Bu eser kısmen (No 41/11 verir)-CORE programı, İsrail Bilim Vakfı (grant No 908/15), Avrupa Crohn ve kolit organizasyon (ECCO) tarafından desteklenmiştir.

Etik onay çalışma için Sheba yerel araştırma Etik Komitesi tarafından kabul edildi ve tüm yöntemleri ilgili kurallara ve düzenlemelere uygun şekilde gerçekleştirilmiştir. İletişim kuralı bir hastanın rızası özel durum alınan yerel etik inceleme kurulu, kullanılan fekal madde beri zaten Mikrobiyoloji çekirdek klinik testleri ve yaş dışında hasta bilgilerinizi olmayan bir parçası olarak sunuldu toplumsal cinsiyet ve mikrobiyal sonuçları. Yazılı, aydınlatılmış onam sağlıklı gönüllülerden elde edildi ve kurumsal inceleme kurulu çalışma onayladı. Bu örnekleri bazıları zaten bir önceki analiz1' dahil ettik.
1. örnek işleme
<ol><li>Toplamak bir yaklaşık 5 mm2 smear (kabaca bir Silgi boyutunu) testinde steril bir bez ile taze bir dışkı örnekten tüp ( Tablo malzemelerigörmek). 24 saat içinde-80 ° C'de dışkı örnekleri içeren tüm temizleme bezi saklayın. Dışkı temizleme bezi daha fazla işleme kadar orada kalabilir.</li>
</ol>2. DNA ekstraksiyon
<ol><li>Oda sıcaklığında çıkarma ve seyreltme çözümleri çözülme ( Tablo malzemelerigörmek).</li>
	<li>Transferi dışkı çubukla bir boş 2 mL koleksiyonu içine tüp ( Tablo malzemelerigörmek). Pamuklu çubuk sopa boyutu kesim tarafından tüp kapatma minimum Çapraz bulaşma ile etkinleştirmek için temiz bir makas kullanarak ayarlayın. Ayıklama çözüm 250 μL dışkı çubukla ve girdap karışımı içeren her koleksiyon tüp ekleyin.</li>
	<li>Örnekleri 10 min kaynar su banyosu için ısı (95-100° C). Seyreltme çözüm 250 μL her örnek ve girdap karışımı ekleyin.</li>
	<li>Ayıklanan DNA ve 4 ° C'de çubukla içeren 2 mL tüpler depolamak</li>
</ol>3. PCR ve Kütüphane hazırlık
3.1 ve 3.2 adımlar için şablon ve amplicon ücretsiz ortam temiz, sağlayan bir PCR iş istasyonu içinde çalışır.
<ol><li>Astar (Tablo 1) göre onların barkod etiket. Çift Kişilik distile su (DDW) bir 50 mikron konsantrasyon ve mağaza-20 ° C'de her astar sulandırmak</li>
	<li>96-şey plaka PCR reaksiyonları için kullanın. Her plaka 32 farklı dizin astar tarafından etiketlenir 32 farklı örnekler içerebilir. İleri astar ve 32 ters astar oda sıcaklığında erimek ve onları için 5 mikron sulandırmak.</li>
	<li>PCR reaksiyon karışımları (her iyi son hacim 20 μl olacaktır) 100 reaksiyonlar için 5 mikron ileri astar, 1 mL 2 X PCR Master mix ve 400 μL DDW 100 μL karıştırarak hazırlayın. Bu PCR karışımı 15 μL her kuyuda (96 kuyu toplam) koymak. Her 5 mikron ters dizin oluşturulmuş astar 1 μL (32 farklı Astar boyaları triplicates verir toplam 96 Wells) 3 farklı wells için ekleyin.</li>
	<li>Pre-PCR adanmış bölgesinde reaksiyon karışımları için her ayıklanan DNA örneğinin 4 μL eklemek şablonu ve amplicon ücretsiz, temiz bir Bank anlamı (ayıklanan her DNA örneği nüsha güçlendirilmiş — 32 örnek / 96-şey plaka).</li>
	<li>PCR aşağıdaki ayarlarla çalıştırın: ilk denatürasyon 94 ° c 3 dakika; denatürasyon 94 ° C'de 35 döngüleri için 1 dk 1 dk ve uzantısı için 1 dk 72 ° C'de için 55 ° C'de tavlama, ardından; ve 10 dk 72 ° C'de son bir uzantısı.</li>
	<li>Bir post-PCR özel bölge olarak tanımlanacağını belirtiyor, farklı bir bankta bir tek birim tüp (örnek başına 60 μL) içine onaylatılacak her PCR reaksiyon birleştirin.</li>
	<li>PCR amplicons kalitesini değerlendirmek için üzerinde bir etidyum bromür lekeli % 1'özel jel her kombine-PCR reaksiyon 4 μL çalıştırın. Altında UV dalga boyu 260 nm, pozitif amplicons 375-425 bp beklenen grup boyutunda görüntülenir. Sadece bu amplicons sonraki adımda eklenecektir. Not: Her bir örneği her örnek içinde 3 farklı PCR reaksiyonları güçlendirilmiş onaylatılacak, anlamda güçlendirilmiş. Büyütmek değil.</li>
</ol>4. Kütüphane miktar ve Temizleme
<ol><li>Bir ekimolar toplama havuzu tüm PCR örnekleri almak için her amplicon bir çift iplikçikli DNA tarafından ölçmek (dsDNA ölçmek reaktif) floresan nükleik asit leke (bkz. Tablo reçetesi) geniş eşzamanlı miktar için uygun örnekleri miktarı. Not: amplicon boyutu aralığını belirsiz olduğu için nanogram gerçek tutarı ekimolar bir konsantrasyon yüklemek için kullanılır.</li>
	<li>Bir tek, steril tüp içine her örneğinin birleştirmek 500 ng. Girdap karıştırmak için.</li>
	<li>Havuza alınan Kütüphanesi 200 μL etidyum bromür lekeli % 1'özel jel üzerinde çalıştırın. Bir jel ekstraksiyon kiti üreticinin talimatlarına göre kullanarak jel 375-425 bp bantları ayıklamak ( Tablo malzemelerigörmek) ve havuza alınan kütüphanede 80 μL DDW elute. Not: Havuza alınan Kütüphane boyutu belirsiz amplifikasyon ürünleri ana bilgisayardan DNA azaltmak için seçili olmalıdır.</li>
	<li>Son derece hassas bir dsDNA kiti üreticinin talimatlarına göre algılama kullanarak son Kütüphane konsantrasyon ölçmek ( Tablo malzemelerigörmek). Üreticinin yönergelerine göre DNA kitaplıkları için son derece hassas bir ayrılık ve analiz kiti kullanarak doğru kitaplık boyutunu ölçmek ( Tablo malzemelerigörmek).</li>
</ol>5. sıralama
<ol><li>7 de % 20 Denetim Kitaplığı eklenmesi ile havuza alınan kitaplığına seyreltik (bkz. Tablo reçetesi) sıralama makine protokolüne göre.</li>
	<li>Sıralama için tasarlanmış kullanımı özel (bkz. Tablo 1) V4 amplifikasyon astar ücretsizdir astar okuyun.</li>
	<li>Ek bir barkoda okur kullanım üçüncü özel tasarlanmış sıralama astar (bkz. Tablo 1) döngüsü ve üreticinin belirtimlerine göre her yöne doğru uzunlukta eşleştirilmiş uç okuma 175 üslerinin oluşturur.</li>
	<li>Sıralama makine çalıştırabilir ve FASTQ dosyaları üreticinin protokolüne göre elde edilir.</li>
</ol>6. veri işleme
<ol><li>Birleştirmek ve QIIME 2 sürüm 2017.7.017uygulanan veri küratörlüğü potansiyel örtüşen eşleştirilmiş uç FASTQ dosyalarında işlem. Örnek belirli barkodlar göre okuma demultiplex.</li>
	<li>DADA218 kalite kontrol ve sıra varyant (SVs) algılaması için kullanabilir. Okuma 3' sonundan itibaren 13 üsleri ve 15 üsleri 5' uç, üzerinden atma ile 2'den fazla beklenen hataları okur kesecek. Belirlemek ve uzlaşma yöntemiyle chimeras kaldırmak — chimeras örnekleri ayrı ayrı algılanır ve örnekleri yeterli bir kısmını chimeric bulundu dizileri kaldırılır.</li>
	<li>SVs taksonomik sınıflandırma bir Naive Bayes donatılmış Sınıflandırıcısı kullanarak gerçekleştirmek, Ağustos 2013 eğitim % 99 kimliği Greengenes veritabanı6, 175 için uzun ayarla ileri/geri astar ve okur.</li>
	<li>2.146 dizileri derinliği için tüm örneklerini rarefy.</li>
	<li>Unweighted UniFrac β-çeşitlilik seyreltilmiş örnekleri (örnek çeşitlilik19,20) arası ölçüm için bir örnek boyutu etkisi önlemek için kullanın.</li>
	<li>Bir asıl koordinatları (PCoA) çözümlemesi için elde edilen mesafe matris kullanın. Not: Veri işleme komut dosyası ve eşleme dosyaları ek malzeme (ek malzeme 1 ve 2) sağlanır.</li>
</ol>

<ol>
	<li>Braun, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fecal+microbial+characterization+of+hospitalized+patients+with+suspected+infectious+diarrhea+shows+significant+dysbiosis.">Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis.</a> Scientific Reports. 7, 1088 (2017).</li><li>De Filippo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+diet+in+shaping+gut+microbiota+revealed+by+a+comparative+study+in+children+from+Europe+and+rural+Africa.">Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa.</a> Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).</li><li>Yatsunenko, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+gut+microbiome+viewed+across+age+and+geography.">Human gut microbiome viewed across age and geography.</a> Nature. 486, 222-227 (2012).</li><li>Rodriguez, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+of+the+gut+microbiota+throughout+life,+with+an+emphasis+on+early+life.">The composition of the gut microbiota throughout life, with an emphasis on early life.</a> Microbial Ecology in Health and Disease. 26, 26050 (2015).</li><li>Turnbaugh, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+obesity-associated+gut+microbiome+with+increased+capacity+for+energy+harvest.">An obesity-associated gut microbiome with increased capacity for energy harvest.</a> Nature. 444, 1027-1031 (2006).</li><li>McDonald, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+Greengenes+taxonomy+with+explicit+ranks+for+ecological+and+evolutionary+analyses+of+bacteria+and+archaea.">An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.</a> The ISME Journal. 6, 610-618 (2012).</li><li>Bakken, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treating+Clostridium+difficile+infection+with+fecal+microbiota+transplantation.">Treating Clostridium difficile infection with fecal microbiota transplantation.</a> Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).</li><li>Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+composition+of+the+human+fecal+microbiome+after+bacteriotherapy+for+recurrent+Clostridium+difficile-associated+diarrhea.">Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea.</a> Journal of Clinical Gastroenterology. 44, 354-360 (2010).</li><li>Nood, E. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duodenal+infusion+of+donor+feces+for+recurrent+Clostridium+difficile.">Duodenal infusion of donor feces for recurrent Clostridium difficile.</a> The New England Journal of Medicine. 368, 407-415 (2013).</li><li>Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Value+of+stool+cultures.">Value of stool cultures.</a> The Lancet. 316, 413-416 (1980).</li><li>Platts-Mills, J. A., Liu, J., Houpt, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+concepts+in+diagnostics+for+infectious+diarrhea.">New concepts in diagnostics for infectious diarrhea.</a> Mucosal Immunology. 6, 876-885 (2013).</li><li>Bokulich, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality-filtering+vastly+improves+diversity+estimates+from+Illumina+amplicon+sequencing.">Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.</a> Nature Methods. 10, 57-59 (2013).</li><li>Leek, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+the+widespread+and+critical+impact+of+batch+effects+in+high-throughput+data.">Tackling the widespread and critical impact of batch effects in high-throughput data.</a> Nature Reviews Genetics. 11, (2010).</li><li>Dubilier, N., McFall-Ngai, M., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Create+a+global+microbiome+effort.">Create a global microbiome effort.</a> Nature. 526, 631-634 (2015).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> PNAS. 108, 4516-4522 (2011).</li><li>Flores, G. E., Henley, J. B., Fierer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+direct+PCR+approach+to+accelerate+analyses+of+human-associated+microbial+communities.">A direct PCR approach to accelerate analyses of human-associated microbial communities.</a> PloS One. 7, (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature Methods. 7, 335-336 (2010).</li><li>Callahan, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DADA2:+High-resolution+sample+inference+from+Illumina+amplicon+data.">DADA2: High-resolution sample inference from Illumina amplicon data.</a> Nature Methods. 13, 581-583 (2016).</li><li>Lozupone, C., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+A+new+phylogenetic+method+for+comparing+microbial+communities.">UniFrac: A new phylogenetic method for comparing microbial communities.</a> Applied and Environmental Microbiology. 71, 8228-8235 (2005).</li><li>Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+An+effective+distance+metric+for+microbial+community+comparison.">UniFrac: An effective distance metric for microbial community comparison.</a> The ISME Journal. 5, 169-172 (2011).</li><li>Srinivasan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+16S+rRNA+gene+for+identification+of+a+broad+range+of+clinically+relevant+bacterial+pathogens.">Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens.</a> PloS One. 10, e0117617 (2015).</li><li>Hiergeist, A., Gl&#228;sner, J., Reischl, U., Gessner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyses+of+intestinal+microbiota:+culture+versus+sequencing.">Analyses of intestinal microbiota: culture versus sequencing.</a> ILAR Journal. 56, 228-240 (2015).</li><li>Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transforming+clinical+microbiology+with+bacterial+genome+sequencing.">Transforming clinical microbiology with bacterial genome sequencing.</a> Nature Reviews Genetics. 13, 601-612 (2012).</li><li>Salipante, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+16S+rRNA+next-generation+sequencing+of+polymicrobial+clinical+samples+for+diagnosis+of+complex+bacterial+infections.">Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.</a> PloS One. 8, e65226 (2013).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME Journal. 6, 1621-1624 (2012).</li></ol>

Yazarlar ifşa gerek yok.

16s rRNA-amplicon ve metagenomics av tüfeği sıralamanın Klinik Mikrobiyoloji uygulamaları21,22,23popülerlik kazanmıştır. Bu teknikler artan yeteneklerini patojen inoculum ve yeteneklerini daha doğrusu bir polymicrobial bulaşıcı belirlemek için göreli bolluk hakkında veri sağlayan culturable ve culturable takson yakalamak için avantajlı olan 24parmak izi. Microbiome araştırma alanında gelişmeler çeşitli yaklaşımlar tutarlılık eksikliği nedeniyle kolayca karşılaştırılabilir değildir verileri oluşturmuş. Son yıllarda, çeşitli konsorsiyumlar bazı bu sorunları gidermek için çalıştılar. Bu iletişim kuralı dünya microbiome Projesi (EMP) benzer Kütüphane hazırlık izler. Ancak, eklendi bir ayrıntılı adım adım dışkı örnekleri analizleri boru hattı üzerinden DNA çıkarılması için protokoldür.
Daha önce 16S rRNA sıralaması dışkı örnekleri sağlıklı olmayan hastaneye konular ve hasta yatan şüpheli bulaşıcı ishal olan ve geleneksel kültür sonuçlarına mikrobiyal kompozisyon desenlerini tanımlamak için kullanılmıştır. Bu analiz sonuçlarından derin artar hasta yatan takson Proteobakteriler şube1var gösterdi. Burada açıklanan biçimde tasarlanmış doğrudan PCR sütunları ücretsiz yaklaşım bitki DNA16çıkarma için kullanarak 16S rRNA gen amplicon sıralama için genel olarak kullanılan yöntemlerden entegre bir protokoldür. Bu yaklaşım etkili olabilir ve hızlı bir şekilde iyi kalite güçlendirilmiş-DNA kitaplıkları 16S rRNA gen örnekleri yüksek üretilen iş 16S rRNA sıralama için uygun, çok sayıda gelen V4 değişken bölge hedefleme ayıklayın.
Bu DNA tabanlı sıralama yöntemi olduğu için hem aerobes hem de anaerobik mikrobiyal topluluklar içinde bireysel bir dışkı örneği mevcut veriler elde edilir. Protokol V4 bölge 16S rRNA gen karşı ilk olarak tasarlanmış15 yaşından astar kabul etmiştir. Önemlisi, ters amplifikasyon astar her lane15ilâ 2,167 farklı örneklerinin havuzu oluşturma destekler bir on iki temel barkod sıra içerir. İleri amplifikasyon astar dokuz İlave Bazlar eşleştirilmiş uç sıralama sıralama platform25 tarihinde (Tablo 1 ve takıma giren madde 3) destek bağdaştırıcısı bölge içerir. Bu yaklaşım bir kütüphane işleme etkin 10622.57 ± 1211.34 (ortalama ± standart hata) okuma örnek örnek başına ~ 30 dolarlık bir maliyetle başına çalışan derinliği olan bir Lane'de sıralı 250 dışkı örnekleri oluşur.
Kalite kontrol sağlamak için aşağıdaki negatif denetimleri kullanmanızı öneririz; i) PCR DNA şablon, II olmadan) bir temiz Steril bez ve III--dan hulâsa DNA PCR) PCR üzerinde çıkarma ve seyreltme çözüm karışık. Pozitif denetimleri gelince aynı dışkı örneği kökenli, ancak farklı kitaplık hazırlık farklı geriye doğru barkodlu astar ve örnekleri ile önceki ishal--dan iç kalite kontrol went-den geçerek örnekleri de dahil olmak üzere öneririz. Belirtmek gerekirse kullanılmak üzere diğer isteğe bağlı olumlu NIST tarafından sağlanan bu microbiome ölçüm standartları denetimleridir. Ortalama okur kapsama negatif denetimler için gerçek dışkı örneği (Tablo 1) ile karşılaştırıldığında oldukça düşüktür ve öncelikle Mycoplasma takson oluşuyordu. Daha fazla her aynı fekal madde kökenli, ancak bu farklı kitaplık hazırlama (şekil 3) gitti numuneleri kullanılarak elde edilen sıralama sonuçları tutarlılığını gösterdik. Bu sonuç aynı zamanda bizim entegre yöntemini kullanırken, orada olduğunu, hiçbir Çapraz bulaşma örnekleri arasında doğrular.
Bu protokol için çok sayıda örnekleri analiz etmek için entegre bir üniformalı, uygun protokol tanıtmak. Bu iletişim kuralı bilim adamları sağlam, üreme, kullanımı kolay, ucuz, detaylı bir şekilde dışkı toplama veri analizleri, 16S rRNA amplicon sıralaması kullanımına başlatılıyor baktılar önemli denetimlerini kullanma kılavuzu amaçlamaktadır. Bu standart detaylı rehberli protokolünü kullanarak, toplu iş etkileri en aza indirmek ve daha karşılaştırılabilir sıralama sonuçları farklı labs arasında sağlar.

Yoğun çabaları microbiome çeşitlilik ve bolluk, fark ve sağlıklı ve patolojik koşullarda bireyler arasındaki benzerlikler yakalamak bir diğer yönü olarak daha iyi anlamak için yapılmıştır. Yaş2,3, coğrafi konum4, yaşam tarzı5,6ve hastalık5 gut microbiome kompozisyon ile ilişkili olduğu gösterilmiştir, ancak birçok koşul ve nüfus henüz tam olarak henüz karakterize. Son zamanlarda microbiome için tedavi uygulamaları7,8,9değiştirilebilir bildirilmiştir. Bu nedenle, çeşitli fizyolojik şartlarda ve mikrobiyal kompozisyon ilişkisi içine ek fikir potansiyel gelecek değişiklikler duruma getirilmesi doğru ilk adımdır.
Geleneksel mikrobiyal kültür yöntemleri düşük verimleri10,11tarafından sınırlı olduğunu ve ikili bir devlet ya da nerede bir bakteri kavramsallaştırma gut ya da mevcut. Yüksek işlem hacmi DNA tabanlı sıralama mikrobiyal ekoloji, mikrobiyal toplumun tüm üyelerinin yakalama etkinleştirme devrim yarattı. Ancak, sıra uzunluğu ve kalite önemli engelleri doğru taksonomi atama12kalır okuyun. Ayrıca, yüksek üretilen iş tabanlı deneyler nerede ölçümleri biyolojik olmayan veya bilimsel olmayan değişkenler13tarafından etkilenen toplu etkileri muzdarip olabilir. Son yıllarda, çeşitli programlar insan microbiome Amerikan Gut proje, Amerika Birleşik Devletleri (ABD) insan Microbiome projesi ve Birleşik Krallık (UK) MetaHIT projesi de dahil olmak üzere, eğitim için kurulmuştur. Bu girişimler tutarlılık onların yaklaşımlar eksikliği nedeniyle kolayca karşılaştırılabilir değildir verileri oluşturmuş. Bazı bu sorunları14 yönelik olarak uluslararası insan Microbiome Konsorsiyumu, uluslararası insan Microbiome Standartları Projesi ve National Institute of Standards ve Technology (NIST) gibi uluslararası projeler çeşitli çalıştı ve geliştirilen güvenilir üreme sonuçlar ulaşılmasına izin vermesi gerekir microbiome ölçümleri için standartları. Burada açıklanan 16S rRNA yüksek üretilen iş (16S-seq) sıralama veri analizleri aracılığıyla dışkı örneği koleksiyonundan başlatmak için birkaç genel olarak kullanılan yöntemlerin15,16 entegre bir protokoldür. Bitki DNA16doğrudan çıkarma için tasarlanan bir sütun ücretsiz PCR yaklaşım, protokolünü açıklar, dışkı çok sayıda eşzamanlı işlemeyi etkinleştirmek IÇIN örnekleri nispeten kısa sürede yüksek kalitede DNA hedef için güçlendirilmiş mikrobiyal değişken V4 bölgenin ortak bir sıralama platformu üzerinde sıralanıyor. Bu iletişim kuralı bilim adamları sağlam, üreme, kullanımı kolay, detaylı bir şekilde 16S rRNA amplicon sıralaması kullanımına başlatılıyor baktılar önemli denetimlerini kullanma kılavuzu amaçlamaktadır. Bir rehber eşliğinde ve detaylı adım-tarafından adım protokolü olan toplu etkisini en aza indirmek ve böylece daha karşılaştırılabilir sıralama sonuçları labs arasında izin verir.

<table>
	<tbody>
		<tr>
			<td>Primers</td>
			<td>Integrated DNA Technologies (IDT)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Extraction solution</td>
			<td>Sigma-Aldrich</td>
			<td>E7526</td>
			<td></td>
		</tr>
		<tr>
			<td>Dilution solution</td>
			<td>Sigma-Aldrich</td>
			<td>D5688</td>
			<td></td>
		</tr>
		<tr>
			<td>Kapa HiFi HotStart ReadyMix PCR Kit</td>
			<td>KAPABIOSYSTEMS</td>
			<td>KK2601</td>
			<td>PCR Master mix</td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Reagent kit</td>
			<td>Invitrogen</td>
			<td>P7589</td>
			<td>dsDNA quantify reagent</td>
		</tr>
		<tr>
			<td>MinElute Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28606</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Amresco</td>
			<td>0710-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra Pure Water Dnase and Rnase Free</td>
			<td>Biological Industries</td>
			<td>01-866-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS assay kit</td>
			<td>Molecular probes</td>
			<td>Q32854</td>
			<td>dsDNA detecting kit</td>
		</tr>
		<tr>
			<td>High Sensitivity D1000</td>
			<td>Agilent Technologies</td>
			<td>Screen Tape 5067-5582</td>
			<td>separation and analysis</td>
		</tr>
		<tr>
			<td>Screen Tape Assay</td>
			<td>Agilent Technologies</td>
			<td>Reagents 5067-5583</td>
			<td>for DNA libraries</td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>15017666</td>
			<td>control library</td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v2 (500 cycle)</td>
			<td>Illumina</td>
			<td>MS-102-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>Amresco</td>
			<td>E406-10mL-TAM</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL collection tubes</td>
			<td>SARSTEDT</td>
			<td>72.695.400</td>
			<td>Safe Seal collection tubes</td>
		</tr>
		<tr>
			<td>Plastic stick swab in PP test tube</td>
			<td>STERILE INTERIOR</td>
			<td>23117</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Machine</td>
			<td>Applied Biosystems</td>
			<td>2720 Thermal Cycler</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequncing Machine</td>
			<td>Illumina</td>
			<td>Miseq</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR workstation</td>
			<td>Biosan</td>
			<td>UV-cleaner</td>
			<td></td>
		</tr>
		<tr>
			<td>scissors</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>vortexer</td>
			<td>Scientific Industries</td>
			<td>Vortex-Genie 2</td>
			<td></td>
		</tr>
	</tbody>
</table>

guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing

İnsan bağırsak microbiome hücreleri yaralanmalara karşı korumak, enerji ve besin işleme ve dokunulmazlık teşvik merkezi bir rol oynar. Sağlıklı microbiota kompozisyon (dysbiosis) olarak kabul edilir ne gelen sapmalar hayati fonksiyonları için patolojik koşulları önde gelen bozabilen. Son ve devam eden araştırma çabalarının mikrobiyal kompozisyon ve insan sağlığı ve hastalık arasındaki ilişkilendirmeleri karakterizasyonu doğru yönetmen var.
Yüksek işlem hacmi sıralama teknolojileri gelişmeler bağırsak mikrobiyal kompozisyon karakterizasyonu etkinleştirin. Bu yöntemler 16S rRNA amplicon sıralama ve av tüfeği sıralamanın içerir. 16s rRNA amplicon sıralama av tüfeği sıralama gen Öngörüler ve fonksiyonel ek açıklama hakkında ek bilgi sağlarken taxonomical kompozisyon, profil için kullanılır. 16S rRNA gen değişken bölge hedefli sıralama yöntemini kullanarak bir av tüfeği sıralama için karşılaştırıldığında önemli ölçüde daha düşük maliyet avantajdır. 16S rRNA gen farklılıkları sıra mikrobiyal parmak izi kadar tanımlamak ve farklı özellikleri tek tek bir örnek içinde ölçmek için kullanılır.
Büyük uluslararası çabalara 16S rRNA amplicon sıralama için standartlar kayıtlı. Ancak, çeşitli çalışmalarda ortak bir kaynaktan toplu etkisiyle neden varyasyon bildirin. Bu etki, üniformalı protokolleri için örnek koleksiyonu, en aza indirmek için işleme ve sıralamanın uygulanması gerekir. Bu iletişim kuralı veri analizleri için dışkı örneği koleksiyonundan başlayan genel olarak kullanılan protokolleri entegrasyonu öneriyor. Bu iletişim kuralını eşzamanlı kullanım ve DNA ekstraksiyon dışkı örnekleri, PCR güçlendirme V4 bölgesinin yanı sıra çok sayıda sağlar sütun-Alerjik, doğrudan-PCR yaklaşım içerir. Ayrıca, protokol analiz boru hattı açıklar ve QIIME (QIIME 2 yorum 2017.7.0 ve DADA2) en son sürümünü kullanarak bir komut dosyası sağlar. Adım adım bu protokolü ilgilenenler sağlam, üreme, kullanımı kolay ve ayrıntılı bir şekilde 16S rRNA amplicon sıralaması kullanımına başlatılıyor rehberlik etmek hedefleniyor.

Şematik Protokolü'nün şekil 1' de gösterilen.
Biz prospektif şüpheli bulaşıcı ishal ile yatan hastalardan dışkı örneği toplanmıştır. Yukarıda açıklanan1olduğu gibi bu örnekleri Sheba Tıp Merkezi Şubat ve Mayıs 2015 yılları arasında Klinik Mikrobiyoloji Lab sunuldu. Dışkı örneği Klinik Mikrobiyoloji laboratuarında gerçekleştirilen geleneksel Mikrobiyolojik kültür ve geniş yüksek üretilen iş 16S-seq paralel tabi tutuldu. Buna ek olarak, sağlıklı yetişkin dışkı örnekleri karşılaştırma için sıralı.
Bu analizde, odak veri ve QIIME217elde edilen çıktının temsilcisi sonuçları göster Kalite kontrol oldu. Başlangıçta, kalite kontrol dahil olmak üzere 6 negatif kontrol örnekleri sıralama sonuçlar incelendi: i) şablonu olmadan PCR, PCR II) çıkarımı ve seyreltme çözüm temiz ve steril temizleme bezi üzerinde ve PCR III) karışık ayıklama ve seyreltme çözümler. Tablo 2 gösterir tüm negatif kontrol örnekleri ortalama toplam gösterdi ≤118 Toplam Okunma (ortalama 29 sıralarının), öncelikle tüm diğer örnekleri analiz ederken Mycoplasma takson vardı okur 10622.57 (±1211.34 standart hata) ve hiçbir Mycoplasma okuma Ana örnekleri kalite kontrolünü geçti.
Her aynı dışkı örneği kökenli ama went-den geçerek farklı kitaplık hazırlık farklı geriye doğru barkodlu astar ile on altı örnekleri olumlu denetimler olarak kullanılmıştır. 16 örnekleri 8 pozitif kültürlerle Campylobacter, Salmonellave Klinik Mikrobiyoloji laboratuarı ve negatif kültürlere sahip olarak rapor edilmiş 8 tarafından rapor edilmiştir Shigella dahil. Bir alan arsa kültürlenebilen düzeyinde Şekil 2' de gösterilmiştir. Çok tutarlı göreli bereket (şömine testi şube düzeyinde taksonomik göreli bereket kopyası arasında aynı dışkı örneği kökenli ama went-den geçerek farklı geriye doğru barkodlu astar hazırlıkla farklı kitaplık örnekleri göster değerleri simüle p-değeri 9999 çoğaltır dayalı 1 x 10-04 =).
Asıl koordinatları analiz (PCoA), dimensionality giriş veri azaltan UniFrac matris üzerinde görsel örnek ayırma ve benzerlik keşfetmek için kullanıldı. Şekil 3Aiçinde aynı özgün dışkı örneği kökenli, ancak farklı kitaplık hazırlama gitti sıralı örnekleri aynı renkte görünür. Nitekim, bu nispeten yakından PCoA mezarlığına bulunur (şömine test yinelemeleri PC1 PC2 arasında değerler simüle p-değeri = 1e-04 9999 çoğaltır dayalı). İki yineleme arasında ortalama mesafe 0.235 buna ek olarak, bu çalışmada örnekleri arasındaki ortalama unweighted unifrac beta çeşitlilik mesafe 0.706, iken (Wilcoxon rank sum testi p-değeri 4.205 10-11x =). İlginçtir, kültür Campylobacter, Salmonella, Shigella veya enteropathogens için olumlu olduğunu örnekler gösterdi önemli ölçüde farklı PC1 değerleri (Wilcoxon rank sum testi p-değeri 0.011 =) örnekleri ile karşılaştırıldığında Kültür sonuçları negatif. Şekil 3B aynı PCoA arsa gösterir ama şimdi örnekleri Proteobakteriler göreli bolluk tarafından renkli. Örnekleri yüksek bakteri bereket ile önemli ölçüde farklı PC1 değerler vardı (Spearman korelasyon r =-0.533, p-değeri = 0.000975). Bu sonuçları nerede hasta yatan derin artar takson Proteobakteriler şube1var önceki bu, veri çözümlemesi ile tutarlıdır. Burada PC1 kültür pozitif örnekleri çoğunlukla PC1 eksen ve kültür negatif örnekler çoğunlukla diğer tarafta, sağlıklı örnekleri ile birlikte kümeleme bir tarafındaki kümeleme ile bakteri bereket ile korelasyon gösterdi.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56845/56845fig1.jpg"> Resim 1 : Dışkı örneklerinden akış şeması göreli mikrobiyal bereket için. 1) örnek işleme: yaptı, dışkı örnekleri steril Pamuklu çubuk tüpte toplanır. Şu, pamuklu çubuk sopa boyutu 2 ml tüp ve depolama kapatılması etkinleştirmek için kesim tarafından ayarlanır. 2) DNA ekstraksiyon: DNA doğrudan PCR sütunları ücretsiz yaklaşım tarafından ayıklanır. 3) Kütüphane hazırlık: yaptı, ayıklanan DNA'ın 4 μL ileri/geri-dizin astar ile güçlendirilmiş. Her ters astar 12 temel barkod içerir. Her örnek nüsha güçlendirilmiş. 96-şey plaka 32 farklı barkod içerir. Şu, her barkod onaylatılacak tek toplu tüp içine birleştirmek. 96-şey plaka 96 farklı barkod içerir. 4) Kütüphane miktar: üst kapı aynası, olumlu örnekler için amplicons eleme üzerinde etidyum bromür lekeli % 1'özel jel algılandı. Alt paneli, 500 ng amplicon her örnekten ekimolar konsantrasyon tek kitaplık havuza ulaşmak için olumlu amplicons miktar. 5) Kütüphane arıtma: üst kapı aynası, havuza alınan kütüphanesidir boyutu seçimi ve arıtma için çıkarılan jel. Alt paneli, kitaplık tam boyutunu ve konsantrasyonu ölçülür. 6) sıralama: yüksek işlem hacmi sıralama havuza alınan Kütüphanesi. 7) sıralama veri 16S rRNA amplicon mikrobiyal ekoloji için bioinformatic potansiyel tarafından analiz edilir. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56845/56845fig2.jpg"> Resim 2 : Aynı dışkı örneği kökenli, ancak farklı kitaplık hazırlama gitti örnekleri arasında tutarlı göreli bereket. Taksonomik göreli bereket şube düzeyinde örnek belirtildiği şekilde gösterilir. Göreli bereket her farklı geriye doğru barkodlu astar ve 3 sağlıklı kontrol farklı kitaplık hazırlama (yinelenen 1 ve 2) gitti şüpheli bulaşıcı ishal ile yatan hastalardan elde edilen 16 dışkı örnekleri için gösterilir. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56845/56845fig3.jpg"> Şekil 3 : Filogenetik göstermek aynı dışkı örneği kökenli, ancak farklı kitaplık hazırlama gitti örnekleri için tutarlı sonuçlar. Dimensionality giriş veri azaltır asıl koordinatları analiz (PCoA) UniFrac matris üzerinde görsel örnek ayırma ve benzerlik keşfetmek için kullanıldı. İki örnek arasındaki mesafe onların microbiome kompozisyon farkı temsil eder. (A)Unweighted UniFrac PCoA arsa. Her noktası tek bir sıralı örnek temsil eder. Aynı orijinal dışkı örneği kökenli örnekleri aynı renkte görünür. Hastanede yatan hastalarda Klinik Mikrobiyoloji1 tarafından bildirilen olumlu dışkı kültürü ile örnekleri kareler, kültür negatif üçgenler1ve sağlıklı yetişkinlerden ayrı sıralama çalışma1 ile hastanede yatan hastalar tarafından işaretlenir çevrelerde dolu ile işaretlenir. Şimdi (B) içinde olarak aynı PCoA A ama örnekleri bakteri, onların göreceli bereket tarafından belirtildiği şekilde renklendirilir. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Astar adı</td>
			<td>Astar sıra</td>
			<td>Astar açıklama</td>
		</tr>
<tr>
<td>İleri astar</td>
			<td>AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>5' adaptör serisi - astar pad ileri - ileri astar astar bağlayıcı - ileri</td>
		</tr>
<tr>
<td>Ters dizin astar</td>
			<td>CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT</td>
			<td>Tamamlayıcı 3' bağdaştırıcı dizisi - deniyordun barkod - ters astar pad - ters astar bağlayıcı - ters astar ters</td>
		</tr>
<tr>
<td>Oku 1 sıralama astar</td>
			<td>TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>Astar pad ileri - ileri astar astar bağlayıcı - ileri</td>
		</tr>
<tr>
<td>Oku 2 sıralama astar</td>
			<td>AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT</td>
			<td>Astar pad - ters astar bağlayıcı - ters astar ters</td>
		</tr>
<tr>
<td>Dizin sıra astar</td>
			<td>ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT</td>
			<td>Ters astar - ters astar bağlayıcı ters tamamlayıcı - ters Kompleman ters astar pad ters tamamlayıcı</td>
		</tr>
</tbody></table>Tablo 1: Astar listesi.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Örnek</td>
			<td>Sayıda defa okundu ilk kalite kontrol QIIME</td>
		</tr>
<tr>
<td>PCR çıkarma ve seyreltme çözüm -1 temiz temizleme bezi üzerinde</td>
			<td>118</td>
		</tr>
<tr>
<td>PCR çıkarma ve seyreltme çözüm -2 temiz temizleme bezi üzerinde</td>
			<td>39</td>
		</tr>
<tr>
<td>Şablon -1 olmadan PCR</td>
			<td>0</td>
		</tr>
<tr>
<td>Şablon -2 olmadan PCR</td>
			<td>0</td>
		</tr>
<tr>
<td>PCR çıkarma ve seyreltme çözümleri Mix - 1</td>
			<td>16</td>
		</tr>
<tr>
<td>PCR çıkarma ve seyreltme çözümleri Mix - 2</td>
			<td>0</td>
		</tr>
<tr>
<td>Örnekleri (ortalama ± standart hata)</td>
			<td>10622.57 ± 1211.34</td>
		</tr>
</tbody></table>Tablo 2: Okuma negatif denetimleri ve dışkı örnekleri sayısı.
Takıma giren madde 1: veri işleme filmi <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845_Suppl1_script.txt">Bu dosyayı indirmek için buraya tıklayınız.</a>
Takıma giren madde 2: eşleme dosyası. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845_Suppl2_map.txt">Bu dosyayı indirmek için buraya tıklayınız.</a>
Takıma giren madde 3: astar düzeni. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845_Suppl3_schematic_primers_representation.pptx">Bu dosyayı indirmek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Bu el yazması yüksek üretilen iş 16S rRNA amplicon sıralama, detaylı bir standart protokolünü açıklar. Protokol dışkı örneği koleksiyonu veri analizleri ile başlayarak bir entegre, üniformalı, uygun ve ucuz protokol tanıttı. Bu protokol analiz örnekleri titiz standartları ile çok sayıda ve çeşitli denetimler sağlar.

16S rRNA Amplicon sıralama tarafından dışkı mikrobiyal karakterizasyonu için rehberli iletişim kuralı

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

guided-protocol-for-fecal-microbial-characterization-16s-rrna

Nanyang Technological University

Research

JoVE Journal

Biology

19.4K Görüntüleme.  Sheba Medical Center. Bu el yazması yüksek üretilen iş 16S rRNA amplicon sıralama, detaylı bir standart protokolünü açıklar. Protokol dışkı örneği koleksiyonu veri analizleri ile başlayarak bir entegre, üniformalı, uygun ve ucuz protokol tanıttı. Bu protokol analiz örnekleri titiz standartları ile çok sayıda ve çeşitli denetimler sağlar.

Video: Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Pyrosequencing for Microbial Identification and Characterization

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains, and detect genetic mutations that confer resistance to anti-microbial agents. In this video, the procedure for microbial amplicon generation, amplicon pyrosequencing, and DNA sequence analysis will be demonstrated.

Mikrobiyal Tanımlama ve Karakterizasyonu için Pyrosequencing

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate ...

Biyoloji

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

Yetişkin Fare Kalvaryal Kemik İliği içinde Hematopoietik kök hücrelerin Vivo 4-Boyutlu Takip

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

16S Ribozomal RNA Gen amplikonlarının nesil Sıralama

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

Yüksek Verim Dizilimine tarafından MicroRNA ölçümü için Küçük RNA molekülleri, yüksek Verimli ligasyonu

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

DNA Metilasyon Analizi nesil Dizilimine tarafından hedef

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

Belirli Genomik Bölgeler ve enChIP tarafından İlişkili Moleküllerin Tanımlanması İzolasyonu

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fekal Glukokortikoid Analizi: Tek tırnaklılarda in Non-invaziv Adrenal İzleme

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

Bakteriyel Topluluk Karakterizasyonu Verimli Nükleik Asit Ekstraksiyonu ve 16S rRNA gen Sıralama

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 &#946;-lactamase selected at a clinically relevant dosage of ampicillin are provided.

Yüksek verimlilik sıralaması kullanılması Tüm-Protein Doygunluk Mutagenez Kütüphaneleri Fonksiyonel Değerlendirme Protokolü

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to poorly folding proteins or random open reading frames. We have developed a strategy where, by using TEM-1 &#946;-lactamase (the enzyme conferring ampicillin resistance) on a genomic scale, we can select collections of correctly folded protein domains from the coding portion of the DNA of any intronless genome. The protein fragments obtained by this approach, the so called &#34;domainome&#34;, will be well expressed and soluble, making them suitable for structural/functional studies.
By cloning and displaying the &#34;domainome&#34; directly in a phage display system, we have showed that it is possible to select specific protein domains with the desired binding properties (e.g., to other proteins or to antibodies), thus providing essential experimental information for gene annotation or antigen identification.
The identification of the most enriched clones in a selected polyclonal population can be achieved by using novel next-generation sequencing technologies (NGS). For these reasons, we introduce deep sequencing analysis of the library itself and the selection outputs to provide complete information on diversity, abundance and precise mapping of each of the selected fragment. The protocols presented here show the key steps for library construction, characterization, and validation.

The protocols described allow the construction, characterization and selection (against the target of choice) of a &#34;domainome&#34; library made from any DNA source. This is achieved by a research pipeline that combines different technologies: phage display, a folding reporter and next generation sequencing with a web tool for data analysis.

Interactome-Seq: Domainome kitaplığı inşaat, doğrulama ve seçim fajının görüntü ve sonraki nesil sıralama için bir protokol

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to ...