1. klonlama ve hücre satırı üretimi
<ol><li>PCR yükseltmek NBB bölge çerçeve standart Restriksiyon enzimi tabanlı Oligomerizasyonda etki alanı 2 x FK506 bağlayıcı protein (2xFKBP veya 2xFV) ve Venüs floresan ile klonlama olarak amino asit kalıntıları eklenmesi 1-140 (NBB140), insan MLKL cDNA sayfasından için karşılık gelen protein doksisiklin (Dox) - indüklenebilir retroviral vektör pRetroX-NBB140elde etmek için TRE3G - 2xFV-Venüs (Tablo 1, rakamlar 1A-B).</li>
	<li>Ölümsüzleştirmek SV40 büyük antijen ile geçici transfection tarafından ilgili fareler yeşil laboratuarda elde edilen birincil mlkl- / - veya ripk3- / - mlkl- / - fare embriyonik fibroblastlar (MEFs) Plazmid ifade ediyorum. ~ 1 – 2 ile ölümsüzleştirdi hücreleri seçin hafta ve % 10 fetal Sığır serum (FBS), 2 mM L-glutamin, 100 U/mL penisilin ve streptomisin, 1 mM sodyum pyruvate ve 37 ° C ve % 5 CO2 standart doku'de gerekli olmayan amino asitler ile takıma DMEM korumak Kültür İnkübatörler.</li>
	<li>Transduce SV40 ölümsüzleştirilmiş mlkl- / - MEFs ile ters tetrasiklin kontrol transactivator (rtTA)-retrovirüsü blasticidin direnç gen (bizim değiştirilmiş plazmid) içeren bir plazmid ifade içeren ve 1 için tedavi hafta ile 5 μg/mL blasticidin stabil rtTA28ifade hücrelerini seçer.</li>
	<li>RtTA ifade MEFs ile Dox indüklenebilir retroviral vektör chimeric MLKL içeren transduce (pRetroX-NBB140-2xFV-Venüs-puro) ve bir hafta, 2 gün sonra iletim için 4 μg/mL puromisindir kullanarak seçin.</li>
</ol>2. canlı cep mikroskobu görüntüleme Necroptosis MLKL-aracılı
<ol><li>Plaka mlkl- / - NBB140ifade MEFs-2xFV-24 (1 mL/de) kuyuya başına 50.000 hücre yoğunluğu, Venüs de tabak ve gecede kuluçkaya (Şekil 2A). (Bkz. Tablo reçetesi) otomatik hücre sayımı için canlı hücre boyama kullanın.</li>
	<li>Hücreler Dox ile 12 h için tedavi (0.5 μg/NBB140ifade ikna etmek için mL)-2xFV-Venüs.</li>
	<li>Necroptosis 25 nM FKBP dimerizer (Dim) ile 25 nM membran geçirimsiz yeşil floresan yanı sıra teşvik ( Tablo malzemelerigörmek) standart DMEM boya (1.2 bakın). Necroptosis geçiren hücreleri birikir boya NBB140tarafından onların plazma membran bütünlüğü tehlikeye gibi-aracılı yırtılması. Deneyleri nüsha veya quadruplicate yerine getirmek.</li>
	<li>Tek veya çift renkli görüntüleme sistemleri ( Tablo malzemelerigörmek) kullanarak necroptosis izlemek için bir memeli doku kültürü kuluçka makinesine yer alan ilgili görüntüleme birimi damarları yerleştirin.</li>
	<li>Açık bilgisayar yazılımı ( Tablo malzemelerigörmek) ve zamanlama yaklaşan tarar görevler listesinin altında sekmesini seçin. Not: bu iletişim kuralı tek renkli sistemleri kullanarak görüntüleme için ama benzer bir yazılım çift renkli sistemlerinde kullanılabilir.</li>
	<li>"Tepsi, gemi, tarama türleri" ve "Tarama deseni" "Fiziksel düzeni" sekmesini ve "Hızlı floresan" Özellikler sekmesini seçin.</li>
	<li>"İnceden inceye gözden geçirmek yanında tıkırtı zaman" "Zaman çizelgesi" pencere ve toplam zaman puan ve frekans Alım (genellikle 1 edinme her 0,5 h 6 12 h s veya fast-kinetik necroptosis için her 5 dk 1 h) ekleyin ve resim alma "App seçerek başlayın ly"(kırmızı düğme).</li>
	<li>Görüntü analiz yazılımı kullanarak necroptosis ölçmek ( Tablo malzemelerigörmek) seçerek "görev bölmesinden", "Nesne sayma yeni analizi ile sabit segmentasyon eşik arka plan seviyesinden", hangi tespit üzerine gelerek fare imlecini birkaç görüntü analizinde kullanılan bölgelerde arka plan üzerinde.</li>
	<li>Geçerli görüntü kullanarak önizlemesini görüntülemek seçerek floresan nesneleri inceleyin ve gerektiği gibi eşit düzeylerine rafine.</li>
	<li>Yeşil floresans sayar "Denize indirmek yeni analiz" sekmesini açarak entegre, "Zaman aralığı" seçmek, çözümlenmesi, "Analiz iş adı" girin ve "Tamam" tuşuna basarak için kuyu seçin.</li>
	<li>Erişim ilgili işin adına çift tıklatıp ek çözümleme harici grafik yazılım grafik/verme penceresinden verme "Analiz işleri" sekmesinden veri analiz ( Tablo malzemelerigörmek).</li>
	<li>Veri yeşil floresans pozitif (+ ve) olarak sayar/mm2 quantitate veya sayıları izdiham tarafından normale ve verileri hızlı yeşil floresans + ve sayıları/izdiham olarak.</li>
	<li>İsteğe bağlı olarak, deneysel uç noktada 100 hücrelerle leke membran-permeant yeşil floresan nM boya ( Tablo malzemelerigörmek). Yeşil floresans/yeşil floresans uç noktada oranı % necroptotic hücrelere veri normalleştirmek.</li>
</ol>3. canlı hücre Confocal mikroskobu görüntüleme plazma zarı işe alım ve Permeabilization MLKL tarafından
<ol><li>Plaka mlkl- / - NBB140ifade MEFs-2xFV-Venüs bir cam (0.5 mL/de) kuyuya başına 20.000 hücre yoğunluğu, alt için 30 dk 37 ° C'de PBS içinde 50 µg/mL fibronektin ile ön işleme 4-şey mikroskobu odası ve ~ 12 h ( için kuluçkaya Şekil 2B).</li>
	<li>Dox hücrelerle tedavi (0.5 μg/mL) ~ 12 h NBB140ifade ikna etmek için-2xFV-Venüs.</li>
	<li>Necroptosis taze orta ile 25 (1 mL/de) kuluçka tarafından teşvik nM NBB140ikna etmek için Dim-2xFV-Venüs harekete geçirmek ve plazma zarı için translocation.</li>
	<li>Çevre denetimi ve bir 63 ile donatılmış bir ters stand üzerinde inşa confocal mikroskobu tarama dönen disk lazer odası yerleştirin 1.4 NA amaç ve yazılım kullanarak edinme Imaging başlar ( Tablo malzemelerigörmek).</li>
	<li>Belgili tanımlık bilgisayar yazılımı başlatmak, YFP filtre yapılandırma (uyarma dalga boyu 515 nm) ve "Focus" simgesini seçin.</li>
	<li>Görüş alanı ve odak düzlemi bulun ve "Kesin Focus" sekmesini kullanarak odak bakım sistem meşgul.</li>
	<li>Satın alma başlamak için filtre yapılandırma, uygun EMCCD fotoğraf makinesi pozlama zaman ve yoğunlaştırılması kazanç ve hızlandırılmış edinme parametrelerini aralığı ve edinme uzunluğu gibi atama tarafından takip "Yakalama" sekmesini seçin.</li>
	<li>İzlemek floresan NBB140hücresel yeniden dağıtım-2xFV-Venüs protein elde tarafından necroptosis sırasında görüntüleri her 10 515 nm lazer (Film 1) kullanarak bir EMCCD kamera tarafından s. Not: Photobleaching floresan protein görüntüleme ile bir husustur. Venüs daha dayanıklı floresan proteinler photobleaching29biridir. Photobleaching için daha duyarlı floresan proteinler kullandıysanız, her 30 resim s veya kurtarma görüntüleme zaman puan arasında sinyal sağlamak için daha uzun.</li>
	<li>NBB140Derneği plazma zarı izlemek için-2xFV-Venus necroptosis sırasında görüntü her 10 s örnek hazırlanan 3.3 içinde toplam iç yansıma floresans tarafından bir otomatik TIRF slider ile donatılmış bir mikroskop kullanarak (TIRF) mikroskopi ve bir 100 x 1.4 NA objektif ve bir EMCCD kamera (Movie 2). 3.5-3.7, adımları izleyin ama TIRF odak sekme mikroskobu odası örnek ve alt cam kalınlığı göre içindeki TIRF açısını ayarlamak. Not: plazma zarı işaretleyicileri LCK-C-RFP gibi denetimleri plazma zarı yerelleştirme TIRF analizi için kullanılabilir.</li>
	<li>Görüntü kalitesi Gauss işlev (Marr algoritması) negatif normalleştirilmiş ikinci türev ile evrişim tarafından geliştirmek için işleme gerçekleştirin.</li>
</ol>4. elektron mikroskobu
<ol><li>Plaka mlkl- / - NBB140ifade MEFs-2xFV-Venüs bir yoğunluk plazma kaplı 150 mm 5 milyon hücre, hücre kültür çanak ve kuluçkaya 12 h (Şekil 3).</li>
	<li>Doksisiklin hücrelerle tedavi (0.5 μg/NB1-140ifade ikna etmek için mL)-2xFV-Venüs 12 h için.</li>
	<li>NBB140ikna etmek-2xFV-Venüs harekete geçirmek ve 25 ile plazma zarı translocation homodimerizer 5 min için nM. Bu sefer canlı hücre görüntülemede gözlenen necroptosis kinetik üzerinden kurulur.</li>
	<li>Medyayı çıkarın ve 10 mL % 2.5 oxazolidin, 37 ° C'de önceden ısınmış % 2 paraformaldehyde 0.1 M sodyum cacodylate tampon pH 7.4 içinde (cacodylate arabellek) kullanarak hücreleri tamir</li>
	<li>Kazıma örnek toplamak ve örnekleri 500 x g, 10 min için spin. Süpernatant atmak.</li>
	<li>Örnek % 1.5 potasyum ferrocyanide 0.1 M sodyum cacodylate tampon ile 1,5 saat içinde indirimli % 2 osmiyum tetroxide için postfix. Osmiyum tetroxide TEM içinde kontrast sağlamak için yaygın olarak kullanılan boyama bir ajandır. TEM necroptosis geçiren hücre SEM önce ön analiz olarak kullanılır.</li>
	<li>Örnek 5 kere 5 min için ultrasaf su vasıl 500 x gdurular arabelleği ardından, durulama (bkz: 4.6), su ve etanol otomatik bir işlemci. Süpernatant atmak.</li>
	<li>SEM için % 1 uranyl asetat ve kurşun aspartat heavy metalci leke31ile daha önce sabit örnekleri leke.</li>
	<li>Alkol ve propilen oksit çözümleri kademeli bir dizi örnekleri kurutmak.</li>
	<li>Örnek bir reçine blok elde etmek için sert reçine32 içinde embed.</li>
	<li>Analiz doğru alan belirlemek için 0.5 mikron kalınlığında bölümlerini kes.</li>
	<li>Elektriksel olarak iletken metal (Iridium) ultra ince bir film örnekleriyle kat.</li>
	<li>Görüntü ve örneklerini (Şekil 3). Miktar için reçine blok yüzey maruz kalan hücrelerle düşük-büyütme resim 5'te taranır bir elektron mikroskop kullanarak keV.</li>
	<li>Hücrelerin SEM tarafından yakalanan bireysel görüntüleri karşısında görselleştirmek veya görüntüleme yazılımı birden çok alan görünümü bir bitişik resim30birleştirmek için kullanılan. Kabaca 100 hücreler hücreleri necroptosis bu şekilde seçim yazılımında yüksek çözünürlüklü resim dizisi oluşturarak geçiren kısmını değerlendirmek için kullanılan ( Tablo malzemelerigörmek). Not: SEM tarafından nekrotik morfoloji Puanlama normal hücre özellikleri önceden nekrotik veya nekrotik fenotipleri ilerleme ile karşılaştırır. Bu özellikler microvilli ortadan kalkması da dahil olmak üzere, düzleştirme, yırtığı 10 arasında değişen hücrelerdeki plazma zarı değişiklikler içerir nm 1 µm boyutu veya organel yapısı sitozolik hücre alan en az % 30-40 arasında kaybı için.</li>
</ol>5. lipid bağlama, nükleer manyetik rezonans (NMR) spektroskopisi tarafından MLKL
<ol><li>15N etiketli NBB1-156 standart protein ifade ve arıtma yukarıda açıklanan24olarak hazırlayın.</li>
	<li>1,2-distearoyl-sn-glycero-3-phosphoinositol amonyum tuz (18:0 PI) ve 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol) amonyum tuzu (18:1 PI) buz gibi CHCl3 her için son 1 mg/mL konsantrasyonda 500 µL 500 µg geçiyoruz.</li>
	<li>1 mg/mL 18:0 ve sonication su banyosu oda sıcaklığında 1 dk 18:1 PI solüsyon içeren temizleyicide veya en fazla 5 dakika içinde bir buz-su karışımı.</li>
	<li>
Aliquot 1 mg/mL 18:0 ve 18:1 PI içine temiz cam şişeler için bireysel NMR titrasyon serisi (Şekil 4). Transfer lipidler organik çözücüler hava geçirmez cam şırınga kullanarak içinde.
	<ol>
<li>1 mg/mL 18:1 PI aliquot 132 µL (molar kütlesi = 880.137 g/mol) CHCl3 125 µM konsantrasyon, 1200 µL son resuspension hacmi için. Not: 5 mm NMR tüpler için seri seyreltme hacimleri hazırlamak > 1000 µL ve son NMR örnek hacimleri > 500 µL. 3 mm NMR tüpler için seri seyreltme hacimleri hazırlamak > 300 µL ve son NMR örnek hacimleri > 150 µL.</li>
	</ol>
</li>
	<li>Aliquot 1 mg/mL domuz beyin 20 L-α-phosphatidylinositol-4,5-bisphosphate amonyum tuzu: 9:1 CHCl3/MeOH/H2O (beyin PI (4,5) P2) temiz cam şişe içine.</li>
	<li>Şişeleri argon (Ar) veya azot (N2) karşı cam şişe duvarları sıçramasına olmadan organik çözücü buharlaşır için orta akış ile gaz akışı altına yerleştirin. Otuz beş dk 10-200 µL organik çözücü birimler için genellikle yeterli olur.</li>
	<li>Cam vial(s) Büchner veya vakum büyük Cımbız kullanarak flask altındaki bir kauçuk tıpa ile mühür ve bir vakum hattına bağlı plastik boru eklemek düzenlemek. Şişesi altında kalan organik kaldırmak için hafif vakum gecede tahliye edin.</li>
	<li>Lipid film aliquots inert gaz ile yerleşimi, hava geçirmez bir kapak ile mühür ve daha uzun vadeli depolama için kullanmak bir ay içinde veya-80 ° C-20 ° C'de depolayın.</li>
	<li>NMR örnek arabellek deterjan olmadan hazırlamak (-Det) 20 mM NaxHyPO4 pH 6.8, %10 D2içeren O ve deterjan (+ Det ile) 20 mM NaxHyPO4 pH 6.8, içeren %10 D2O, 0,34 mM n-Lauryl-β-D-maltopyranoside (demir).</li>
	<li>Ekle + cam şişe istenen toplama ulaşmak için ve su banyosu ilâ 30 dk sonication için 10 dk alternatif için solüsyon içeren temizleyicide lipid film ile Det arabelleğe görsel denetim tarafından takip. Not: Örnek Sonication sıcak. Oda sıcaklığında son protein örnek sulandırma önce 15 dakika soğumasını bekleyin.</li>
	<li>Lipid-deterjan micelles + 1:1 karışımları sonication için istenen konsantrasyon serisi kullanarak Det arabellek seri seyreltme gerçekleştirin. 125 µM lipid konsantrasyonu başlayarak, üç tekrarlama 62.5 µM, 31.3 µM ve 15,6 µM lipid 0,34 mm DDM ortaya çıkarır.</li>
	<li>Denetim hazırlayın ve protein ve katkı - Det NMR örnekleri başvuru ve + Det arabellekleri, anılan sıraya göre. Protein ve lipit içinde her seyreltme için katkı + Det arabellek ekleyin. Not: 15N NBB156için protein 40 µM son bir konsantrasyon için eklendi ve azaltılmış Cys artıkları tutmak için 2 mM deuterated dithiothreitol ile desteklenmiştir.</li>
	<li>Örnekler uygun hacmi (bkz: Not Adım 5,4) 5 mm veya 3 mm NMR tüpler aktarın.</li>
	<li>El ile yükleme örnekleri NMR alet veya bir Otomasyon platform SampleCase yükleyici gibi düzenleyin.</li>
	<li>Kalite kontrol en iyi duruma getirilmiş enine gevşeme spektroskopisi (TROSY) olarak 2D 1H -15N korelasyon spectra tarafından takip olarak 1H proton spectra için standart darbe programları kullanarak bileşik NMR spectra elde etmek veya heteronuclear birden fazla kuantum tutarlılık (SOFAST-HMQC)33. Not: 3 mm NMR tüpler kullanımı 1 H -15N TROSY (~ 3 h) veya 1H -15N SOFAST-HMQC (~ 90 dk) 64 inceden inceye gözden geçirmek ister. Tarama numaraları 5 mm NMR tüpler için yarıya iner.</li>
	<li>İşlenmiş 2D NMR spectra çözümleme veya kullanıcıya diğer yazılım CARA depo34 eklenebilir.</li>
	<li>
Yazılım 2D NMR rezonanslar her protein durumu için üç iyi dağınık ve çözümlenen tepeler için ek açıklama ekleme tarafından analiz. Her NBB156 (Şekil 5A) içeren her arabellek koşul için altı zirvesinin en yüksek genlikleri kaydedin.
	<ol>
<li>Bir toplu iş-entegrasyon liste hazırlamak için Cara'yı kullanın (tıklatın ana menü başlığı "spektrum | Kurulum toplu iş listesi"...) Tüm spectra toplanan ve bir tek en yüksek atama dosyasını kullanarak analiz (tıklatın ana menü başlığı "tepeler | Peaklist alma"..... .ve 6 Toplam tepeler, 3 içinde tanımlanan her protein durum için bir .peaks Kullanıcı tanımlı dosya seçin).</li>
		<li>Uygulamasının ayarlarını ("ıntegrator | En yüksek Model tune"...) X-genişlikte 0.06 ppm ve Y-genişlik 0.30 ppm (tıklatın ana menü başlığı "ıntegrator | En yüksek Model tune"...) Son çıktı iki menü seçimlerini (1. kaydetmeden önce Ana menü başlığını tıklatın "ıntegrator | «««Entegre"toplu liste) (2. Ana menü başlığını tıklatın "tepeler | Entegrasyon tablosunu verin") (Şekil 5B). Not: Kalıntıları M21, V53 ve L105 omurga Amid rezonanslar NBB156 kapalı küme ayracı devlet için atanmıştır. Açık küme ayracı devlet omurga Amid rezonanslar kalıntılarının G130 ve A141 ve 3D NMR deneyler24kullanarak epsilon proton yan zinciri rezonans W133 atandı.</li>
	</ol>
</li>
	<li>Örnekleri farklı mıknatıslar veya örnek koşullar doğrudan karşılaştırma için üç açık küme ayracı genlikleri başvuru örneklerinin ortalama ve iki başvuru ile ilgili bir normalleştirme faktörünün hesaplanması normalleştirmek. NBB156 rezonanslar normalleştirme faktörü ve ayar negatif genlikleri (Tablo 2) sıfır olarak kullanarak için ölçekli genlikleri hesaplayın. Örnekler: 1) farklı mıknatıslar örnekleri karşılaştırma: mıknatıs A, NBB156+ DDM ve mıknatıs B, NBB156+ DDM. 2) deterjan karşılaştırma: 0,34 mM DDM ve 1.7 mM DDM.</li>
	<li>Ölçekli kesir, kapalı - veya açık-tüm spectra ürününün için maksimum minimum genlik yelpazesi ile bölünerek küme ayracı içeren uygun başvuruları ücretsiz NBB156 ve tamamen açık ayraç NBB156 içinde toplanan her rezonans için hesaplamak deterjan.</li>
	<li>Normalleştirilmiş NMR genlikleri lipid konsantrasyonu bir fonksiyonu olarak arsa ve açık küme ayracı NBB156 farklı koşullarda (şekil. 5 C) kısmını karşılaştırın. Not: Alternatif olarak, kapalı küme ayracı conformation lipid konsantrasyon karşı kısmını analizini NBB156lipid bağlama karşılaştırmak için gerçekleştirilebilir. Çünkü bu daha hızlı ve lipidler tarafından daha iyi kesir raporlarda tam-nişanlı eski analiz tercih ederim.</li>
</ol>

<ol>
	<li>Weinlich, R., Oberst, A., Beere, H. M., Green, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Necroptosis+in+development,+inflammation+and+disease.">Necroptosis in development, inflammation and disease.</a> Nature Reviews Molecular Cell Biology. 18 (2), 127-136 (2017).</li><li>Kaiser, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIP3+mediates+the+embryonic+lethality+of+caspase-8-deficient+mice.">RIP3 mediates the embryonic lethality of caspase-8-deficient mice.</a> Nature. 471 (7338), 368-372 (2011).</li><li>Murphy, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pseudokinase+MLKL+mediates+necroptosis+via+a+molecular+switch+mechanism.">The pseudokinase MLKL mediates necroptosis via a molecular switch mechanism.</a> Immunity. 39 (3), 443-453 (2013).</li><li>Oberst, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+activity+of+the+caspase-8-FLIP(L)+complex+inhibits+RIPK3-dependent+necrosis.">Catalytic activity of the caspase-8-FLIP(L) complex inhibits RIPK3-dependent necrosis.</a> Nature. 471 (7338), 363-367 (2011).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+complementation+between+FADD+and+RIP1+in+embryos+and+lymphocytes.">Functional complementation between FADD and RIP1 in embryos and lymphocytes.</a> Nature. 471 (7338), 373-376 (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137 (6), 1100-1111 (2009).</li><li>Dondelinger, Y., Hulpiau, P., Saeys, Y., Bertrand, M. J. M., Vandenabeele, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionary+perspective+on+the+necroptotic+pathway.">An evolutionary perspective on the necroptotic pathway.</a> Trends in Cell Biology. 26 (10), 721-732 (2016).</li><li>Newton, K., Manning, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Necroptosis+and+Inflammation.">Necroptosis and Inflammation.</a> Annual Review of Biochemistry. 85, 743-763 (2016).</li><li>Kaiser, W. J., Upton, J. W., Mocarski, E. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+modulation+of+programmed+necrosis.">Viral modulation of programmed necrosis.</a> Current Opinion in Virology. 3 (3), 296-306 (2013).</li><li>Newton, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPK3+deficiency+or+catalytically+inactive+RIPK1+provides+greater+benefit+than+MLKL+deficiency+in+mouse+models+of+inflammation+and+tissue+injury.">RIPK3 deficiency or catalytically inactive RIPK1 provides greater benefit than MLKL deficiency in mouse models of inflammation and tissue injury.</a> Cell Death &amp; Differentiation. 23 (9), 1565-1576 (2016).</li><li>Kearney, C. J., Martin, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Inflammatory+Perspective+on+Necroptosis.">An Inflammatory Perspective on Necroptosis.</a> Molecular Cell. 65 (6), 965-973 (2017).</li><li>Pasparakis, M., Vandenabeele, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Necroptosis+and+its+role+in+inflammation.">Necroptosis and its role in inflammation.</a> Nature. 517 (7534), 311-320 (2015).</li><li>Sun, L., Wang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+kind+of+cell+suicide:+mechanisms+and+functions+of+programmed+necrosis.">A new kind of cell suicide: mechanisms and functions of programmed necrosis.</a> Trends in Biochemical Sciences. 39 (12), 587-593 (2014).</li><li>Grootjans, S., Vanden Berghe, T., Vandenabeele, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Initiation+and+execution+mechanisms+of+necroptosis:+an+overview.">Initiation and execution mechanisms of necroptosis: an overview.</a> Cell Death &amp; Differentiation. 24 (7), 1184-1195 (2017).</li><li>Sun, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mixed+lineage+kinase+domain-like+protein+mediates+necrosis+signaling+downstream+of+RIP3+kinase.">Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase.</a> Cell. 148 (1-2), 213-227 (2012).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mixed+lineage+kinase+domain-like+protein+MLKL+causes+necrotic+membrane+disruption+upon+phosphorylation+by+RIP3.">Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3.</a> Molecular Cell. 54 (1), 133-146 (2014).</li><li>Cai, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+membrane+translocation+of+trimerized+MLKL+protein+is+required+for+TNF-induced+necroptosis.">Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis.</a> Nature Cell Biology. 16 (1), 55-65 (2014).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+mixed+lineage+kinase+domain-like+protein+to+plasma+membrane+leads+to+necrotic+cell+death.">Translocation of mixed lineage kinase domain-like protein to plasma membrane leads to necrotic cell death.</a> Cell Research. 24 (1), 105-121 (2014).</li><li>Dillon, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPK1+blocks+early+postnatal+lethality+mediated+by+caspase-8+and+RIPK3.">RIPK1 blocks early postnatal lethality mediated by caspase-8 and RIPK3.</a> Cell. 157 (5), 1189-1202 (2014).</li><li>Rickard, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPK1+regulates+RIPK3-MLKL-driven+systemic+inflammation+and+emergency+hematopoiesis.">RIPK1 regulates RIPK3-MLKL-driven systemic inflammation and emergency hematopoiesis.</a> Cell. 157 (5), 1175-1188 (2014).</li><li>Kaiser, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toll-like+receptor+3-mediated+necrosis+via+TRIF,+RIP3,+and+MLKL.">Toll-like receptor 3-mediated necrosis via TRIF, RIP3, and MLKL.</a> Journal of Biological Chemistry. 288 (43), 31268-31279 (2013).</li><li>Upton, J. W., Kaiser, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DAI+Another+Way:+Necroptotic+Control+of+Viral+Infection.">DAI Another Way: Necroptotic Control of Viral Infection.</a> Cell Host &amp; Microbe. 21 (3), 290-293 (2017).</li><li>Tanzer, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Necroptosis+signalling+is+tuned+by+phosphorylation+of+MLKL+residues+outside+the+pseudokinase+domain+activation+loop.">Necroptosis signalling is tuned by phosphorylation of MLKL residues outside the pseudokinase domain activation loop.</a> Biochemical Journal. 471 (2), 255-265 (2015).</li><li>Quarato, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Engagement+of+Distinct+MLKL+Phosphatidylinositol-Binding+Sites+Executes+Necroptosis.">Sequential Engagement of Distinct MLKL Phosphatidylinositol-Binding Sites Executes Necroptosis.</a> Molecular Cell. 61 (4), 589-601 (2016).</li><li>Davies, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+brace+helices+of+MLKL+mediate+interdomain+communication+and+oligomerisation+to+regulate+cell+death+by+necroptosis.">The brace helices of MLKL mediate interdomain communication and oligomerisation to regulate cell death by necroptosis.</a> Cell Death &amp; Differentiation. , (2018).</li><li>Su, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+plug+release+mechanism+for+membrane+permeation+by+MLKL.">A plug release mechanism for membrane permeation by MLKL.</a> Structure. 22 (10), 1489-1500 (2014).</li><li>Dondelinger, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MLKL+compromises+plasma+membrane+integrity+by+binding+to+phosphatidylinositol+phosphates.">MLKL compromises plasma membrane integrity by binding to phosphatidylinositol phosphates.</a> Cell Reports. 7 (4), 971-981 (2014).</li><li>Llambi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BOK+Is+a+Non-canonical+BCL-2+Family+Effector+of+Apoptosis+Regulated+by+ER-Associated+Degradation.">BOK Is a Non-canonical BCL-2 Family Effector of Apoptosis Regulated by ER-Associated Degradation.</a> Cell. 165 (2), 421-433 (2016).</li><li>Malkani, N., Schmid, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Some+secrets+of+fluorescent+proteins:+distinct+bleaching+in+various+mounting+fluids+and+photoactivation+of+cyan+fluorescent+proteins+at+YFP-excitation.">Some secrets of fluorescent proteins: distinct bleaching in various mounting fluids and photoactivation of cyan fluorescent proteins at YFP-excitation.</a> PLoS One. 6 (4), 18586 (2011).</li><li>Perez, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+workflow+for+the+automatic+segmentation+of+organelles+in+electron+microscopy+image+stacks.">A workflow for the automatic segmentation of organelles in electron microscopy image stacks.</a> Frontiers in Neuroanatomy. 8, 126 (2014).</li><li>Walton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lead+aspartate,+an+en+bloc+contrast+stain+particularly+useful+for+ultrastructural+enzymology.">Lead aspartate, an en bloc contrast stain particularly useful for ultrastructural enzymology.</a> Journal of Histochemistry &amp; Cytochemistry. 27 (10), 1337-1342 (1979).</li><li>Denk, W., Horstmann, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+block-face+scanning+electron+microscopy+to+reconstruct+three-dimensional+tissue+nanostructure.">Serial block-face scanning electron microscopy to reconstruct three-dimensional tissue nanostructure.</a> PLoS Biology. 2 (11), 329 (2004).</li><li>Rossi, P., Xia, Y., Khanra, N., Veglia, G., Kalodimos, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=15N+and+13C-+SOFAST-HMQC+editing+enhances+3D-NOESY+sensitivity+in+highly+deuterated,+selectively+[1H,13C]-labeled+proteins.">15N and 13C- SOFAST-HMQC editing enhances 3D-NOESY sensitivity in highly deuterated, selectively [1H,13C]-labeled proteins.</a> Journal of Biomolecular NMR. 66 (4), 259-271 (2016).</li><li>Keller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+computer+aided+resonance+assignment+tutorial.">The computer aided resonance assignment tutorial.</a> Cantina Verlag. , (2004).</li><li>Chen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+sequence+determinants+control+human+and+mouse+receptor+interacting+protein+3+(RIP3)+and+mixed+lineage+kinase+domain-like+(MLKL)+interaction+in+necroptotic+signaling.">Diverse sequence determinants control human and mouse receptor interacting protein 3 (RIP3) and mixed lineage kinase domain-like (MLKL) interaction in necroptotic signaling.</a> Journal of Biological Chemistry. 288 (23), 16247-16261 (2013).</li><li>Tanzer, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+divergence+of+the+necroptosis+effector+MLKL.">Evolutionary divergence of the necroptosis effector MLKL.</a> Cell Death &amp; Differentiation. 23 (7), 1185-1197 (2016).</li></ol>

MLKL plazma zarı yırtılması24sözde cellat karıştığı için kombine teknikleri için iletişim kuralları sağlar. Necroptosis MLKL-aracılı düzenleyen yasal ağ deşifre ek olarak, bu tekniklerin uygun diğer biyolojik sistemleri tanımlamak için bağımsız olarak kullanılabilir. Pratik olarak konuşursak, bu teknikleri orta-düşük verimi keşif araçları vardır.
Biz düzenli olarak canlı hücre görüntüleme NBB140kullandık-2xFV-Venüs-aracılık necroptosis ve mechanistically necroptosis mutagenesis ve küçük molekül kimyasal kullanarak MLKL Yönetmelikte incelemek için diğer MLKL yapıları tarafından indüklenen sondalar. Özellikle, biz ve diğer gruplar bu insan göstermiştir ve NBB en az bölge içeren fare yapıları MLKL, necroptosis insan ve fare hücre hatları aracılık. Bir necroptosis MLKL-aracılı yöneten bilmeniz gereken türler özgüllük ters yönde stimülasyon TNF, şaplak atmak mimetics ve caspase inhibisyon kombinasyonu tarafından gözlenen türler arasında olan engeller RIPK3 ve MLKL etkileşim bildirilir 25,35,36. Buna göre insan ve RIPK3 fare ve MLKL proteinler altında bu koşullar25,35,36cross-react değil. Türler arası kısıtlamaları bypass için biz insan MLKL etkinleştirmek veya Oligomerizasyonda kaset burada gösterildiği gibi kullanın NBB140için mutasyonlar tanıtmak-2xFV-Venüs24. İnsan NBB140 için inhibitör bölge tutar ve bu nedenle NBB140bağlamında devre dışı kalır bir yapısı-2xFV-Venüs. 2xFV dimerization brace serbest bırakarak NBB140 etkinleştirmek için düşünülmektedir. Buna ek olarak, bu oluşumu kendiliğinden24oligomerize mümkün olduğundan insan NBB182 Oligomerizasyonda, yokluğunda bile necroptosis neden olmaktadır. Ayrıca, mutantlar (R30A, R30E, E136A ve E136R) işaret tam uzunlukta insan MLKL bağlamında NB bölgede aktive üstesinden gelmek için harekete geçirmek ihtiyaç RIPK3 fosforilasyon24tarafından. Ayrıca, dimerizable insan RIPK3 yeniden (Cerulean-2xFV-RIPK3) ve Dox indüklenebilir tam uzunlukta insan MLKL-uyumlu ve sağlam ripk3- / - mlkl- / - MEFs24 necroptosis neden Venüs, . Diğerleri son ek mutasyonlar veya insan-fare etki alanı türler özgüllük engelleri25üstesinden MLKL yapıları takas ortaya.
Biz genellikle 96-şey levha birkaç aralığı bulma deneyler yaparak necroptosis tahlil koşulları optimize. Biz o zaman tamamlayıcı floresan aktif hücre (FACS) sıralama ile çoğullama için yeterli hücre ve western Blot analizleri daha sonra aynı örnekleri üzerinde gerçekleştirilen sağlayan 24-şey kaplamalar, en iyi duruma getirilmiş deneyler ile takip hemen son kez görüntüleme sonra gelin. Şu anda, canlı hücre görüntüleme birçok uygulama etiketleme olasılıklarını sınırlayan yeşil ve kırmızı floresans tespiti temel alır. Yeşil floresan boyalar bir ortak hücre geçirimsiz DNA'ya bağlanıcı floresan boya propidium (PI) iyodür alternatiftir. Çift renk görüntüleme cihazları necroptosis görüntüleme yardımcı programı ve bilgi içeriğini geliştirmek için tamamlayıcı kırmızı veya yeşil flüoresan proteinler ile bu boyalar kullanarak seçeneği sunuyoruz.
MLKL plazma zarı onun aktivasyon sonra translocate yeteneği yapar canlı mikroskobu seçim bu proteinin biyoloji çalışma tekniği ve gerçek zamanlı olarak morfolojik takip etmek temel necroptosis değiştirir. TIRF mikroskobu tümden MLKL protein toplamları plazma zarı üzerinde özellikle plazma zarı Co yerelleştirmek işaretleri huzurunda çalıştırıldığında giderir. LCK-C-RFP plazma zarı Co yerelleştirme24avans olarak kullanılır. Etiket proteinler ile farklı fluorophores, ilgi yetenek da aynı anda birkaç proteinler aynı sürecine dahil aktivite çalışmaya izin verir. Süper çözünürlük mikroskobu yeni nesil kısmen ve standart confocal mikroskobu kırınım sınırı sorunu üstesinden necroptosis MLKL-aracılı'nın ek özellikleri ortaya çıkarmak için bir potansiyele sahiptir.
Plazma zarı permeabilization necroptosis işaretlerinden biridir. Çeşitli teknikler dolaylı olarak ölçmek veya membran yırtığı belirtmek bile sadece EM MLKL tarafından uyarılan plazma zarı bütünlük içinde süreksizliklerin görselleştirebilirsiniz. TEM çözünürlüğü yüksek güç olsa da, SEM daha büyük örnek alanları eşleme yeteneği vardır. Bu özellik, veri, büyük hacim yönetimi yapmak yeni ve güçlü yazılım geliştirme ile kombine SEM yardımcı programında hücre morfolojisi karakterizasyonu geliştirmiştir. Ayrıca, SEM de iyon demeti odaklanmış gibi diğer sistemlerine birleştiğinde 3D imar izin ardışık örnek bölümler tarama yapabiliyor. Bazı sakıncaları EM analiz araçları ve bakım maliyeti, alanında son derece uzman personel ve önemli zaman yatırım gerekliliğini örnek işleme ve analiz içerir.
Nokta leke deneyleri aslında MLKL ve plazma membran fosfolipitler16,27arasında doğrudan bağlantı kurmak için kullanılmaktadır. Bizim lipid NMR tabanlı bağlama tahlil MLKL PIP2 seçim MLKL ligand vurgulama belirli fosfolipid bağlamadaki kesin olarak implicates. Sonuçlarımız asil zinciri doygunluk NBB156 bağlama phosphatidylinositol için zararlı etkisini göstermektedir. Bununla birlikte, nasıl MLKL bağlama PIP2ve potansiyel olarak diğer fosfolipitler, plazma zarı yırtılması kalır bilinmeyen sonuçlanır. Bu iletişim kuralını kullanan diğer fosfolipid bağlama için MLKL için test edilebilir. MLKL ve çeşitli ligandlar mutantlarla lipid bağlama özel katkılar kesin olarak belirlemek için kullanılabilir bizim tahlil MLKL aracılık necroptosis, ortaya çıkan modelleri sınamak için mükemmel bir araç olarak hizmet vermektedir. Ayrıca, bu diğer ilişkili Membran Sistemler için lipid bağlama profillerini sorgulamak için kullanılabilir.

Necroptosis genetik bileşenleri tanımlayan necroptosis dolaylı fizyolojisi ve hastalığı1,2,3,4,5' te test etmek için hayvan modellerinin kullanımı kolaylaştırdı. RIPK3 veya MLKL nakavt farelerde en az dolaylı geliştirme ve yetişkin homeostazı o necroptosis için hayat3,6şart değil ima vardı. Ayrıca, bazı türler ya RIPK3 ya da MLKL genler, necroptosis olmayan temel rolü hayvanların7,8' destek içermez. Öte yandan, çeşitli patolojileri laboratuvarda indüklenen ile nakavt hayvan modelleri zorlu necroptosis inflamasyon, doğuştan gelen bağışıklık ve viral enfeksiyon9,10, önemli bir rol ortaya koymuştur 11 , 12.
Necroptosis etkinleştirilmesi birkaç şekilde farklı doğuştan gelen bağışıklık sensörler sinyal tarafından tüm belgili tanımlık harekete geçirmek RIPK31,13,14hangi sonucu. Active RIPK3 sırayla phosphorylates ve MLKL3,4,5,6,7,8,9,10 etkinleştirir ,11,12,13,14,15,16,17,18. En iyi okudu ve belki de RIPK3 aktivasyonu için önde gelen en karmaşık yolu da apoptozis ya da necroptosis1ikna etmek için sinyal kompleksleri aşağı akım kompozisyona göre hangi bifurcates ölüm reseptör ligasyonu, geçiyor. RIPK1 sinyal tercih edilir ve nişan RIPK319,20sonuç Necroptosis ensues. Bu sonuç kolayca farmakolojik inhibisyon veya caspase 8, bir sözde endojen inhibitörü olan necroptosis koyunda tutar necroptosis genetik silinmesi üzerine tercih edilir. RIPK1 bağlar ve RIPK3'ı etkinleştirir. Necroptosis etkinleştirmek için başka bir yol TLR3/TLR4 Toll benzeri reseptörler sinyal aracılığıyla yürütmektedir ve RIPK3 tır etki alanını içeren bağdaştırıcı indükleyici interferon-β (TRIF)21aktive olduğu. Henüz doğrudan yürütmektedir ve RIPK322etkinleştirir DNA sensör DAI, etkinleştirme tarafından necroptosis tarafından ölmek için başka bir yol olduğunu.
MLKL bir N-terminal helix paket (NB) ve bir düzenleyici küme ayracı bölge3ile bağlantılı bir C-terminal pseudokinase etki alanı (psKD) oluşan sitozolik bir proteindir. Normal hücrelerde, MLKL nereye RIPK314ile etkin olmayan bir karmaşık olduğu düşünülen sitozol bulunur. Harekete geçirmek-in necroptosis MLKL RIPK3 fosforilasyon harekete geçirmek ilmik psKD ve NF ve kaşlı ayraç3,15,23yılında potansiyel olarak ek siteler içinde tetikler. Fosforilasyon ayrılma RIPK314sonuç MLKL konformasyon bir değişiklik neden olmaktadır. Kötü anlaşılır konformasyon değişiklikleri küme ayracı psKD24yayın. 2 sarmal içeren küme ayracı, MLKL Oligomerizasyonda sözde trimer ile C-terminal helix25içine aracılık eder. Brace N-terminal helix membran permeabilization24,26için gerekli olan NB etki alanı engeller. Tecrit NB etki alanı plazma zarı permeabilization ve necroptosis16,24,27ikna etmek yeterlidir. NB pro-necroptotic etkinliği içinde fare embriyonik fibroblastlar MLKL (mlkl- / - MEFs) eksik öldürüldüğüne tanıklık etmişlerdir. NB tercihen fosfolipid phosphatidylinositol 4,5 nükleotittir (PIP2) yürütmektedir bir lipid bağlayıcı etki alanıdır. Biz MLKL, onda MLKL alımı için plazma zarı NB zayıf etkileşimler PIP2 kutup baş grup24ile üzerinden küme ayracı Oligomerizasyonda kolaylaştırır aktivasyon kademeli bir mekanizma önerdi. Membran NB PIP2etkin olmayan MLKL brace tarafından maskeli için bir ek yüksek afinite bağlama sitesinin düzenlenmiş pozlama uğrar. Genel olarak, her ne kadar bu olayların moleküler mekanizması-değil var aydınlatılmamıştır NB birden çok etkileşimler PIP2 ile onun kopmalara önde gelen plazma zarı istikrarsızlaştırmak.
Burada MLKL işlevini necroptosis24cellat tanımlamak için kullanılan belirli yöntemleri gösterilmektedir. Özellikle, biz odaklanmak en az etki alanı MLKL, NB ve küme ayracı (NBB), hangi küme ayracı inhibisyon tarafından düzenlenir ve plazma membran rüptürü ve necroptosis ikna etmek için zorunlu dimerization ile aktif hale getirebilirsiniz. Biz zorunlu uyuşturucu kaynaklı FKBP-aracılı dimerization canlı hücre görüntüleme ve necroptosis geçiren hücrelerin elektron mikroskobu ile birlikte bizim indüklenebilir ifade sistemi açıklanmaktadır. Ayrıca, bizim vitro NMR Analizi NBB etkileşimleri ile phosphatidylinositols (pip) göstermektedir.

<table border="0" cellpadding="0" cellspacing="0" style="width:1175px;" width="1174">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:429px;">Cloning and cell line generation</td>
			<td style="width:229px;"></td>
			<td style="width:323px;"></td>
			<td style="width:193px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pRetroX-TRE3G</td>
			<td>Clontech</td>
			<td>631188</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tet-On transactivator plasmid</td>
			<td></td>
			<td></td>
			<td>Llambi et al., 2016</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mouse Embryonic Fibroblasts (MEFs) mlkl-/-</td>
			<td></td>
			<td></td>
			<td>Dillon et al., 2014</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Blasticidin S Hydrochloride</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP2647100 CAS#3513-03-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell death quantification and live-cell microscopy</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Doxycycline</td>
			<td>Clontech</td>
			<td>631311 CAS# 24390-14-5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">B/B Homodimerizer AP20187</td>
			<td>Takara</td>
			<td>635059 CAS# 195514-80-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYTOX Green</td>
			<td>Thermo Fisher Scientific</td>
			<td>S7020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Syto16</td>
			<td>Thermo Fisher Scientific</td>
			<td>S7578</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NMR</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15N Ammonium Chloride</td>
			<td>Cambridge Isotope Laboratories</td>
			<td>NLM-467-10 CAS# 12125-02-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Deuterated DTT</td>
			<td>Cambridge Isotope Laboratories</td>
			<td>DLM-2622-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Deuterium Oxide</td>
			<td>Sigma Aldrich</td>
			<td>617385-1 CAS# 7789-20-0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">n-Dodecyl-&#946;-D-Maltopyranoside</td>
			<td>Anatrace</td>
			<td>D310 CAS# 69227-93-6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-&#945;-phosphatidylinositol-4,5-bisphosphate (Brain, Porcine) (ammonium salt)</td>
			<td>Avanti Polar Lipids</td>
			<td>840046X CAS# 383907-42-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1,2-distearoyl-sn-glycero-3-phosphoinositol (ammonium salt) (18:0 PI)</td>
			<td>Avanti Polar Lipids</td>
			<td>850143 CAS# 849412-67-5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1,2-dioleoyl-sn-glycero-3-phospho-(1&#39;-myo-inositol) (ammonium salt) (18:1)</td>
			<td>Avanti Polar Lipids</td>
			<td>850149 CAS# 799268-53-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Specialized Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IncuCyte FLR or ZOOM</td>
			<td>Essen BioScience, Inc.</td>
			<td></td>
			<td>Live-cell microscopy imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Helios NanoLab 660 DualBeam&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Electron microscope</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IncuCyte 2011A Rev2 v20111.3.4288 (FLR)</td>
			<td>Essen BioScience, Inc.</td>
			<td>http://www.essenbioscience.com</td>
			<td style="width:193px;">Imaging analysis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FEI MAPS</td>
			<td>Thermo Fisher Scientific</td>
			<td>https://www.fei.com/software/maps/</td>
			<td style="width:193px;">EM analysis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TopSpin v3.2</td>
			<td>Bruker BioSpin</td>
			<td>http://www.bruker.com</td>
			<td style="width:193px;">NMR data collection</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CARA v1.9.1.7</td>
			<td></td>
			<td>http://cara.nmr.ch/&#160;</td>
			<td style="width:193px;">NMR data analysis</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:429px;">Slidebook</td>
			<td style="width:229px;">3i (Intelligent Imaging Innovations)</td>
			<td style="width:323px;">https://www.intelligent-imaging.com/slidebook</td>
			<td style="width:193px;">Confocal microscopy</td>
		</tr>
	</tbody>
</table>

characterization of mlkl-mediated plasma membrane rupture in necroptosis

Necroptosis phosphorylates ve karışık soy kinaz benzeri etki alanı pseudokinase, MLKL rüptürü veya plazma zarı permeabilize, aktive protein kinaz 3 (RIPK3), etkileşim reseptör etkinleştirme tarafından tetiklenen bir programlı hücre ölümü yoludur . Necroptosis otoimmünite, bulaşıcı ve kalp-damar hastalıkları, felç, ateş ve kanser de dahil olmak üzere birden çok patolojileri ile ilişkili inflamatuvar bir yoludur. Burada, MLKL necroptosis plazma zarı kopma cellat olarak karakterize etmek için kullanılan iletişim kurallarını açıklar. Biz necroptosis confocal ve konvansiyonel floresans mikroskobu ile canlı hücre Imaging'i kullanma hücreleri ve sabit hücrelerin elektron mikroskobu, birlikte plazma için sitozol üzerinden MLKL dağıtılması ortaya kullanarak işlem görselleştirmek membran plazma zarı büyük delikler indüksiyon öncesinde. Biz MLKL-aracılı necroptosis sözde modülatörler tanımlamak için lipidler kullanarak vitro nükleer manyetik rezonans (NMR) analiz mevcut. Bu yöntem üzerinde bağlı olarak, biz nicel lipid-bağlama tercihleri ve phosphatidyl inositol fosfatlar (pip) MLKL, plazma zarı hedefleme ve necroptosis permeabilization için gerekli olan kritik bağlayıcı olarak tespit edilmiştir.

Düzenlenmiş necroptosis yürütme canlı hücrelerdeki görselleştirme en az bir kesilmiş yapı, NBB140MLKL indüklenebilir ifade yoluyla mümkün olmuştur-2xFV-Venüs. Bu yapıyı plazma zarı permeabilization ikna yeteneği korur ve Dim kaynaklı Oligomerizasyonda FKBP kaset (2xFV) etkinleştirilir. Biz gözlemlemek ve necroptosis tarafından Imaging, kinetically (her 5 dk) bir hücre geçirimsiz yeşil floresans DNA bağlama boya (Şekil 6A) alımını izleme live-cep mikroskobu ölçmek. Bu indüklenebilir sistemi çok sağlam ve mlkl- / - MEFs tam necroptosis ~ 1 h Dim-aracılı Oligomerizasyonda NBB140hızlı Dox preincubated hücrelerin üzerine içinde gözlenen-2xFV-Venüs (Şekil 1A ). Biz fast-kinetik necroptosis bu şartları bakın. İfade Venüs yalnız ± Dim veya NBB140-2xFV-Venüs Dim yokluğunda değil ikna etmek necroptosis (Şekil 6A). Genellikle en az 3 Çoğalt görüntüleme deneyler nüsha veya quadruplicate 24, 96 veya 384-şey plakaları gerçekleştiriyoruz.
Hızlı-kinetik necroptosis NBB140yürürlüğe dimerization tarafından indüklenen-2xFV-Venüs (Şekil 6A) MLKL rol plazma zarı yırtılması sözde cellat olarak destekler. NBB140dağıtılması görselleştirmek için-2xFV-Venüs'e necroptosis, canlı-hücre confocal mikroskobu sırasında plazma zarı Venüs floresans izlemek için kullanılır. Hücre çevre kaplama görülmektedir, Venüs, kuluçka Dim ile 2-3 dakika içinde hızlı-kinetik necroptosis sırasında (Film 1) yuvarlama kademeli hücre tarafından takip. NBB140-2xFV-Venüs birikimi plazma zarı, hücre ses seviyesinde sitozol-plazma membran-glass arayüzü üzerinde duruluyor TIRF confocal mikroskobu tarafından görüntülenmiştir. Plazma zarı ilişkili Venus puncta, kuluçka Dim (Movie 2) ile 1-2 dk içinde görünür. Böylece, zorlanan Oligomerizasyonda NBB140-2xFV-Venüs, hızlı yeniden dağıtım için plazma zarı neden olmaktadır.
Elektron mikroskobu (SEM) tarama necroptosis geçiren hücrelerdeki morfolojik değişiklikler ortaya çıkarmak için güçlü bir araçtır. NBB140Oligomerizasyonda tarafından indüklenen hızlı necroptosis altında-2xFV-Venüs, değişiklik morfoloji (zaman 0 dk) normal uzun şekillere üzerinden yuvarlak ve kısmen yırtılmış (10 dakika) için (5 dk) arttı ve kapsamlı sitozol bulunduğu çöktü hücreleri (20 dk) (Şekil 6B) ortadan kayboldu. SEM MLKL yerelleştirme plazma zarı için membran rüptürü ile korele yaşamak-cep mikroskobu önceki gözlemler tamamlar. Genel olarak izlemek, değerlendirmek ve necroptosis hücresel düzeyde ölçmek ve NBB140işe bulaştırmak için tamamlayıcı anlamına gelir burada sunulan mikroskobu teknikleri teklif-2xFV-Venüs plazma zarı yırtılması yürütülmesini.
MLKL plazma zarı doğrudan iletişim kurabilirsiniz Eğer belirlemek için rekombinant NBB156kullanarak NMR spektroskopisi tarafından izlenen vitro lipid bağlama deneyler yapmak. Lipid-deterjan micelles deterjan (lipid tanıtımı için araç) sürekli bir konsantrasyon ve değişken lipit konsantrasyonları, kullanarak, seri dilutions 2D NMR spektroskopisi tarafından test için 15N etiketli NBB156 bağlama için hangi monitör bağlama kaynaklı protein değişimler. NBB156 üzerine inhibitör küme ayracı bölge (amino asitler 132-156) kapalı ve helisel yerinden için bağlama lipid (kapalı kaşlı ayracı) açık ve özünde düzensiz biçimi (açık kaşlı ayracı) (Şekil 7 için önemli yapısal değişiklikler geçer A). Her iki conformers (Rakamlar 7B-7 C) karışımları üzerinde kalıntı bilgi başına iki boyutlu NMR spektroskopisi sağlar. Daha önce her iki conformers24omurga amidler atanmış. Kolayca 5A-C rakamlaraçıklandığı gibi belirli bir örnek içinde kapalı ve açık conformers oranlarda izleyebilirsiniz. Bu bağlama tahlil kullanarak, biz NBB156 bağlama için tırtıl (Şekil 5B) bağlama NBB156 için hareketsiz DDM deterjan keşfetmek. Bu tahlil, tam inhibitör küme ayracı açılışında 125 µM (Şekil 5C) ikna en iyi NBB156 ligand PIP2 dir. Buna ek olarak, doymuş (18:0) PI ve doymamış (18:1) PI zavallı NBB156 ligandlar aynı koşullarda (Şekil 5C) açılış kısmi küme ayracı inducing vardır. Bizim lipid NMR tabanlı bağlama tahlil fosfolipitler ile MLKL NBB156 etkileşim için destekleyici kanıt sağlar ve MLKL ve plazma zarı arasında doğrudan bir bağ öneriyor.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58088/58088fig1.jpg"> Şekil 1: Kararlı bir modifiye Tet üzerinde 3 G indüklenebilir sistemi barındıran hücre kültürünü. (A)istikrarlı hücre hatları tarafından retroviral iletim mlkl- / - MEFs pTREX-rtTA-pRetroX-TRE3G-NBB140tarafından takip patlama ile oluşturulan-2xFV-Venüs-puro. Her iletim daha sonraki analizler için geçmeden 1 hafta antibiyotik seçimi izledi. (B) indüklenebilir MLKL ifade sistem şematik gösterimi. Bu sistem 2 ilaç-indüklenebilir düzenleyici merdivenlerinde dayanmaktadır: i) MLKL gen ekspresyonu ve protein üretim (+ Dox) ve II) etkinleştirme Oligomerizasyonda (+ Dim) tarafından. Protein üretim indüklenen zaman peşin + Dox, hızlı-kinetik necroptosis tetiklenebilir + Dim. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58088/58088fig2.jpg"> Resim 2 : Fast-kinetik necroptosis live-hücre görüntüleme ortaya MLKL hızlı membran relocalization. (A)Fast-kinetik Şekil 1B olduğu gibi indüklenen necroptosis izlenen bir görüntüleme sistemi. Necroptosis hücre geçirimsiz yeşil flüoresan boya alımı tarafından attı. (B) canlı hücre görüntüleme fast-kinetik necroptosis epifluorescence ve toplam iç yansıma Floresan (TIRF) mikroskopi analizi ile şematik gösterimi. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58088/58088fig3.jpg"> Şekil 3 : Elektron mikroskobu (SEM) numune hazırlama ve analiz tarama şematik Gösterim. Şekil 1 ' de açıklandığı gibi indüklenen fast-kinetik necroptosis hücrelerden Dim eklenmesinden sonra farklı zaman noktalarda plaka üzerinde sabitlenir. Hücrelerin SEM analiz için kazıma ve havuzu, ağır metal boyama, reçine katıştırma ve 4 bölümde açıklandığı gibi iridyum kaplama hazır mısın. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58088/58088fig4.jpg"> Şekil 4: Örnek hazırlama ve veri toplama için 15N NBB156 ve lipid-deterjan micelles NMR titrations. Bu tahlil ve Analizi genellikle 3-4 gün içinde gerçekleştirilen: 1 gün boyunca, lipid aliquots reçete ve gecede kurutulmuş. 2 gün boyunca, lipid filmleri tahlil arabellek ± deterjanlar, sonicated ve seri olarak seyreltilmiş (iki kat) içinde rehydrated lipid çözüm arabellek lipid içermeyen çözüm ile eşit miktarda karıştırılarak rehydrated. Her seyreltme homojen karıştırma ve lipidler deterjan micelles sonraki dilutions önce içinde dağılımını sağlamak için sonicated. Protein örnekleri seri lipid-deterjan micelle dilutions karışık, uygun NMR tüplerde yüklü, bir SampleCase yükleyici yerleştirilir (veya el ile yüklenen) ve otomatik NMR veri toplama başladı. Sonraki günlerde, NMR veri toplama tamamlandı ve 2D NMR analizi ile izledi. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58088/58088fig5.jpg"> Şekil 5 : NBB156 lipid-bağlama tercihlerini ölçülen 2D NMR kullanarak. (A)(kırmızı) varlığı veya yokluğu 0,34 DDM görselleştirildiği CARA içinde mM 125 µM PI (4,5) P2 (mavi) 1H -15N TROSY spectra 15N-NBB156 için üst üste. (B) rezonanslar genlik ölçümleri ve normalleştirme için kullanılan tek boyutlu dilim. Ham spektrum (yeşil) genlik ve entegrasyon için sınır ile programıyla CARA overlaid. (C) NORMALIZED genlikleri NBB156 fosfoinositid DDM micelles huzurunda, çizilen lipid konsantrasyon karşı. PIP2 tam açılış ayracı neden olmaktadır. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/58088/58088fig6.jpg"> Şekil 6 : Fast-kinetik necroptosis NBB140Oligomerizasyonda tarafından indüklenen-2xFV- mlkl- / - MEFs Venüs. (A)hücre geçirimsiz, DNA'ya bağlanıcı yeşil flüoresan boya alımını yanında yüksek üretilen iş floresans düşsel Necroptosis miktar. Sağlam necroptosis indüksiyon sadece Dim kaynaklı Oligomerizasyonda NBB140gözlenen-2xFV-Venüs, ama değil Dim yokluğunda. Sadece Venüs kontrol deneyleri de gerçekleştirilir. Her koşulda nüsha yapılır ve ortalama çizilir ve SD bir temsilcisi çoğaltır. (B) Fast-kinetik necroptosis indüklenen huzurunda Dim elektron mikroskobu tarama ile görüntülenir. Ders ortaya morfolojik değişiklikler temel necroptosis hücre yuvarlama ve (5 dk), şişme gibi zaman plazma membran (10 dakika) rüptürü ve ekstravazasyonu sitozol (20 dk) tamamlayın. Her örnek zaman 0 dk. hücreleri benzer dizi vardı. Soldan sağa, 26, 32, 23 ve çekirdekleri ile 36 hücreleri içinde yakınlaştırılan alan içerir. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/58088/58088fig7.jpg"> Şekil 7 : NBB156 NMR spektroskopisi tarafından izlenen phosphoinositides için bağlama. (A) 1H -15N TROSY spektrum 15N-NBB156. Rezonanslar kapalı küme ayracı spektrum normalleştirme veya miktar açık durumu için kullanılan kimyasal vardiya kareler veya daire ile sırasıyla vurgulanır. Doğru şematik NMR imzaları yokluğu veya lipid-deterjan micelles varlığı tespit edildi. NBB156 DDM deterjan micelles phosphoinositides yokluğunda bağlanmaz. (B) 1H -15N TROSY spectra 15N-NBB156 ilgili lipid-deterjan micelles varlığında üst üste. (C) tek 1H -15N TROSY spectra 15N-NBB156 ilgili lipid-deterjan micelles B. panelinden varlığında Açık ve kapalı biçimler belirsizliğe yer bırakmadan iki biçimler karışımları yanında hafiye verilen örnekteki iki conformers oranlarda ölçmek. PIP2 MLKL ve plazma membran fosfolipitler arasında doğrudan bir bağlantı sağlayan NBB156 tercih edilen lipid ligand var. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088fig7large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>PCR arabellek (10 x)</td>
			<td>5.0 ΜL</td>
		</tr>
<tr>
<td>DNA şablonu (100 ng/µL)</td>
			<td rowspan="2">1.0 ΜL</td>
		</tr>
<tr>
<td>cDNAs için MLKL, 2 x FKBP, Venüs)</td>
		</tr>
<tr>
<td>dNTPs (25 mM her NTP)</td>
			<td>0.5 ΜL</td>
		</tr>
<tr>
<td>PCR astar ileri (F) (100 ng/µL)</td>
			<td>1.3 ΜL</td>
		</tr>
<tr>
<td>PCR astar ileri (FR (100 ng/µL)</td>
			<td>1.3 ΜL</td>
		</tr>
<tr>
<td>NBB140 F</td>
			<td>ATAATCGATACCATGGAAAATTTGAAGCATATT</td>
		</tr>
<tr>
<td>NBB140 R</td>
			<td>TATGCGGCCGCATCCTGCTGATCTTCCTGTGC</td>
		</tr>
<tr>
<td>2xFKBP F</td>
			<td>ATAGCGGCCGCAGGCGTCCAAGTCGAAACCATT</td>
		</tr>
<tr>
<td>2xFKBP R</td>
			<td>TATGCGGCCGCTTCCAGTTTTAGAAGCTCCAC</td>
		</tr>
<tr>
<td>Venüs F</td>
			<td>ATAGGGCCCACCATGGTGAGCAAGGGCGAG</td>
		</tr>
<tr>
<td>Venüs R</td>
			<td>TATGAATTCTTACTTGTACAGCTCGTC</td>
		</tr>
<tr>
<td>DNA polimeraz (2.5 U/µL)</td>
			<td>1.0 ΜL</td>
		</tr>
<tr>
<td>Distile deiyonize su (GKD2O)</td>
			<td>39.9 ΜL</td>
		</tr>
<tr>
<td>Toplam reaksiyon birim</td>
			<td>50.0 ΜL</td>
		</tr>
<tr>
<td>PCR Bisiklete binme parametreleri</td>
			<td></td>
		</tr>
<tr>
<td>1 döngüsü</td>
			<td>94-98 ° C; 45 s</td>
		</tr>
<tr>
<td rowspan="3">25 – 30 döngüleri</td>
			<td>94-98 ° C; 45 s</td>
		</tr>
<tr>
<td>58 ° C; 45 s</td>
		</tr>
<tr>
<td>72 ° C; 1-2 dk</td>
		</tr>
<tr>
<td>1 döngüsü</td>
			<td>72 ° C; 10 dk</td>
		</tr>
</tbody></table>Tablo 1: NB PCR reaksiyon 140 -2xFV-Venüs Restriksiyon enzimi tabanlı pRetroX-TRE3G içinde klonlama için.
<img alt="Table 2" src="/files/ftp_upload/58088/58088tbl2v2.jpg"> Tablo 2: NMR spectra normalleştirilmiş dönüşümün veri gösteren şekil 5'te sunulan için ham veri toplanan ikinci NMR mıknatısa Hesaplanan Ortalama Açık ayraç durumuna. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/58088tbl2v2large.jpg" target="_blank">Bu tablo daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Movie 1" src="/files/ftp_upload/58088/58088movie1.jpg"> Film 1: Fast-kinetik necroptosis indüklenen NBB Oligomerizasyonda tarafından 140 -2xFV-Venüs mlkl- / - MEFs. NBB140hızlı translocation gösterilen confocal mikroskobu canlı-2xFV-Venüs sitozol'ten sonra FKBP etki zorunlu Oligomerizasyonda plazma zarı için. Hücreleri Şekil 1'de açıklandığı gibi tedavi edildi. Sarı: NBB140-2xFV-Venüs. Bu videoyu izlemek için <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/Movie1.mov" target="_blank">lütfen buraya tıklayın. (İndirmek için sağ tıklatın.)</a>
<img alt="Movie 2" src="/files/ftp_upload/58088/58088movie2.jpg"> Movie 2: fast-kinetik necroptosis TIRF mikroskobu. Plazma zarı mlkl- / - NBB140ifade MEFs loş eklenmesi üzerine hızlı (~ 2 dk) relocalization ve MLKL agregasyon gösteren TIRF mikroskobu-2xFV-Venüs. Bu videoyu izlemek için <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58088/Movie2.mp4" target="_blank">lütfen buraya tıklayın. (İndirmek için sağ tıklatın.)</a>

Watch this Scientific Journal Video about Characterization of MLKL-mediated Plasma Membrane Rupture in Necroptosis at JoVE.com

Characterization of MLKL-mediated Plasma Membrane Rupture in Necroptosis

Biz yöntemleri konvansiyonel ve confocal live-cep mikroskobu görüntüleme, dahil olmak üzere necroptosis MLKL-aracılı plazma zarı kopma karakterizasyonu için scanning elektron mikroskobu ve lipid NMR tabanlı bağlama raporu.

Necroptosis MLKL-aracılı plazma zarı kopma karakterizasyonu

Necroptosis is a programmed cell death pathway triggered by activation of receptor interacting protein kinase 3 (RIPK3), which phosphorylates and ...

characterization-mlkl-mediated-plasma-membrane-rupture

Nanyang Technological University

Research

JoVE Journal

Biology

10.7K Görüntüleme.  St. Jude Children's Research Hospital. Biz yöntemleri konvansiyonel ve confocal live-cep mikroskobu görüntüleme, dahil olmak üzere necroptosis MLKL-aracılı plazma zarı kopma karakterizasyonu için scanning elektron mikroskobu ve lipid NMR tabanlı bağlama raporu.

Video: Characterization of MLKL-mediated Plasma Membrane Rupture in Necroptosis

Measuring Near Plasma Membrane and Global Intracellular Calcium Dynamics in Astrocytes

The brain contains glial cells.  Astrocytes, a type of glial cell, have long been known to provide a passive supportive role to neurons. However, increasing evidence suggests that astrocytes may also actively participate in brain function through functional interactions with neurons.  However, many fundamental aspects of astrocyte biology remain controversial, unclear and/or experimentally unexplored. One important issue is the dynamics of intracellular calcium transients in astrocytes. This is relevant because calcium is well established as an important second messenger and because it has been proposed that astrocyte calcium elevations can trigger the release of transmitters from astrocytes. However, there has not been any detailed or satisfying description of near plasma membrane calcium signaling in astrocytes. Total internal reflection fluorescence (TIRF) microscopy is a powerful tool to analyze physiologically relevant signaling events within about 100 nm of the plasma membrane of live cells. Here, we use TIRF microscopy and describe how to monitor near plasma membrane and global intracellular calcium dynamics almost simultaneously. The further refinement and systematic application of this approach has the potential to inform about the precise details of astrocyte calcium signaling. A detailed understanding of astrocyte calcium dynamics may provide a basis to understand if, how, when and why astrocytes and neurons undergo calcium-dependent functional interactions.

We describe how to measure near membrane and global intracellular calcium dynamics in cultured astrocytes using total internal reflection and epifluorescence microscopy.

Astrositler Plazma Membran ve Küresel Hücre içi kalsiyum Dynamics civarında Ölçüm

The brain contains glial cells.  Astrocytes, a type of glial cell, have long been known to provide a passive supportive role to neurons. However, ...

Biyoloji

Measuring Plasma Membrane Protein Endocytic Rates by Reversible Biotinylation

Plasma membrane proteins are a large, diverse group of proteins comprised of receptors, ion channels, transporters and pumps.  Activity of these proteins is responsible for a variety of key cellular events, including nutrient delivery, cellular excitability, and chemical signaling.  Many plasma membrane proteins are dynamically regulated by endocytic trafficking, which modulates protein function by altering protein surface expression.  The mechanisms that facilitate protein endocytosis are complex and are not fully understood for many membrane proteins.  In order to fully understand the mechanisms that control the endocytic trafficking of a given protein, it is critical that the protein s endocytic rate be precisely measured.  For many receptors, direct endocytic rate measurements are frequently achieved utilizing labeled receptor ligands.  However, for many classes of membrane proteins, such as transporters, pumps and ion channels, there is no convenient ligand that can be used to measure the endocytic rate.  In the present report, we describe a reversible biotinylation method that we employ to measure the dopamine transporter (DAT) endocytic rate.  This method provides a straightforward approach to measuring internalization rates, and can be easily employed for trafficking studies of most membrane proteins.

Regulated endocytosis governs the cell surface expression levels of the majority of membrane proteins. Here we utilize reducible, membrane impermeant biotinylation reagents to measure the endocytic rate of the dopamine transporter (DAT), a polytopic membrane protein. The method facilitates a straightforward approach to measuring the endocytic rate of most plasma membrane proteins.

Tersinir biyotinilasyon Plazma Membran Protein endositik Oranları Ölçüm

Plasma membrane proteins are a large, diverse group of proteins comprised of receptors, ion channels, transporters and pumps.  Activity of these proteins ...

Quantitative Measurement of GLUT4 Translocation to the Plasma Membrane by Flow Cytometry

Glucose is the main source of energy for the body, requiring constant regulation of its blood concentration. Insulin release by the pancreas induces glucose uptake by insulin-sensitive tissues, most notably the brain, skeletal muscle, and adipocytes. Patients suffering from type-2 diabetes and/or obesity often develop insulin resistance and are unable to control their glucose homeostasis. New insights into the mechanisms of insulin resistance may provide new treatment strategies for type-2 diabetes.
The GLUT family of glucose transporters consists of thirteen members distributed on different tissues throughout the body1. Glucose transporter type 4 (GLUT4) is the major transporter that mediates glucose uptake by insulin sensitive tissues, such as the skeletal muscle. Upon binding of insulin to its receptor, vesicles containing GLUT4 translocate from the cytoplasm to the plasma membrane, inducing glucose uptake. Reduced GLUT4 translocation is one of the causes of insulin resistance in type-2 diabetes2,3.
The translocation of GLUT4 from the cytoplasm to the plasma membrane can be visualized by immunocytochemistry, using fluorophore-conjugated GLUT4-specific antibodies.
Here, we describe a technique to quantify total amounts of GLUT4 translocation to the plasma membrane of cells during a chosen duration, using flow cytometry. This protocol is rapid (less than 4 hours, including incubation with insulin) and allows the analysis of as few as 3,000 cells or as many as 1 million cells per condition in a single experiment. It relies on anti-GLUT4 antibodies directed to an external epitope of the transporter that bind to it as soon as it is exposed to the extracellular medium after translocation to the plasma membrane.

This protocol describes a rapid technique to quantify the translocation of GLUT4 from the cytoplasm to the plasma membrane of cells by flow cytometry.

Akış Sitometri Plazma Membran GLUT4 Translokasyon Kantitatif Ölçüm

Glucose is the main source of energy for the body, requiring constant regulation of its blood concentration. Insulin release by the pancreas induces ...

Mapping Molecular Diffusion in the Plasma Membrane by Multiple-Target Tracing (MTT)

Our goal is to obtain a comprehensive description of molecular processes occurring at cellular membranes in different biological functions. We aim at characterizing the complex organization and dynamics of the plasma membrane at single-molecule level, by developing analytic tools dedicated to Single-Particle Tracking (SPT) at high density: Multiple-Target Tracing (MTT)1. Single-molecule videomicroscopy, offering millisecond and nanometric resolution1-11, allows a detailed representation of membrane organization12-14 by accurately mapping descriptors such as cell receptors localization, mobility, confinement or interactions.
We revisited SPT, both experimentally and algorithmically. Experimental aspects included optimizing setup and cell labeling, with a particular emphasis on reaching the highest possible labeling density, in order to provide a dynamic snapshot of molecular dynamics as it occurs within the membrane. Algorithmic issues concerned each step used for rebuilding trajectories: peaks detection, estimation and reconnection, addressed by specific tools from image analysis15,16. Implementing deflation after detection allows rescuing peaks initially hidden by neighboring, stronger peaks. Of note, improving detection directly impacts reconnection, by reducing gaps within trajectories. Performances have been evaluated using Monte-Carlo simulations for various labeling density and noise values, which typically represent the two major limitations for parallel measurements at high spatiotemporal resolution.
The nanometric accuracy17 obtained for single molecules, using either successive on/off photoswitching or non-linear optics, can deliver exhaustive observations. This is the basis of nanoscopy methods17 such as STORM18, PALM19,20, RESOLFT21 or STED22,23, which may often require imaging fixed samples. The central task is the detection and estimation of diffraction-limited peaks emanating from single-molecules. Hence, providing adequate assumptions such as handling a constant positional accuracy instead of Brownian motion, MTT is straightforwardly suited for nanoscopic analyses. Furthermore, MTT can fundamentally be used at any scale: not only for molecules, but also for cells or animals, for instance. Hence, MTT is a powerful tracking algorithm that finds applications at molecular and cellular scales.

Mapping Molecular Diffusion in the Plasma Membrane by Multiple-Target Tracing MTT

Multiple-Target Tracing is a homemade algorithm developed for tracking individually labeled molecules within the plasma membrane of living cells. Efficiently detecting, estimating and tracing molecules over time at high-density provide a user-friendly, comprehensive tool to investigate nanoscale membrane dynamics.

Çoklu Hedef İzleme (MTT) tarafından Plazma Membran Moleküler Difüzyon Haritalama

Our goal is to obtain a comprehensive description of molecular processes occurring at cellular membranes in different biological functions. We aim at ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Lipidik Mesophases Membran Proteinleri Yüksek throughput Kristalizasyon için bir robot kullanımı

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

The Cell-based L-Glutathione Protection Assays to Study Endocytosis and Recycling of Plasma Membrane Proteins

Membrane trafficking involves transport of proteins from the plasma membrane to the cell interior (i.e. endocytosis) followed by trafficking to lysosomes for degradation or to the plasma membrane for recycling. The cell based L-glutathione protection assays can be used to study endocytosis and recycling of protein receptors, channels, transporters, and adhesion molecules localized at the cell surface. The endocytic assay requires labeling of cell surface proteins with a cell membrane impermeable biotin containing a disulfide bond and the N-hydroxysuccinimide (NHS) ester at 4 &#186;C -&#160;a temperature at which membrane trafficking does not occur. Endocytosis of biotinylated plasma membrane proteins is induced by incubation at 37 &#186;C. Next, the temperature is decreased again to 4 &#186;C to stop endocytic trafficking and the disulfide bond in biotin covalently attached to proteins that have remained at the plasma membrane is reduced with L-glutathione. At this point, only proteins that were endocytosed remain protected from L-glutathione and thus remain biotinylated. After cell lysis, biotinylated proteins are isolated with streptavidin agarose, eluted from agarose, and the biotinylated protein of interest is detected by western blotting. During the recycling assay, after biotinylation cells are incubated at 37 &#176;C to load endocytic vesicles with biotinylated proteins and the disulfide bond in biotin covalently attached to proteins remaining at the plasma membrane is reduced with L-glutathione at 4 &#186;C as in the endocytic assay. Next, cells are incubated again at 37 &#176;C to allow biotinylated proteins from endocytic vesicles to recycle to the plasma membrane. Cells are then incubated at 4 &#186;C, and the disulfide bond in biotin attached to proteins that recycled to the plasma membranes is reduced with L-glutathione. The biotinylated proteins protected from L-glutathione are those that did not recycle to the plasma membrane.

Membrane trafficking involves transport of proteins from the plasma membrane to the cell interior (i.e. endocytosis) followed by trafficking to lysosomes for degradation or to the plasma membrane for recycling. Methods described in this article are designed to study endocytosis and recycling of plasma membrane proteins.

Membrane trafficking involves transport of proteins from the plasma membrane to the cell interior (i.e. endocytosis) followed by trafficking to lysosomes ...

Imaging Plasma Membrane Deformations With pTIRFM

To gain novel insights into the dynamics of exocytosis, our group focuses on the changes in lipid bilayer shape that must be precisely regulated during the fusion of vesicle and plasma membranes. These rapid and localized changes are achieved by dynamic interactions between lipids and specialized proteins that control membrane curvature. The absence of such interactions would not only have devastating consequences for vesicle fusion, but a host of other cellular functions that involve control of membrane shape. In recent years, the identity of a number of proteins with membrane-shaping properties has been determined. What remains missing is a roadmap of when, where, and how they act as fusion and content release progress.
Our understanding of the molecular events that enable membrane remodeling has historically been limited by a lack of analytical methods that are sensitive to membrane curvature or have the temporal resolution to track rapid changes. PTIRFM satisfies both of these criteria. We discuss how pTIRFM is implemented to visualize and interpret rapid, submicron changes in the orientation of chromaffin cell membranes during dense core vesicle (DCV) fusion. The chromaffin cells we use are isolated from bovine adrenal glands. The membrane is stained with a lipophilic carbocyanine dye,1,1&#39;-dioctadecyl-3,3,3&#39;,3&#39;-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate, or&#160;diD. DiD intercalates in the membrane plane with a &#34;fixed&#34; orientation and is therefore sensitive to the polarization of the evanescent field. The diD-stained cell membrane is sequentially excited with orthogonal polarizations of a 561&#160;nm laser (p-pol, s-pol). A 488&#160;nm laser is used to visualize vesicle constituents and time the moment of fusion. Exocytosis is triggered by locally perfusing cells with a depolarizing KCl solution. Analysis is performed offline using custom-written software to understand how diD emission intensity changes relate to fusion pore dilation.

Polarization-based Total Internal Reflection Fluorescence Microscopy (pTIRFM) enables real-time detection of cell membrane dynamics. This article describes the implementation of pTIRFM for the study of membrane remodeling during regulated exocytosis. The technique is generalizable to other processes in cell biology that directly or indirectly involve changes in membrane shape.

PTIRFM ile görüntüleme Plazma Membran deformasyonlar

To gain novel insights into the dynamics of exocytosis, our group focuses on the changes in lipid bilayer shape that must be precisely regulated during ...

Functional Characterization of Na+/H+ Exchangers of Intracellular Compartments Using Proton-killing Selection to Express Them at the Plasma Membrane

Endosomal acidification is critical for a wide range of processes, such as protein recycling and degradation, receptor desensitization, and neurotransmitter loading in synaptic vesicles. This acidification is described to be mediated by proton ATPases, coupled to ClC chloride transporters. Highly-conserved electroneutral protons transporters, the Na+/H+ exchangers (NHE) 6, 7 and 9 are also expressed in these compartments. Mutations in their genes have been linked with human cognitive and neurodegenerative diseases. Paradoxically, their roles remain elusive, as their intracellular localization has prevented detailed functional characterization. This manuscript shows a method to solve this problem. This consists of the selection of mutant cell lines, capable of surviving acute cytosolic acidification by retaining intracellular NHEs at the plasma membrane. It then depicts two complementary protocols to measure the ion selectivity and activity of these exchangers: (i) one based on intracellular pH measurements using fluorescence video microscopy, and (ii) one based on the fast kinetics of lithium uptake. Such protocols can be extrapolated to measure other non-electrogenic transporters. Furthermore, the selection procedure presented here generates cells with an intracellular retention defective phenotype. Therefore these cells will also express other vesicular membrane proteins at the plasma membrane. The experimental strategy depicted here may therefore constitute a potentially powerful tool to study other intracellular proteins that will be then expressed at the plasma membrane together with the vesicular Na+/H+ exchangers used for the selection.

Functional Characterization of Na+/H+ Exchangers of Intracellular Compartments Using Proton-killing Selection to Express Them at the Plasma Membrane

The first part of this article shows how to select mutant cell lines expressing vesicular Na+/H+ exchangers at their plasma membrane. The second part provides protocols based on intracellular pH measurements and fast ion uptake, which are used to determine the ion selectivity and the kinetic parameters of these exchangers.

Na fonksiyonel karakterizasyonu<sup&gt; +</sup&gt; / H<sup&gt; +</sup&gt; Seçim Proton-öldürme Kullanma hücre içi Bölmeler ve Eşanjörleri Plazma Membran Them Express

Endosomal acidification is critical for a wide range of processes, such as protein recycling and degradation, receptor desensitization, and ...

Microperfusion Technique to Investigate Regulation of Microvessel Permeability in Rat Mesentery

Experiments to measure the permeability properties of individually perfused microvessels provide a bridge between investigation of molecular and cellular mechanisms regulating vascular permeability in cultured endothelial cell monolayers and the functional exchange properties of whole microvascular beds. A method to cannulate and perfuse venular microvessels of rat mesentery and measure the hydraulic conductivity of the microvessel wall is described. The main equipment needed includes an intravital microscope with a large modified stage that supports micromanipulators to position three different microtools: (1) a beveled glass micropipette to cannulate and perfuse the microvessel; (2) a glass micro-occluder to transiently block perfusion and enable measurement of transvascular water flow movement at a measured hydrostatic pressure, and (3) a blunt glass rod to stabilize the mesenteric tissue at the site of cannulation. The modified Landis micro-occlusion technique uses red cells suspended in the artificial perfusate as markers of transvascular fluid movement, and also enables repeated measurements of these flows as experimental conditions are changed and hydrostatic and colloid osmotic pressure difference across the microvessels are carefully controlled. Measurements of hydraulic conductivity first using a control perfusate, then after re-cannulation of the same microvessel with the test perfusates enable paired comparisons of the microvessel response under these well-controlled conditions. Attempts to extend the method to microvessels in the mesentery of mice with genetic modifications expected to modify vascular permeability were severely limited because of the absence of long straight and unbranched microvessels in the mouse mesentery, but the recent availability of the rats with similar genetic modifications using the CRISPR/Cas9 technology is expected to open new areas of investigation where the methods described herein can be applied.

The modified Landis technique enables paired measurement of the hydraulic conductivity of individual microvessels in the mesentery of normal and genetically modified rats under control and test conditions using microperfusion techniques. It provides a convenient method to evaluate mechanisms that regulate microvessel permeability and transvascular exchange under physiological conditions.

Şekilde, mikro Tekniği Sıçan mezenter mikrodamar geçirgenliği Yönetmelik Araştırma

Experiments to measure the permeability properties of individually perfused microvessels provide a bridge between investigation of molecular and cellular ...

Ground State Depletion Super-resolution Imaging in Mammalian Cells

Advances in fluorescent microscopy and cell biology are intimately correlated, with the enhanced ability to visualize cellular events often leading to dramatic leaps in our understanding of how cells function. The development and availability of super-resolution microscopy has considerably extended the limits of optical resolution from ~250-20 nm. Biologists are no longer limited to describing molecular interactions in terms of colocalization within a diffraction limited area, rather it is now possible to visualize the dynamic interactions of individual molecules. Here, we outline a protocol for the visualization and quantification of cellular proteins by ground-state depletion microscopy&#160;for fixed cell imaging. We provide examples from two different membrane proteins, an element of the endoplasmic reticulum translocon, sec61&#946;, and a plasma membrane-localized voltage-gated L-type Ca2+ channel (CaV1.2). Discussed are the specific microscope parameters, fixation methods, photo-switching buffer formulation, and pitfalls and challenges of image processing.

This article outlines a protocol for the detection of one or more plasma and/or intracellular membrane proteins using Ground State Depletion (GSD) super-resolution microscopy in mammalian cells. Here, we discuss the benefits and considerations of using such approaches for the visualization and quantification of cellular proteins.

Memeli hücrelerinde devlet tükenmesi süper kararlılık düşsel yer

Advances in fluorescent microscopy and cell biology are intimately correlated, with the enhanced ability to visualize cellular events often leading to ...