Bu eser bir kariyer Ödülü (grant numarası DBI-1253293); aracılığıyla Ulusal Bilim Vakfı tarafından desteklenmiştir Ulusal Sağlık Enstitüleri (NIH) (grant numaraları HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); ve Savunma İleri Araştırma Projeleri Ajansı yaşayan dökümhaneler Program (sözleşme numaralarını HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol>
	<li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumour+evolution+inferred+by+single-cell+sequencing.">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li><li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients.">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li><li>Schmidt, H., Hensel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+islands+in+bacterial+pathogenesis.">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li><li>Mart&#237;nez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+strategies+associated+with+bacterial+infection:+pathogenicity+epidemicity,+and+antibiotic+resistance.">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics.">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter.">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li><li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+tweezers+for+single+cells.">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li><li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing.">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li><li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics.">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets.">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells.">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+single-cell+labeling+(Hi-SCL)+for+RNA-Seq+using+drop-based+microfluidics.">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li><li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing.">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li><li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing.">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li><li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing.">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li><li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding.">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li><li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions.">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li><li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota.">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects.">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li><li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beating+Poisson+encapsulation+statistics+using+close-packed+ordering.">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628 (2009).</li><li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics.">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472 (2012).</li><li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun.">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li><li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells.">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li><li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment.">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550 (2013).</li><li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes.">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li><li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+metagenomic+sequences:+methods+and+challenges.">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li><li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+droplet+enrichment+for+targeted+sequencing.">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86 (2015).</li><li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Finding+a+helix+in+a+haystack:+nucleic+acid+cytometry+with+droplet+microfluidics.">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li></ol>

Bu iş akışı ile ilgili patent olabilir misyonu biyo için hangi Adam R. Abate lisanslı bir hissedar olduğunu.

SIC seq mikrosıvısal iş akışı binlerce bakteri hücreleri tek hücre genomu sıralama veri üretir. Dijital barkod microgel kapsüllenmiş hücrelerin genleri spliced NGS veri silico deconvolution içine aynı hücreden kaynaklanan barkodlu okuma grupları için izin verir. Bilinen bileşimi gibi bir mikrobiyal topluluğu ile bir denetim deneme barkod grupları saflığı değerlendirmek için gereklidir. Yüksek saflıkta gruplar büyük bir kısmı hücre sarma hızı çok yüksekse veya önemli damlacık çapraz bulaşma mikrosıvısal işlem adımları sırasında meydana gelen gösterir. Poisson istatistiklere göre barkod ve hücreleri 1 parçacık oranı tüm boş olmayan damlacıklar % 5'den az birden fazla kapsülleme olayların sınırlamak her 10 damla için hedef oranında kapsüllü. Kapsülleme oranı doğrulama dropmaking işlemi sırasında kritik önemini bu yüzden bundan daha yüksek bir kapsülleme oranı katlanarak, birini oranda artırır. Farklı hücrelerdeki aynı barkod sıra paylaşımı okuma bioinformatically ayrılmış olamaz, çünkü kullanıcılar birden çok hücreyi tek bir microgel kapsüllemenin özellikle dikkatli olmanız gerekir. Durumda 1 hücre 2 farklı barkod alır, bereket ölçümleri barkod sırası tarafından sayarken etkiye sahip olsa da barkod grup saflık etkilenmez.
Damlacık çapraz bulaşma da suboptimal birleşme koşulları nedeniyle ortaya çıkabilir. Başarılı bir operasyon sırasında mikrosıvısal birleşme aygıt (Şekil 5) controllably 1 microgel ile 1 barkod damlacık ve PCR reaktif hacmi eşleştirebilirsiniz. Sigara-mükemmel akış oranları yanlış oranlarıyla eşleştirme damlacık neden olacaktır: 1 barkod 2 microgels ile örneğin eşleştirilmiş. Protokol listelenen tüm akış oranları tahminleri olması amaçlanmıştır ve aygıt geometri ve damlacık boyutlarda küçük farklılıklar bağlı olarak ayarlanması gerekebilir. Fotoğraf makinesi ile yüksek hızlı kayıt yeteneklere erişimi olan kullanıcılar (> 10.000 kare/s) doğru damlacık birleşme başında ve mikrosıvısal işlemi boyunca doğrulamanız gerekir. Bir yüksek hızlı kamera erişimi olmayan kullanıcılar birleştirilmiş çıktı küçük bir hacim toplamak ve el ile mikroskop altında damlacık boyutları ölçmek. Damlacık boyutu düzgün olmalıdır: reinjection gore buna göre azaltılacak birleştirilmemiş barkodlar veya microgel damla bir fazlalığı gösterir.
Kendi bütünlüğünü korumak için microgels ve microdroplets ele alırken birkaç genel önlemler alınmalıdır. Microgels, mekanik olarak sağlam olsa da, yeterince kırma ve tam jelleşme sağlamak için gereken adımları yıkama önce soğutmalı gerekir. Sigara küresel microgels özel değildi bir gösterge vardır kuvvetlendirmek için yeterli zaman verilirse. Microgels yıkarken, süspansiyonlar ürün kayıplarını önlemek için gerekli hızlarda spin aşağı. Özel hidrojel su yakından eşleşen bir kırılma indisi vardır ve kullanıcılar dikkatli aspirasyon öncesinde jel sıvı sınır belirlemek gerekir bu yüzden tüp22içinde görmek zor olabilir. Petrol su damlacıkları birleştirme tarafından statik kuvvetleri23 laboratuvar eldiven ve boru birikmesi yatkındır. Bu nedenle, damlacık reinjection şırınga çıplak elle yükleme ve pompa priming önce bir anti-statik silahla reinjection çizgilerin tedavisinde önerilir. Büyük birleştiler damlacıkları yavaş yavaş şırınga emülsiyonlar döner ve el ile onların büyük batmaz kuvvet nedeniyle üst biriktikçe daha büyük damla aspirating tarafından kaldırılabilir.
SiC-seq olduğunu, tek hücreli genom sıralama göstermek için ilk teknoloji > 50.000 bakteri hücreleri. Bu platform varolan yaklaşımlar içinde üretilen iş önemli avantaj sunar ve türdeş olmayan mikrobiyal topluluklar daha derin bir örnekleme sağlar. Bugüne kadar mikrosıvısal teknolojileri tek hücreli genom sıralama için microchambers9 ve microwells24 hücre izolasyon ve güçlendirme için ama sadece onlarca yüzlerce hücre aralığındaki throughputs ile istihdam. Akış tek hücreleri wellplates5,6 ' sıralama hiçbir özel mikrosıvısal araçları gerektirir ama aynı şekilde düşük bir üretilen iş sahip. Verilen bu çevreden toprak ve su örnekleri sık, Alfa farklılıkların var > 1.000 türler, seviye25,26, SIC seq organizmalar çok daha fazla sayıda örnek için onun yetenek sayesinde son derece avantajlı. SIC seq iş akışı laboratuvar kültür, doğal çevre, ya da bir yaşam ana hücre girişleri için uyarlanabilir kaynaklanıyor. Bir hücre örneği yalnızca bir sulu süspansiyon olması ve büyük parçacıkların ücretsiz (> 10 µm) uygun mikrosıvısal Kapsülleme için olmak. Örneğin, yöntem bir örnek yıkama bir dizi kullanarak ve hücreleri kapsülleme17önce ön işlemden için adımları filtreleme deniz suyu daha önce uygulandı.
SIC seq Protokolü nispeten seyrek bir sıralama veri miktarı her tek hücreden oluşturur ve tüm uygulamalar için uygun olmayabilir. Arama bazı Biyoinformatik algoritmaları de novo genom derleme veya tek nükleotid varyant (SNV) gibi verimli çalışması için daha yüksek kapsama derinlikleri gerektirir. Bunun yerine, böylece algoritmalar okuma büyük kümeleri üzerinde uygulanabilir barkod grupları kümelenmiş silico taksonomik binning yöntemleri27 tarafından olabilir. Nispeten düşük tüm tedarikçilerden etkinliğini SIC seq iş akışının da giriş örnek durumu düşük nerede durumlarda zorluklar takdim edebilir miyim? SiC-seq bir Poisson dağıtılmış barkod kapsülleme basamakta dayanır, bu nedenle hücreleri yaklaşık yüzde 10'u moleküler bir barkod almak ve son Kütüphane hazırlık adımı sırasında güçlendirilmiş. Bu diğer tedarikçilerden microdroplet tabanlı düzenleri10' a benzer olmakla birlikte, değerli hücre örnekleri ile çalışan kullanıcılar sıralama için yeterli kitaplığı verimi elde zorluk olabilir ve PCR döngüleri son sayısını artırmak gerekebilir amplifikasyon adım. Başka bir potansiyel kullanıcıları için mikrosıvısal uzmanlığı ile böylece genel barkodlama verimlilik getiren dijital PCR adım sonra olumlu barkod damlacıkları sıralamak için çözümdür > % 8528.
Bir potansiyel gelecekteki yönünü SIC seq teknolojisi için iş akışı yeni klinik tek hücre çalışmaları için önünü memeli hücreleri ile kullanmak için adapte olduğunu. Örnek olarak, kopya numarası varyasyon tek kanser arasında bir analizini hücreleri Mayıs heterojenite kanser patoloji2' deki rolü bizim anlayış daha fazla. Alternatif olarak, SIC seq yoklama ve DNA dizileri faiz29 zenginleştirmek için mevcut yöntemler ile entegre altgrupları hedeflenen tek hücreli sıralama veya hücrelerin nadir suşları sağlayacak. Çevre örnekleri ile bilinen bir metabolik yolu üzerinden genlerde hedef olabilir ve Roman genomik Adaları tanımlamak için genlerin komşu yanında içeriksel analiz. Gelen bir insan ana bilgisayar ortamında düşük-titresi patojen bakteri örnekleri izole olabilir ve daha fazla incelemek için tek hücre düzeyinde yakından virülans genotypic onların kökeni sıralı.

Hücresel kimlik ve işlevi, bir organizmanın tamamını içeren bir plan potansiyel kodlama'nın genom hizmet vermektedir. Genom düzeyinde Hücresel biyoloji bir anlayış türdeş olmayan hücre popülasyonlarının içinde gözlenen fenotipik çeşitlilik açıklayabilir. Bu heterojenlik biyolojik sistemlerde belirgindir ve insan sağlığı ve hastalığı geniş etkiler. Örneğin, tümör hücreleri arasında gen kopya numarası varyasyonlar evrim ve yayılmasını kanseri1,2bağlıdır. Bakteriyel enfeksiyonlar, patojen Adaları genleri küçük bir kısmını mevcut yatay olarak transfer edilebilir ve için belgili tanımlık hızla çoğalmak-in antibiyotik dirençli bakteri3,4kurşun. Genleri tek hücre düzeyinde eğitim bir birincil DNA elde edilebilir, aynı zamanda hücreleri binlerce analiz etmek gerek genotip tam çeşitliliği örnek için düşük miktarlarda mücadeledir. Bu nedenlerden dolayı deneysel üretilen iş kısıtlamalar yapılan çalışmaların sonuçları en bol hücreler doğru kutuplama tek hücreli, etkinliğini engel. Sıralama5,6, Optik cımbız7, toplu jelleri8ve havacilik9 olarak sıkıştırılma akışı gibi tek hücreli yalıtım teknikleri hücreler sıralama için yüzlerce işleyebilme yeteneği olan; Ancak, bu çoğu örnekleri yalnızca küçük bir kısmını temsil eder. Tek hücreli genom sıralama ile önemli ölçüde daha yüksek üretilen iş için bir yöntem daha derin ve daha kapsamlı hücre popülasyonlarının, böylece bu topluluklar içinde genotypic çeşitlilik rolü elucidating profilleme sağlayacak.
Damlacık Havacilik hücreleri ve biyolojik kimyasalları picoliter ölçekli reaktörler milyonlarca içinde yüksek-den geçerek manipülasyon sağlar. Türdeş olmayan doku10,11,12, hücreleri arasında fark ifade desen çalışması için kullanılan teknolojiler microdroplet bugüne kadar derin uzun moleküller13,14 sıra ,15ve davranış kromatin immunoprecipitation sıralama (ChiP-seq) analizleri tek hücreleri16. Gerçekten de, microdroplets yüksek üretilen iş, bölümlere işlemleri, tek hücreli genomik uygulamalar için mükellef yapma yeteneğine sahiptirler. Bu teknoloji geliştirme ancak kendi benzersiz teknolojik sorunlar sunar. Hücreleri lysed saflaştırılmış ve aynı şekilde örnek hücre popülasyonlarının için en az önyargı ile güçlendirilmiş. Ayrıca, memeli hücrelerinde poliadenile mRNA transkript var. hiçbir karşılaştırılabilir moleküler motifi hedef nükleik asit yakalanması kolaylaştırmak için genom Bu nedenlerden dolayı tek hücreli genom sıralama microdroplet platformlarında uygulamak zor olmuştur.
Bu çalışmada, biz daha önce raporlanmış tek hücreli mikrosıvısal yaklaşımımız bir tek deneme17hücrelerde, on binlerce genleri sıralama yetenekli detaylı bir protokol sağlar. SiC-seq, adı verilen bu teknoloji sayesinde bakteri hücreleri mikron çaplı hydrogels içinde kapsüllenir ve tek tek lysed, tagmented ve genomik DNA hücrenin üzerine spliced benzersiz oligonükleotid barkod içeren bir microdroplet ile birleştirilmiş bir tek örtüşme uzantısı polimeraz zincir tepkimesi (PCR). Hydrogels izole konteyner içinde yüksek molekül ağırlıklı genomik DNA sterically, deterjanlar ve erişmek ve barkodlama18önce DNA arındırmak için litik enzimler gibi daha küçük moleküller izin kaplı olarak hizmet vermektedir. Bu iletişim kuralı işler > saatler, barkodlu kütüphane sıralama için hazır sonuçlanan 50.000 tek hücreler. Nasıl yapılacağını takiben, okuma, okuma, milyonlarca oluşan bir dataset her hücresel bir dizin ile sonuçlanan onların tek hücreli barkod sırasına göre demultiplexed.

<table border="0" cellpadding="0" cellspacing="0" width="1218">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">3&#34; silicon wafers, P type, virgin test grade</td>
			<td style="width:245px;">University Wafers</td>
			<td style="width:163px;">447</td>
			<td style="width:297px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SU-8 3025 photoresist</td>
			<td style="width:245px;">Microchem</td>
			<td style="width:163px;">17030192</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Spin coater</td>
			<td style="width:245px;">Specialty Coating Systems</td>
			<td style="width:163px;">G3P-8</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Photomasks</td>
			<td style="width:245px;">CadArt Servcies</td>
			<td style="width:163px;">(custom)</td>
			<td>See Supplemental Files for mask designs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PGMEA developer</td>
			<td>Sigma-Aldrich</td>
			<td>484431</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropanol</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>109827</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sylgard 184 silicone elastomer kit</td>
			<td style="width:245px;">Krayden</td>
			<td style="width:163px;">4019862</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Degassing chamber</td>
			<td style="width:245px;">Bel-Art</td>
			<td style="width:163px;">42025</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.75 mm biopsy punch</td>
			<td>World Precision Instruments</td>
			<td>504529</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass microscope slides (75 mm x 50 mm)</td>
			<td style="width:245px;">Corning</td>
			<td>294775X50</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Aquapel (hydrophobic glass treatment)</td>
			<td style="width:245px;">Pittsburgh Glass Works</td>
			<td>47100</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PE-2 polyethylene tubing</td>
			<td style="width:245px;">Scientific Commodities</td>
			<td>B31695-PE/2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">1 mL syringes</td>
			<td style="width:245px;">BD</td>
			<td style="width:163px;">309628</td>
			<td style="width:297px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">27 gauge needles</td>
			<td style="width:245px;">BD</td>
			<td style="width:163px;">305109</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Syringe pump</td>
			<td style="width:245px;">New Era Pump Systems</td>
			<td>NE-501</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Novec HFE-7500 fluorinated oil (HFE)</td>
			<td style="width:245px;">3M</td>
			<td style="width:163px;">98-0212-2928-5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">FC-40 fluorinated oil</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">F9755</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PEG-PFPE surfactant</td>
			<td style="width:245px;">Ran Biotechnologies</td>
			<td style="width:163px;">008-FluoroSurfactant</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Space heater</td>
			<td style="width:245px;">Lasko&#160;</td>
			<td style="width:163px;">CD09250&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Agarose, low gelling temperature</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">a9414</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">TE (10X)</td>
			<td style="width:245px;">Rockland</td>
			<td style="width:163px;">mb-007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">PBS 1X, pH 7.4</td>
			<td style="width:245px;">E&#38;K Scientific Products</td>
			<td>EK-65083</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">OptiPrep (density gradient medium)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">d1556</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">1H,1H,2H-Perfluoro-1-Octanol (PFO)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">370533</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Span 80 (sorbitane monooleate)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">s6760</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Hexane</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">139386</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Tween 20 (polysorbate 20)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">p2287</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lysozyme Type IV</td>
			<td style="width:245px;">MP Biomedicals</td>
			<td style="width:163px;">195303</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Mutanolysin</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>M9901</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Zymolyase (yeast lytic enzyme)</td>
			<td style="width:245px;">Zymo Research</td>
			<td style="width:163px;">e1004</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lysostaphin</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>L7386</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Sodium chloride</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">EDTA</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>E6758</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Tris-HCl, pH 7.5, 1M</td>
			<td style="width:245px;">Invitrogen</td>
			<td style="width:163px;">15567-027</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Dithiothreitol (DTT)</td>
			<td style="width:245px;">Teknova</td>
			<td style="width:163px;">d9750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lithium dodecyl sulfate</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">L9781</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Proteinase K</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">P8107S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ethanol, 200 Proof (100%)</td>
			<td style="width:245px;">Koptec</td>
			<td>V1001</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">SYBR Green I (nucleic acid stain)</td>
			<td style="width:245px;">Invitrogen</td>
			<td style="width:163px;">S7563</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">PEG 6k</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>81260</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Triton X-100 (octylphenol ethoxylate)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">t8787</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nextera DNA Library Prep Kit</td>
			<td style="width:245px;">Illumina</td>
			<td>FC-121-1030</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">m05365</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Platinum Multiplex PCR Master Mix (Taq Master Mix)</td>
			<td style="width:245px;">Applied Biosystems</td>
			<td style="width:163px;">4464263</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">m0538m</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">NT buffer from Nextera XT kit (neutralization buffer)</td>
			<td style="width:245px;">Illumina</td>
			<td style="width:163px;">FC-131-1024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Cold cathode fluorescent inverter</td>
			<td style="width:245px;">(custom)</td>
			<td style="width:163px;">(custom)</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">DC power supply</td>
			<td style="width:245px;">Mastech</td>
			<td>HY1503D</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Zerostat 3 anti-static gun</td>
			<td style="width:245px;">Milty</td>
			<td>5036694022153</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">3D-printed centrifuge syringe holder</td>
			<td style="width:245px;">(custom)</td>
			<td>(custom)</td>
			<td>See Supplemental Files for 3D print file</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo DNA Clean &#38; Concentrator-5</td>
			<td style="width:245px;">Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
	</tbody>
</table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

Sıralama teknolojileri üzerinden toplu bir paradigma kayması tek hücreli çözünürlükte yanıt-e doğru hücresel heterojenite rolü gelişen bir anlayış biyolojik sistemlerde uğramıştır. Ancak, tek hücreli sıralama büyük nüfusun by kısıtlamaları genleri sıralama için işleme engel olmuştur. Bu yazıda, tek kişilik hücrelerin genleri izole, yükseltmek için damlacık Havacilik kullanır tek hücreli genom sıralama (SiC-seq) ve barkod için bir yöntem açıklanmaktadır. Microgels hücre katma sağlar compartmentalized arıtma ve tagmentation DNA, bir mikrosıvısal birleşme verimli bir şekilde her genom benzersiz tek hücreli oligonükleotid barkod ile çiftleri iken izin > sıralı için 50.000 tek hücreler Çalıştır. Sıralama veri barkod, tek hücrelerden kaynaklanan okuma grupları oluşturma tarafından demultiplexed. Yüksek işlem hacmi ve düşük-önyargı yöntemi tek hücreli sıralama olarak, SIC seq genomik çalışmalar çeşitli hücre popülasyonlarının hedef daha geniş bir dizi sağlayacaktır.

SIC seq deneysel iş akışı bir yumuşak litografi yordam (Şekil 1) kullanarak fabrikasyon 3 PDMS mikrosıvısal cihazları içerir. Bir iş akışı dropmaker (Şekil 3A) 25 µm benzersiz bir tek hücreli tanımlayıcı genomik DNA etiketleme için dijital barkod damlacıkları oluşturur. Barkod oligonucleotides PCR güçlendirme (Tablo 2, BAR astar) için kolları tarafından çevrili bir 15 bp dejenere sırasında oluşur. Barkodlar tek molekül kapsülleme elde etmek için bir femtomolar konsantrasyon seyreltilmiş ve bütün damlacıklar ya 0 ya da 1 barkod fragment(s) alırsınız. Bir barkod içeren damlacıklar, Çift iplikçikli barkod amplicons çok sayıda kopyasını verimli güçlendirilmiş. Nükleik asit leke başarılı amplifikasyon doğrulamak ve barkod parçaları (Şekil 4B) kapsülleme oranını ölçmek için kullanılır. Microgels bir bakteri hücre süspansiyon ve erimiş özel jel eşit akış oranları (Şekil 2A), ortak akan tarafından oluşturulur. İş akış dropmaking süreci etkili sulu çözümler 2 katına sulandırır. gibi özel iki kez istenen son konsantrasyonu, hazırlanır. Özel soğudukça damlacığı küresel hacminin işgal 25 µm çapı microgel katılaşır.
Yıkama ve lizis adımlar bir dizi yüksek molekül ağırlıklı genomik DNA'microgels (Şekil 2B) arındırır. Emülsiyonlar kırdıktan sonra sulu yıkama geniş hacimli izleme aşağı akım enzimatik tedavi inhibe olabilir organik çözücüler sulandırmak için yapılmaktadır. Yıkanmış microgels hücre sarma hızı (Şekil 4A) doğrulamak için mikroskop altında gözlenir. Bir kokteyl enzim geniş litik aktivite ile bakteri ve ökaryotik mikroplar19hücre duvarlarını sindirmek için microgel süspansiyon eklenir. İndinavir K ve deterjan ile ikinci bir tedavi proteinler düşürür ve hücre artıkları solubilizes.
Tagmentation saf DNA'ın küçük tagmented DNA parçalarının microgels18arasında difüzyon kaynaklanan potansiyel çapraz bulaşma kaçınmak için damlacıkları gerçekleştirilir. Bir damlacık saklama aygıtı (Şekil 3B) her microgel aynı anda aynı zamanda "o ile önceden yüklenmiş oligonükleotid20etiketleme ise" çift iplikçikli DNA parçaları bir tampon ve tagmentation enzim ile compartmentalizes. Microgels 1 microgel için her damla birkaç birini21 (Şekil 4 c) ile yaklaşan kapsülleme oranları elde parçacıkları, yakın Paketli olarak damlacıkları yüklenir.
Mikrosıvısal iş akışı (Şekil 2C) son adımında bir aygıt 1 barkod damla, 1 damla microgel içeren ve kontrollü bir işlemdir amplifikasyon karışımda birleştiren bir çift birleşme işlemi gerçekleştirir. İlk olarak, PCR reaktif içeren bir damlacık eşleştirilmiş ve sarı (Şekil 5) gösterilen bölge bir barkod düşüş birleştirilir. Tuzlu su elektrotlar mikrosıvısal kanaldaki damlacık birleşme tetikler yüksek elektrik alanı degrade üretir. Benzer bir şekilde, ilk birleştirilmiş damlacık microgel damlacık ile eşleştirilmiş ve kırmızı ile gösterilen bölgede ikinci kez birleşti. Damlacıkları toplanır ve termal çip dışı bir tek-örtüşme uzantısında (SOE) PCR sağlanıncaya. Üst üste gelen tamamlayıcı biter barkod ve tagmented genomik DNA füzyon ve sadece doğru barkodlu yapıları, üstel amplifikasyon izin verir.
Sıralama veri ilk okuma kalitesi ile filtre ve Okunma 15-bp tek hücreli barkod sırasına göre gruplandırarak ayrıştırılır. Barkod grubunda geçerli kabul edilmesi, okuma en az sayıda içermelidir; Bu eşik Analizi yararlı bir sıralama veri miktarı ile hücrelere sınırlar ve PCR mutasyona uğramış barkod "öksüz" kümesinden kaldırır. Çalıştırmak bu örnekte, Grup başına 7,5 kbps minimum ayarlanır (50 okuma 150 bp her). Bir çubuk grafik Grup boyutu karşı barkod sayar geçerli barkod grupları önemli bir bölümünü sadece eşik boyutunu (6A rakam) olduğunu gösterir.
Denetim nerede mikrobiyal topluluk kompozisyon bilinmektedir deneyde, saflık ve göreli bereket ölçümleri SIC seq çalıştırmak kalitesini değerlendirmek için kullanılır. Burada, 3 gram-negatif bakteriler, 5 gram-pozitif bakteri ve 2 Mayalar içeren sentetik bir 10 hücreli topluluk analiz edilir. Verilen barkod grubunda saflığı en yaygın genom okuma grubunda toplam sayısı bölü grubunda Eşleme okuma sayısı olarak tanımlanır. Barkod gruplar büyük çoğunluğu eroine 0,95 (ekil 6B) büyük var. Hücre tiplerinin göreli bereket ham okuma sayma ve sayım grupları kendi üye okuma (Şekil 6C) uzlaşma için karşılık gelen bir hücre tipi nerede atanır barkod grupları tarafından hesaplanır. Okuma ve barkod grupları bolluk izlemek öyle ki bazı türler orantısız küçük veya büyük barkod gruplar halinde bulunmayan hücre popülasyonlarının örnek olduğunu belirten kabaca eşit oranlarda. Tek bir tür tüm barkod gruplarından toplam kapsama komplo yüksek kapsama az veya hiç çıkarma bölgesi (Şekil 7) içeren tüm genomu arasında gösterir. Kapsama tekdüzelik normalleştirilmiş kapsama değerleri, ortalama merkezli birçok değeri ile bir frekans dağılımı ile doğrulanabilir (Şekil 7, iç metin).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg"> Resim 1 : Fotolitografi tarafından mikrosıvısal cihazların imalat. (A)Master kalıpları tek özelliği yüksekliği ile SU-8 fotorezist silikon gofret üzerine bir tabaka kaplama spin tarafından imal edilmiştir. Fotorezist sonra photolithographic maskesi ve UV ışığı, crosslinking maruz kalan SU-8 ile desenli. Son olarak, uncrosslinked SU-8 bir geliştirici banyosunda feshedilmiştir. Elde edilen kalıp tam mikrosıvısal aygıt üretmek için cam slayda gümrüklü PDMS döküm için kullanılır. ()B) bir çift-tabaka aygıt için fabrikasyon benzer şekilde spin kaplama ve pozlama adımları ile başlar. Aşağıdaki adımları sonra bir iki katlı aygıt oluşturmak için yinelenir. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg"> Resim 2: SIC seq iş akışı genel bakış. (A) A mikrobiyal süspansiyon erimiş özel microgels tek kişilik hücrelerde kapsüllemek için bir dropmaker cihaz ile birlikte akıyordu. (B) microgels yıkar bakteriyel genomik DNA arındırmak için bir dizi tabi tutulmaktadır. Litik enzimler gram-pozitif bakteri ve Maya hücre duvarlarını sindirmek ve deterjan hücresel enkaz solubilizes. Microgels yeniden damlacıkları çapraz bulaşma azaltmak tagmentation için içine saklanmış. (C) mikrosıvısal birleşme birleştirir dijital PCR barkod, tagmented microgel genom ve amplifikasyon karışımı bir hızda > 1 kHz. Çip dışı SOE-PCR tagmented genom üzerine benzersiz bir tek hücreli barkod tutturmak ve seçmeli olarak tamamen yükselterek barkodlu yapıları. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg"> Şekil 3: Mikrosıvısal cihazlar dropmaking ve microgel yeniden Kapsülleme için. (A) Bu panel bir iş akışı dropmaker (şekil yüksekliği 25 µm) gösterir. Hücreleri ve erimiş özel 25 µm x 25 µm merkezinde 25 µm damlacıkları üretmek için eşit akış oranları cihazın içine tanıtıldı. Dijital barkod dropmaking için hücre giriş takılı ve PCR karışımı özel giriş giriliyor. (B) Bu panel bir microgel yeniden saklama aygıtı (özelliği yüksekliği 25 µm) gösterir. Microgels içine onların yakın Paketli sipariş korumak ve bir tagmentation Mix 25 µm x 30 µm merkezinde yeniden kapsülleme önce alıyorsanız bir huni şeklinde giriş akışı. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg"> Şekil 4 : Filmler damlacıkları ve microgels. 25 µm microgels enzimatik lizis önce yıkanmış (A) Bu panel gösterir. Bakteri fluorescently kapsülleme oranı miktar için lekeli. Poisson yükleme istatistik hücreleri 1 10 damla bir hızda kapsüllü veya çoklu-kapsülleme olayları sıklığını en aza indirmek için daha az olmalıdır dikte. (B) Bu panel 25 µm dijital barkod damlacıkları ile bir nükleik asit leke tedavi floresans mikroskobu görüntüsünü gösterir. Güçlendirilmiş barkod parçaları içeren damlacıklar güçlü floresans sinyal üretirler. (C) Bu panel 50 µm damla yeniden kapsüllü microgels gösterir. Kapat-ambalaj microgels damla başına 1 jel kaç birini ile yaklaşan kapsülleme oranları sağlar. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg"> Şekil 5 : Mikrosıvısal Çift Kişilik birleşme aygıt için tek hücreli genom tedarikçidir. Bir iki adım birleşme işlemi barkod damlacıkları ile yüksek işlem hacmi itibariyle tagmented genleri çiftleri. Bir damlacık PCR karışımı ilk oluşturulan ve barkod damlacık tuzlu su elektrotları kullanarak sarı renkle gösterilen bölge içinde birleştirilir. Daha sonra bir microgel içeren bir damlacık tanıttı ve kırmızı ile gösterilen bölgede ikinci kez birleşti. Yağ giriş reinjected damlacıkları arasındaki boşluğu hassas kontrol sağlar. Barkod reinjection odası ve spacer petrol mavi gölgeli kısa 25 µm tabaka yerleştirilir. Diğer tüm aygıt özellikleri toplam yüksekliği 45 µm ile kalın katmana ait. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg"> Şekil 6 : Barkod grup ölçümleri 10 hücreli sentetik mikrobiyal topluluğunun. (A) Bu panel grubu boyutları barkod dağılımı gösterir. Grup bir boyut sayısı katlanarak grup büyüklüğü arttıkça azalır. Grup başına 7,5 kbps minimum eşik analizi bilgi yeterli miktarda sahip gruplara sınırlar ve PCR mutasyona uğramış sıra "yetimler." kaldırır (B) Bu panel grup eroine barkod dağılımını gösterir. Büyük çoğunluğu (> % 90) gruplarıdır çok yüksek saflık (> % 95). (C) Bu panel 10 tür okuma ve barkod grubu düzeyinde hesaplanan göreli bolluk gösterir. Sayım yöntemleri 2 Barkod Grup boyutu türler arasında tutarlı hale gelir gösteren benzer sonuçlar. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg"> Şekil 7 : Toplamak genomik kapsama Bacillus subtilis barkod gruplar. Bakteri B. subtilis için eşleme tüm barkod gruplardan okuma (N = 9,398) havuzlu ve toplam olarak analiz edilebilir. Dairesel kapsama alanı Haritası SIC seq okuma hiçbir gözlemlenebilir çıkarma bölgeler ile kapsama tekdüzelik göstermektedir. Kesikli çizgi çevresi ortalama kapsamı gösterir (5,55 x). Bir toplu üsleri genom genelindeki ortalama yakınındaki bir derinlikte kaplıdır göreli kapsama frekansları iç metin histogramını gösterir kesikli çizgiyle temsil. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Aygıt</td>
			<td>1 katman yüksekliği (µm)</td>
			<td>1 katman Spin hızı (devir/dakika)</td>
			<td>2 katman yüksekliği (µm)</td>
			<td>2 katman Spin hızı (devir/dakika)</td>
		</tr>
<tr>
<td>İş akışı dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Jel yeniden encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Çift Kişilik birleşme</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
</tbody></table>Tablo 1: mikrosıvısal cihaz üretim parametreleri. Bu tablo (SU-8 3025 için üreticinin belirtimlerine bağlı olarak) kaplama fotorezist spin için gerekli kendi hızlarında SIC seq akışında kullanılan mikrosıvısal aygıtlar listesini gösterir.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Etiket</td>
			<td colspan="5">Sıra (5' > 3')</td>
		</tr>
<tr>
<td>BAR</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
<tr>
<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
<tr>
<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
<tr>
<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
<tr>
<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
</tbody></table>Tablo 2: Astar diziler.
Ek dosya 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">Bu dosyayı indirmek için buraya tıklayınız.</a>
Ek dosya 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">Bu dosyayı indirmek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Tek hücreli genom sıralama için bir üretilen iş Ultrahigh mikrosıvısal Platform

Tek hücreli sıralama genotypic heterojenlik biyolojik sistemlerde ortaya çıkarır, ama daha fazla işlem hacmi derin topluluk kompozisyon ve işlev profil oluşturma için gerekli güncel teknolojileri eksikliği. Burada, biz bir mikrosıvısal iş akışı sıralama için tarif > 50.000 tek hücreli genleri farklı popülasyonlar hücre.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Nanyang Technological University

Research

JoVE Journal

Bioengineering

17.5K Görüntüleme.  University of California, San Francisco. Tek hücreli sıralama genotypic heterojenlik biyolojik sistemlerde ortaya çıkarır, ama daha fazla işlem hacmi derin topluluk kompozisyon ve işlev profil oluşturma için gerekli güncel teknolojileri eksikliği. Burada, biz bir mikrosıvısal iş akışı sıralama için tarif > 50.000 tek hücreli genleri farklı popülasyonlar hücre.

Video: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

Bir mikroakışkan Platform kullanarak Yüksek throughput Protein Ekspresyonu Jeneratör

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

Biyomühendislik

Microfluidic Picoliter Bioreactor for Microbial Single-cell Analysis: Fabrication, System Setup, and Operation

In this protocol the fabrication, experimental setup and basic operation of the recently introduced microfluidic picoliter bioreactor (PLBR) is described in detail. The PLBR can be utilized for the analysis of single bacteria and microcolonies to investigate biotechnological and microbiological related questions concerning, e.g.&#160;cell growth, morphology, stress response, and metabolite or protein production on single-cell level. The device features continuous media flow enabling constant environmental conditions for perturbation studies, but in addition allows fast medium changes as well as oscillating conditions to mimic any desired environmental situation. To fabricate the single use devices, a silicon wafer containing sub micrometer sized SU-8 structures served as the replication mold for rapid polydimethylsiloxane casting. Chips were cut, assembled, connected, and set up onto a high resolution and fully automated microscope suited for time-lapse imaging, a powerful tool for spatio-temporal cell analysis. Here, the biotechnological platform organism Corynebacterium glutamicum&#160;was seeded into the PLBR and cell growth and intracellular fluorescence were followed over several hours unraveling time dependent population heterogeneity on single-cell level, not possible with conventional analysis methods such as flow cytometry. Besides insights into device fabrication, furthermore, the preparation of the preculture, loading, trapping of bacteria, and the PLBR cultivation of single cells and colonies is demonstrated. These devices will add a new dimension in microbiological research to analyze time dependent phenomena of single bacteria under tight environmental control. Due to the simple and relatively short fabrication process the technology can be easily adapted at any microfluidics lab and simply tailored towards specific needs.

In this protocol the fabrication, setup and basic operation of a microfluidic picoliter bioreactor (PLBR) for single-cell analysis of prokaryotic microorganisms is introduced. Industrially relevant microorganisms were analyzed as proof of principle allowing insights into growth rate, morphology, and phenotypic heterogeneity over certain time periods, hardly possible with conventional methods.

In this protocol the fabrication, experimental setup and basic operation of the recently introduced microfluidic picoliter bioreactor (PLBR) is described ...

Cell Squeezing as a Robust, Microfluidic Intracellular Delivery Platform

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This technology has shown potential in addressing previously challenging applications; including, delivery to primary immune cells, cell reprogramming, carbon nanotube, and quantum dot delivery. This vector-free microfluidic platform relies on mechanical disruption of the cell membrane to facilitate cytosolic delivery of the target material. Herein, we describe the detailed method of use for these microfluidic devices including, device assembly, cell preparation, and system operation. This delivery approach requires a brief optimization of device type and operating conditions for previously unreported applications. The provided instructions are generalizable to most cell types and delivery materials as this system does not require specialized buffers or chemical modification/conjugation steps. This work also provides recommendations on how to improve device performance and trouble-shoot potential issues related to clogging, low delivery efficiencies, and cell viability.

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This protocol provides detailed steps on how to use the system for a broad range of applications.

Sağlam, mikroakışkan Hücre içi Delivery Platform olarak hücre Sıkma

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This ...

Microfluidic Platform for Measuring Neutrophil Chemotaxis from Unprocessed Whole Blood

Neutrophils play an essential role in protection against infections and their numbers in the blood are frequently measured in the clinic. Higher neutrophil counts in the blood are usually an indicator of ongoing infections, while low neutrophil counts are a warning sign for higher risks for infections. To accomplish their functions, neutrophils also have to be able to move effectively from the blood where they spend most of their life, into tissues, where infections occur. Consequently, any defects in the ability of neutrophils to migrate can increase the risks for infections, even when neutrophils are present in appropriate numbers in the blood. However, measuring neutrophil migration ability in the clinic is a challenging task, which is time consuming, requires large volume of blood, and expert knowledge. To address these limitations, we designed a robust microfluidic assays for neutrophil migration, which requires a single droplet of unprocessed blood, circumvents the need for neutrophil separation, and is easy to quantify on a simple microscope. In this assay, neutrophils migrate directly from the blood droplet, through small channels, towards the source of chemoattractant. To prevent the granular flow of red blood cells through the same channels, we implemented mechanical filters with right angle turns that selectively block the advance of red blood cells. We validated the assay by comparing neutrophil migration from blood droplets collected from finger prick and venous blood. We also compared these whole blood (WB) sources with neutrophil migration from samples of purified neutrophils and found consistent speed and directionality between the three sources. This microfluidic platform will enable the study of human neutrophil migration in the clinic and the research setting to help advance our understanding of neutrophil functions in health and disease.

This protocol details an assay designed to measure human neutrophil chemotaxis from one droplet of whole blood with robust reproducibility. This approach circumvents the need for neutrophil separation and requires only a few minutes of assay preparation time. The microfluidic chip enables the repeated measure of neutrophil chemotaxis over time in infants or small mammals, where sample volume is limited.

İşlenmemiş kandan Nötrofil Kemotaksis Ölçüm mikroakışkan Platformu

Neutrophils play an essential role in protection against infections and their numbers in the blood are frequently measured in the clinic. Higher ...

The Multi-organ Chip - A Microfluidic Platform for Long-term Multi-tissue Coculture

The ever growing amount of new substances released onto the market and the limited predictability of current in vitro test systems has led to a high need for new solutions for substance testing. Many drugs that have been removed from the market due to drug-induced liver injury released their toxic potential only after several doses of chronic testing in humans. However, a controlled microenvironment is pivotal for long-term multiple dosing experiments,&#160;as even minor alterations in extracellular conditions may greatly influence the cell physiology. We focused within our research program on the generation of a microengineered bioreactor, which can be dynamically perfused by an on-chip pump and combines at least two culture spaces for multi-organ applications. This circulatory system mimics the in vivo conditions of primary cell cultures better and assures a steadier,&#160;more quantifiable extracellular relay of signals to the cells. 
For demonstration purposes, human liver equivalents, generated by aggregating differentiated HepaRG cells with human hepatic stellate cells in hanging drop plates, were cocultured with human skin punch biopsies for up to 28 days inside the microbioreactor. The use of cell culture inserts enables the skin to be cultured at an air-liquid interface, allowing topical substance exposure. The microbioreactor system is capable of supporting these cocultures at near physiologic fluid flow and volume-to-liquid ratios, ensuring stable and organotypic culture conditions. The possibility of long-term cultures enables the repeated exposure to substances. Furthermore, a vascularization of the microfluidic channel circuit using human dermal microvascular endothelial cells yields a physiologically more relevant vascular model.

Here, we present a protocol to coculture primary cells, tissue models and punch biopsies in a microfluidic multi-organ chip for up to 28 days. Human dermal microvascular endothelial cells, liver aggregates and skin biopsies were successfully combined in a common media circulation.

Çok organ Chip - Uzun vadeli Çok doku kokültürü için mikroakışkan Platformu

The ever growing amount of new substances released onto the market and the limited predictability of current in vitro test systems has led to a high need ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

Yüksek verim Tek hücreli İzolasyonu ve Kültür mikroakışkan Platformu

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to spatially fractionate the sample based on a biological property of interest. For the resultant spatial distribution to be used as the assay readout, microfluidic devices are often subjected to microscopic analysis requiring complex instrumentation with higher cost and reduced portability. To address this limitation, we have developed an integrated electronic sensing technology for multiplexed detection of particles at different locations on a microfluidic chip. Our technology, called Microfluidic CODES, combines Resistive Pulse Sensing with Code Division Multiple Access to compress 2D spatial information into a 1D electrical signal. In this paper, we present a practical demonstration of the Microfluidic CODES technology to detect and size cultured cancer cells distributed over multiple microfluidic channels. As validated by the high-speed microscopy, our technology can accurately analyze dense cell populations all electronically without the need for an external instrument. As such, the Microfluidic CODES can potentially enable low-cost integrated lab-on-a-chip devices that are well suited for the point-of-care testing of biological samples.

We demonstrate a microfluidic platform with an integrated surface electrode network that combines resistive pulse sensing (RPS) with code division multiple access (CDMA), to multiplex detection and sizing of particles in multiple microfluidic channels.

Parçacıkların Mekansal Takip için Çoklanmış Elektronik Algılama ile mikroakışkan Platformu

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Imaging the Root Hair Morphology of Arabidopsis Seedlings in a Two-layer Microfluidic Platform

Root hairs increase root surface area for better water uptake and nutrient absorption by the plant. Because they are small in size and often obscured by their natural environment, root hair morphology and function are difficult to study and often excluded from plant research. In recent years, microfluidic platforms have offered a way to visualize root systems at high resolution without disturbing the roots during transfer to an imaging system. The microfluidic platform presented here builds on previous plant-on-a-chip research by incorporating a two-layer device to confine the Arabidopsis thaliana main root to the same optical plane as the root hairs. This design enables the quantification of root hairs on a cellular and organelle level and also prevents z-axis drifting during the addition of experimental treatments. We describe how to store the devices in a contained and hydrated environment, without the need for fluidic pumps, while maintaining a gnotobiotic environment for the seedling. After the optical imaging experiment, the device may be disassembled and used as a substrate for atomic force or scanning electron microscopy while keeping fine root structures intact.

Imaging the Root Hair Morphology of Arabidopsis Seedlings in a Two-layer Microfluidic Platform

This article demonstrates how to culture Arabidopsis thaliana seedlings in a two-layer microfluidic platform that confines the main root and root hairs to a single optical plane. This platform can be used for real-time optical imaging of fine root morphology as well as for high-resolution imaging by other means.

Kök saç Morfoloji Arabidopsis fidan bir iki katlı mikrosıvısal platformda görüntüleme

Root hairs increase root surface area for better water uptake and nutrient absorption by the plant. Because they are small in size and often obscured by ...

A Microfluidic Platform for Longitudinal Imaging in Caenorhabditis elegans

In the last decade, microfluidic techniques have been applied to study small animals, including the nematode Caenorhabditis elegans, and have proved useful as a convenient live imaging platform providing capabilities for precise control of experimental conditions in real time. In this article, we demonstrate live imaging of individual worms employing WormSpa, a previously-published custom microfluidic device. In the device, multiple worms are individually confined to separate chambers, allowing multiplexed longitudinal surveillance of various biological processes. To illustrate the capability, we performed proof-of-principle experiments in which worms were infected in the device with pathogenic bacteria, and the dynamics of expression of immune response genes and egg laying were monitored continuously in individual animals. The simple design and operation of this device make it suitable for users with no previous experience with microfluidic-based experiments. We propose that this approach will be useful for many researchers interested in longitudinal observations of biological processes under well-defined conditions.

A Microfluidic Platform for Longitudinal Imaging in Caenorhabditis elegans

In this article, we demonstrate live imaging of individual worms employing a custom microfluidic device. In the device, multiple worms are individually confined to separate chambers, allowing multiplexed longitudinal surveillance of various biological processes.

Boyuna Imaging'de Caenorhabditis elegans için bir mikrosıvısal Platform

In the last decade, microfluidic techniques have been applied to study small animals, including the nematode Caenorhabditis elegans, and have proved ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Bütün genomik DNA analizi için olağanüstü uzun okunur sıralama

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...