+sequences+alter+gene+transduction.">Chimeric AAV Cap sequences alter gene transduction.</a> Virology. 386, 237-248 (2009).</li><li>Yang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+myocardium+tropic+adeno-associated+virus+(AAV)+evolved+by+DNA+shuffling+and+in+vivo+selection.">A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+engineering+of+a+gene+therapy+vector:+directed+evolution+of+adeno-associated+virus.">Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus.</a> J. Gene. Med. 8, 155-162 (2006).</li><li>Maheshri, N., Koerber, J. T., Kaspar, B. K., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+adeno-associated+virus+yields+enhanced+gene+delivery+vectors.">Directed evolution of adeno-associated virus yields enhanced gene delivery vectors.</a> Nat. Biotechnol. 24, 198-204 (2006).</li><li>Wu, Z., Asokan, A., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+serotypes:+vector+toolkit+for+human+gene+therapy.">Adeno-associated virus serotypes: vector toolkit for human gene therapy.</a> Mol. Ther. 14, 316-327 (2006).</li><li>Kwon, I., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+gene+delivery+vectors:+molecular+engineering+and+evolution+of+adeno-associated+viral+vectors+for+enhanced+gene+transfer.">Designer gene delivery vectors: molecular engineering and evolution of adeno-associated viral vectors for enhanced gene transfer.</a> Pharm. Res. 25, 489-499 (2008).</li><li>Perabo, L., Huber, A., Marsch, S., Hallek, M., Buning, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+evolution+with+adeno-associated+viral+libraries.">Artificial evolution with adeno-associated viral libraries.</a> Comb. Chem. High. Throughput. Screen. 11, 118-126 (2008).</li><li>McCarty, D. M., Monahan, P. E., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-complementary+recombinant+adeno-associated+virus+(scAAV)+vectors+promote+efficient+transduction+independently+of+DNA+synthesis.">Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis.</a> Gene Ther. 8, 1248-1254 (2001).</li></ol>

All authors declare that they have nothing to disclose.

Here, we have outlined essential experimental steps and guidelines for AAV capsid engineering via DNA family shuffling and for evolution in cells or in animals. In essence, these protocols are standardized versions of the procedures we first reported within the AAV field in 20083. While a flurry of follow-up studies by others have reported numerous modifications e.g.,10-13, our present versions represent basic strategies yielding reproducible results while being amenable to up-scaling and a...

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent</td>
 <td>Company</td>
 <td>Catalogue number</td>
 </tr>
 <tr>
 <td>DNase I</td>
 <td>Invitrogen</td>
 <td>18068-015</td>
 </tr>
 <tr>
 <td>Polyethylenimine (PEI)</td>
 <td>Sigma-Aldrich</td>
 <td>408727</td>
 </tr>
 <tr>
 <td>Restriction enzymes</td>
 <td>NEB</td>
 <td>Various</td>
 </tr>
 <tr>
 <td>T4 DNA Ligase</td>
 <td>NEB</td>
 <td>M0202T</td>
 </tr>
 <tr>
 <td>Gel extraction kit</td>
 <td>Qiagen</td>
 <td>28704</td>
 </tr>
 <tr>
 <td>Phusion II polymerase Kit</td>
 <td>Finnzymes (NEB)</td>
 <td>F-540S</td>
 </tr>
 <tr>
 <td>HotStar Hifi polymerase Kit</td>
 <td>Qiagen</td>
 <td>202602</td>
 </tr>
 <tr>
 <td>DMSO</td>
 <td>Finnzymes (NEB)</td>
 <td>F-540S (part of kit)</td>
 </tr>
 <tr>
 <td>EDTA (25 mM)</td>
 <td>Invitrogen</td>
 <td>18068-015 (part of kit)</td>
 </tr>
 <tr>
 <td>Tris</td>
 <td>Roth</td>
 <td>4855.2</td>
 </tr>
 <tr>
 <td>Ampicilin sodium salt</td>
 <td>Roth</td>
 <td>K029.2</td>
 </tr>
 <tr>
 <td>dNTPs (10 mM, 100 &mu;l)</td>
 <td>Invitrogen</td>
 <td>18427013</td>
 </tr>
 <tr>
 <td>Iodixanol (OptiPrep)</td>
 <td>Axis-shield</td>
 <td>1114739</td>
 </tr>
 <tr>
 <td>Phenolred</td>
 <td>Merck</td>
 <td>107241</td>
 </tr>
 <tr>
 <td>Plasmid mega prep kit</td>
 <td>Qiagen</td>
 <td>12181</td>
 </tr>
 <tr>
 <td>Ultracentrifuge</td>
 <td>Beckman-Coulter</td>
 <td>Optima L90K</td>
 </tr>
 <tr>
 <td>Quick-Seal centrifuge tubes</td>
 <td>Beckman-Coulter</td>
 <td>342414</td>
 </tr>
 <tr>
 <td>Electroporation unit</td>
 <td>Bio-Rad</td>
 <td>GenePulserXcell</td>
 </tr>
 <tr>
 <td>Thermal cycler</td>
 <td>Eppendorf</td>
 <td>Vapo Protect</td>
 </tr>
 <tr>
 <td>Heating block</td>
 <td>BIOER</td>
 <td>MB-102</td>
 </tr>
 <tr>
 <td>Fluorescence microscope</td>
 <td>Olympus</td>
 <td>IX81</td>
 </tr>
 <tr>
 <td>FACS analyser</td>
 <td>Beckman-Coulter</td>
 <td>Cytomics FC500 MLP</td>
 </tr>
 <tr>
 <td>MegaX DH10B T1R cells</td>
 <td>Invitrogen</td>
 <td>C640003</td>
 </tr>
 <tr>
 <td>Benzonase</td>
 <td>Merck</td>
 <td>101695</td>
 </tr>
 <tr>
 <td>Adenovirus-5</td>
 <td>ATCC</td>
 <td>VR-5</td>
 </tr>
 <tr>
 <td>pBlueScript II KS(+) plasmid</td>
 <td>Stratagene</td>
 <td>212207</td>
 </tr>
 <tr>
 <td>cap5F (Pac I site in yellow, cap5-specific sequences in bold): 
 GACTCTTAATTAACAGGTATGTCTTTTGTTGATCACCCTCC</td>
 <td>IDTDNA</td>
 <td>Custom primer</td>
 </tr>
 <tr>
 <td>cap5R (Asc I site in green, cap5-specific sequences in bold): 
 GTGAGGGCGCGCCTTAAAGGGGTCGGGTAAGGTATC</td>
 <td>IDTDNA</td>
 <td>Custom primer</td>
 </tr>
 </tbody>
</table>

engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically &gt;80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

engineering-evolution-synthetic-adeno-associated-virus-aav-gene

Research

JoVE Journal

Immunology and Infection

28.3K Views.  Heidelberg University. We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Video: Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully generated and infused T-cells specific for Epstein Barr virus (EBV), cytomegalovirus (CMV) and Adenovirus (Adv) using monocytes and EBV-transformed lymphoblastoid cell (EBV-LCL) gene-modified with an adenovirus vector as antigen presenting cells (APCs). As few as 2x105/kg trivirus-specific cytotoxic T lymphocytes (CTL) proliferated by several logs after infusion and appeared to prevent and treat even severe viral disease resistant to other available therapies. The broader implementation of this encouraging approach is limited by high production costs, complexity of manufacture and the prolonged time (4-6 weeks for EBV-LCL generation, and 4-8 weeks for CTL manufacture &#x2013; total 10-14 weeks) for preparation. To overcome these limitations we have developed a new, GMP-compliant CTL production protocol. First, in place of adenovectors to stimulate T-cells we use dendritic cells (DCs) nucleofected with DNA plasmids encoding LMP2, EBNA1 and BZLF1 (EBV), Hexon and Penton (Adv), and pp65 and IE1 (CMV) as antigen-presenting cells. These APCs reactivate T cells specific for all the stimulating antigens. Second, culture of activated T-cells in the presence of IL-4 (1,000U/ml) and IL-7 (10ng/ml) increases and sustains the repertoire and frequency of specific T cells in our lines. Third, we have used a new, gas permeable culture device (G-Rex) that promotes the expansion and survival of large cell numbers after a single stimulation, thus removing the requirement for EBV-LCLs and reducing technician intervention. By implementing these changes we can now produce multispecific CTL targeting EBV, CMV, and Adv at a cost per 106 cells that is reduced by &gt;90%, and in just 10 days rather than 10 weeks using an approach that may be extended to additional protective viral antigens. Our FDA-approved approach should be of value for prophylactic and treatment applications for high risk allogeneic HSCT recipients.

A rapid, simple and cost-effective protocol for the generation of donor-derived multivirus-specific CTLs (rCTL) for infusion to allogeneic hematopoietic stem cell transplant (HSCT) recipients at risk of developing CMV, Adv or EBV infections. This manufacturing process is GMP-compliant and should ensure the broader implementation of T-cell immunotherapy beyond specialized centers.

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where the CB does not contain appreciable numbers of virus-experienced T cells which can protect the recipient from infection.1-4 We and others have shown that virus-specific CTL generated from seropositive donors and infused to the recipient are safe and protective.5-8 However, until recently, virus-specific T cells could not be generated from cord blood, likely due to the absence of virus-specific memory T cells. 
In an effort to better mimic the in vivo priming conditions of na&iuml;ve T cells, we established a method that used CB-derived dendritic cells (DC) transduced with an adenoviral vector (Ad5f35pp65) containing the immunodominant CMV antigen pp65, hence driving T cell specificity towards CMV and adenovirus.9 At initiation, we use these matured DCs as well as CB-derived T cells in the presence of the cytokines IL-7, IL-12, and IL-15.10 At the second stimulation we used EBV-transformed B cells, or EBV-LCL, which express both latent and lytic EBV antigens. Ad5f35pp65-transduced EBV-LCL are used to stimulate the T cells in the presence of IL-15 at the second stimulation. Subsequent stimulations use Ad5f35pp65-transduced EBV-LCL and IL-2. 
From 50x106 CB mononuclear cells we are able to generate upwards of 150 x 106 virus-specific T cells that lyse antigen-pulsed targets and release cytokines in response to antigenic stimulation.11 These cells were manufactured in a GMP-compliant manner using only the 20% fraction of a fractionated cord blood unit and have been translated for clinical use.

Here we describe the first good manufacturing practice (GMP)-compliant method of producing virus-specific cytotoxic T lymphocytes (CTL) from umbilical cord blood, a source of predominantly na&#238;ve T cells.

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

Lentiviral vectors (LVs) are a powerful means of delivering genetic material to many types of cells. Because of safety concerns associated with these HIV-1 derived vectors, producing large quantities of LVs is challenging. In this paper, we report a method for producing high titers of self-inactivating LVs. We retrovirally transduce the tet-off stable producer cell line GPR to generate a cell line, GPRS, which can express all the viral components, including a dendritic cell-specific glycoprotein, SVGmu. Then, we use concatemeric DNA transfection to transfect the LV transfer plasmid encoding a reporter gene GFP in combination with a selectable marker. Several of the resulting clones can produce LV at a titer 10-fold greater than what we achieve with transient transfection. Plus, these viruses efficiently transduce dendritic cells in vitro and generate a strong T cell immune response to our reporter antigen. This method may be a good option for producing strong LV-based vaccines for clinical studies of cancer or infectious diseases.

Here, we use retroviral transduction and concatemeric transfection to create a cell line that can express the components of a lentiviral vector (LV) in the absence of tetracycline. This LV encodes GFP and is pseudotyped with a glycoprotein, SVGmu, which is specific for a receptor on dendritic cells.

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Cell-based Flow Cytometry Assay to Measure Cytotoxic Activity

Cytolytic activity of CD8+ T cells is rarely evaluated. We describe here a new cell-based assay to measure the capacity of antigen-specific CD8+ T cells to kill CD4+ T cells loaded with their cognate peptide. Target CD4+ T cells are divided into two populations, labeled with two different concentrations of CFSE. One population is pulsed with the peptide of interest (CFSE-low) while the other remains un-pulsed (CFSE-high). Pulsed and un-pulsed CD4+ T cells are mixed at an equal ratio and incubated with an increasing number of purified CD8+ T cells. The specific killing of autologous target CD4+ T cells is analyzed by flow cytometry after coculture with CD8+ T cells containing the antigen-specific effector CD8+ T cells detected by peptide/MHCI tetramer staining. The specific lysis of target CD4+ T cells measured at different effector versus target ratios, allows for the calculation of lytic units, LU30/106 cells. This simple and straightforward assay allows for the accurate measurement of the intrinsic capacity of CD8+ T cells to kill target CD4+ T cells.

This protocol describes a sensitive, cell-based cytotoxicity assay. By enumerating the decrease in frequency of live target CD4+ T cells in the presence of an increasing number of effector CD8+ T cells, this assay allows for the direct assessment of cytolytic activity of antigen-specific CD8+ T cells.

Cytolytic activity of CD8+ T cells is rarely evaluated. We describe here a new cell-based assay to measure the capacity of antigen-specific CD8+ T cells ...

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

The glassy-winged sharpshooter (Homalodisca vitripennis) is a highly vagile and polyphagous insect found throughout the southwestern United States. These insects are the predominant vectors of Xylella fastidiosa (X. fastidiosa), a xylem-limited bacterium that is the causal agent of Pierce&#39;s disease (PD) of grapevine. Pierce&#8217;s disease is economically damaging; thus, H. vitripennis have become a target for pathogen management strategies. A dicistrovirus identified as Homalodisca coagulata virus-01 (HoCV-01) has been associated with an increased mortality in H. vitripennis populations. Because a host cell is required for HoCV-01 replication, cell culture provides a uniform environment for targeted replication that is logistically and economically valuable for biopesticide production. In this study, a system for large-scale propagation of H. vitripennis cells via tissue culture was developed, providing a viral replication mechanism. HoCV-01 was extracted from whole body insects and used to inoculate cultured H. vitripennis cells at varying levels. The culture medium was removed every 24 hr for 168 hr, RNA extracted and analyzed with qRT-PCR. Cells were stained with trypan blue and counted to quantify cell survivability using light microscopy. Whole virus particles were extracted up to 96 hr after infection, which was the time point determined to be before total cell culture collapse occurred. Cells were also subjected to fluorescent staining and viewed using confocal microscopy to investigate viral activity on F-actin attachment and nuclei integrity. The conclusion of this study is that H. vitripennis cells are capable of being cultured and used for mass production of HoCV-01 at a suitable level to allow production of a biopesticide.

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

Here we present a protocol to propagate Homalodisca vitripennis cells and HoCV-1 in vitro. Medium was removed from HoCV-1 positive cultures and RNA extracted every 24 hr for 168 hr. Cell survivability was quantified by trypan blue staining. Whole virus particles were extracted post-infection. Extracted RNA was quantified by qRT-PCR.

The glassy-winged sharpshooter (Homalodisca vitripennis) is a highly vagile and polyphagous insect found throughout the southwestern United States. These ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been successfully employed for editing genomes of various organisms. Here we describe a protocol for editing the vaccinia virus (VV) genome in the cytoplasm of VV-infected CV-1 cells using the RNA-guided Cas9. RNA-guided Cas9 induces double-stranded DNA breaks facilitating homologous recombination efficiently and specifically in the targeted site of VV and a transgene can be incorporated into these sites by homologous recombination. By using a site-specific homologous vector with transgene(s), a N1L gene-deleted VV with the red fluorescence protein (RFP) gene incorporated in this region was generated with a successful recombination efficiency 10 times greater than that obtained from the conventional homologous recombination method. This protocol demonstrates successful use of RNA-guided Cas9 system to generate mutant VVs with enhanced efficiency.

Vaccinia virus (VV) has been widely used in biomedical research and the improvement of human health. This article describes a simple, highly efficient method to edit the VV genome using a CRISPR-Cas9 system.