Bu eser bilim promosyon [Grant sayıları 16 K 15860-m. ve 15 K 15777 N.H. için] Japonya Derneği tarafından desteklenmiştir.

1. Astar tasarım <ol><li>2-adım fusion PCR ve gene bozulma doğrulanması için astar hazırlayın. 
	Not: Tablo 1 bu protokol için kullanılan astar dizileri gösterir. şekil 1 bir şematik S. mutans çoğunlukla Δ gtfC oluşturmak için kullanılan 2-adım füzyon PCR yöntemi gösterir.
	<ol><li>Tasarım astar genom Spektinomisin-direnç gen (spc r) 7 ile hedef bölgede değiştirilmesi için. Bu iletişim kuralı gtfC gen tüm kodlayıcı bölge spc r ile yerini alır.</li>
		<li>Dahil 15 üsleri spc r alt ve üst ucuna tamamlayıcı saat 5'te &#39; up-ters bölgelerinde ve astarlar, sırasıyla aşağı-ileri. Benzer şekilde, dahil 15 üsleri tamamlayıcı gtfC ters yönde kanat bölgelerinde alt sonuna ve gtfC akış aşağı kanat bölgelerinde üst sonu saat 5'te &#39; bölgelerinde spc r-ileri ve spc r -astar, sırasıyla ters ( şekil 1A). 
		Not: Up-geri, aşağı-ileri, spc r - ileri ve spc r - dizilerini ters astar bozulma yapı birleşme siteye bağlı olarak otomatik olarak belirlenir.</li>
		<li>Tasarım oluşturan için yukarı-ileri ve aşağı-geri astar &#62; 1 kb upstream ve downstream sırasıyla gtfC gene, bölgelerinde kanat. Yukarı-ileri erime sıcaklık (T m) ayarlayın ve astar astar, up-ters ve aşağı-ileri erime sıcaklığı uygun olarak sırasıyla aşağı-ters ( şekil 1A). 
		Not: T m belirlemek için aşağıdaki formül bakın: T m (° C) = 2 (* NA + * NT) + 4 (* NC + * NG) - 5, nerede * N temsil eder (A, T, C veya G) belirtilen kimlikle astar nükleotit sayısı.</li>
		<li>Tasarım 2 nd PCR ( şekil 1B) için iç içe geçmiş astar (N_up-ileri ve N_up-geri). 
		Not: her ne kadar en dıştaki astar çifti (yukarı-ileri ve aşağı-geri) 2 nd için PCR astar kullanılabilir, iç içe geçmiş astar (N_up-ileri ve N_up-geri) Bu protokol için dizayn edilmiştir. İç içe geçmiş astar için 2 nd PCR, Temsilcisi sonuçları ayrıntılı olarak sık sık gerekli.</li>
		<li>Tasarım astar spc r için belirli. Astar koloni PCR için ekran gtfC bozulma için kullanılır.</li>
		<li>Tasarım astar gtfC doğrulanması için kesinti. 
		Not: Bu primerler kullanılarak güçlendirilmiş PCR ürünleri gtfC veya spc r ve yukarı veya aşağı gtfC bölgelerinde kanat arasındaki sınır apışıp kalmak. Astar kümeleri &#39; gtfC yukarı-ileri ve gtfC yukarı-ters &#39; ve &#39; gtfC aşağı-ileri ve gtfC aşağı-ters &#39; gtfC için özel ve &#39; gtfC yukarı-ileri ve spc r 2 -geriye doğru &#39; ve &#39; spc r 2-ileri ve gtfC aşağı-ters &#39; spc r için özel.</li>
	</ol></li></ol> 2. S. mutans çoğunlukla genomik DNA çıkarma <ol><li>çizgi stok S. mutan s UA159 bir beyin kalp infüzyon (BHI) agar plaka üzerine. Gecede 37 ° C'de anaerobik koşullarda plaka kuluçkaya.</li>
	<li>Steril bir kürdan kullanarak bir koloni up pick ve BHI suyu 5 mL aşılamak. S. mutan s kültür gecede 37 ° C'de anaerobik koşullarda kuluçkaya.</li>
	<li>Santrifüj bakteriyel hücre kültürü, 2.000 × g. 15 dakika Resuspend hücre Pelet fosfat tamponlu tuz (PBS) 5 mL.</li>
	<li>, 2.000 × g. 15 dakika santrifüj Resuspend hücre Pelet PBS 200 µL içinde.</li>
	<li>Üretici tarafından sağlanan yönergelere göre bir boncuk-dayak-temel genomik DNA ekstraksiyon kiti kullanarak süspansiyon gelen genomik DNA ayıklamak.
	<ol><li>2.0 mL örnek süspansiyon aktarmak tüp cam boncuk (kit ile birlikte) içeren. Hücre süspansiyon lizis çözüm (kit ile birlikte) 750 µL ekleyin.</li>
		<li>Sıkıca kap ve tüpler simetrik boncuk atan bozulma aparatı tüp sahibi yerleştirin. 5 min için maksimum hızda işlem. Santrifüj boncuk dayak örnekleri 10,000 × g., 1 dk. için Transfer süpernatant (kit ile birlikte) spin filtresi 2.0 mL toplama tüp ve 7.000 × g ., 1 dk santrifüj</li>
		<li>Ekle 1200 µL DNA bağlayıcı arabelleğe filtrate (kit ile birlikte). 2.0 mL toplama tüp ve 10.000 × g., 1 dk santrifüj (kit ile birlikte) spin sütun karışıma 800 µL transfer</li>
		<li>Akış-üzerinden atma spin sütun sütun matris yıkayın ve 10.000 × g. atma akışı aracılığıyla, 1 dk santrifüj kapasitesi, yıkama arabelleği (kit ile birlikte) 500 µL spin için eklemek için 200 µL ön yıkama arabelleği (kit ile birlikte) eklemek sütun sütun matris yıkayın ve 10.000 × g., 1 dk santrifüj kapasitesi</li>
		<li>Spin sütun yeni bir 1.5 mL microcentrifuge tüp içine yerleştirin ve 100 µL (kit ile birlikte) elüsyon arabelleği sütun matris ekleyin.</li>
		Genomik DNA elute için 10.000 × g <li>santrifüj 30 s. Saflık ve DNA toplama 260 Absorbans ölçerek tahmin etmeye nm ve 280 nmusing bir Spektrofotometre ve A 260 /A 280 oranı 1.8 büyük olduğundan emin olun.</li>
	</ol></li></ol> 3. PCR güçlendirme <ol><li>1 st S. mutan s WT genom ve sentetik spc r gen (bkz. Tablo 1) PCR şablon olarak kullanarak PCR gerçekleştir. Yükseltmek ters yönde kanat gtfC gen bölgesinin, gtfC gen ve astar olarak başına ( şekil 1A yukarıda), açıklanan üç kümesi kullanarak spc r gen aşağı akım kanat bölgesi Tablo 2 ve Tablo 3. 
	Not: PCR astar, reaktifler ve amplifikasyon döngüleri Tablo 1, Tablo 2 ve Tablo 3, sırasıyla özetlenir.</li>
	<li>% 1'özel jel her PCR ürünü fractionate ve jel bant kesici kullanarak karşılık gelen grup tüketim.</li>
	<li>Her bir spin sütun ve silika jel zar bazlı ayıklama kit kullanarak jelleri güçlendirilmiş DNA üründen arındırmak.
	<ol><li>Transfer temiz bir microcentrifuge jel dilimlere tüp ve arabellek (kit ile birlikte) bağlama 500 µL ile karıştırın. Jel dilimleri tamamen çözünene kadar 55 ° C 15 dakika karisimin kuluçkaya.</li>
		<li>(Kit ile birlikte) spin sütun (kit ile birlikte) bir koleksiyon tüp içine koyun, spin sütuna örnek yüklemek ve santrifüj kapasitesi 30 için 11.000 × g s. Akış-üzerinden atmak, Silis membran yıkama ve 30 için santrifüj kapasitesi için Spin sütun yıkama (kit ile birlikte) arabelleği 600 µL eklemek 11.000 × g s.</li>
		<li>Akışı aracılığıyla ve silis membran kurumaya 11.000 × g de 2 dk santrifüj atın.</li>
		<li>Spin sütun yeni bir 1.5 mL microcentrifuge tüp içine yerleştirin, 50 µL ekleyin elüsyon arabellek (kit ile birlikte) ve 2 dakika süreyle oda sıcaklığında kuluçkaya</li>
		Güçlendirilmiş DNA elute için <li>11.000, 2 dk santrifüj × g. Saflık ve DNA toplama 260 Absorbans ölçerek tahmin etmeye nm ve 280 nmusing bir Spektrofotometre ve A 260 /A 280 oranı 1.8 büyük olduğundan emin olun.</li>
	</ol></li> <li>Gerçekleştir 2 nd 2-adım füzyon Tablo 2 başına PCR Şablonlar olarak üç yaklaşık ekimolar parçaları kullanarak PCR PCR ve Tablo 3. 
	Not: Bu parçaları AMPLİFİKATÖRLÜ ve iç içe geçmiş primerler kullanılarak spliced &#39; N_up-ileri ve N_down geri &#39; veya en dıştaki astar &#39; yukarı-ileri ve aşağı-geri &#39; ( şekil 1B). PCR astar, reaktifler ve amplifikasyon döngüleri özetlenir Tablo 1, Tablo 2 ve Tablo 3, sırasıyla.</li>
	<li>Yük-onda % 0,8 özel jel PCR reaksiyon karışımı (5 µL) ve uygun amplicon ( şekil 1 c) nesil onaylamak için beklenen Grup boyutu ile güçlendirilmiş grup boyutunu karşılaştırın.</li>
	<li>Etanol yağış arıtma olmadan tarafından kalan son PCR ürünü konsantre.
	<ol><li>Ekleyin 55 µL ultra saf su 100 µL.Add için toplam ses seviyesini ayarlamak için kalan PCR karışımı için % 100 etanol (250 µL) 2.5 birimler tarafından takip 3 M sodyum asetat (10 µL), pH 5.2, onda biri hacmi. Mix ve 30 dk-80 az için donma ° C.</li>
		<li>, 15.000 × g 4 ° C'de 20 dk santrifüj tüp alt Pelet denetlemek ve süpernatant atın. Pelet % 70 etanol, santrifüj, 15.000 × g 4 ° C'de 5 min için 1 mL ile yıkayın ve süpernatant atın. Pelet için yaklaşık 30 dakika kuruması ve ultra saf su 10 µL ile çözülür.</li>
	</ol></li></ol> 4. Yetkili hücre hazırlık ve hücre dönüşüm <ol><li>çizgi stok S. mutan s UA159 BHI agar plaka üzerine. Gecede 37 ° C'de anaerobik koşullarda plaka kuluçkaya.</li>
	<li>Steril bir kürdan kullanarak bir koloni up pick ve BHI suyu 5 mL aşılamak. S. mutan s kültür gecede 37 ° C'de anaerobik koşullarda kuluçkaya.</li>
	<li>BHI suyu 50 mL 2 mL mutan S. s kültür aktarmak ve 6-8 h 37 ° c ile 600 optik bir yoğunluk için kuluçkaya nm 0,2-0,4 anaerobik koşullarda (OD 600).</li>
	<li>Hücreleri 2.000 × g 4 ° c de 15 dakika santrifüj kapasitesi, süpernatant atmak ve hücreleri iki kez 40 mL % 10 gliserol 40 mL tarafından takip buz gibi su ile yıka. 
	Not: Sonraki adım kalan maddeler etkiler.</li>
	Hücre Pelet % 10 gliserol içinde bağlılık azalır gibi <li>süpernatant dikkatle Pasteur pipet ile Aspire edin. 1 mL taze % 10 gliserol hücrelerde resuspend, süspansiyon 50 µL her 1.5 mL microcentrifuge tüp içine dağıtmak ve depolamak kullanmadan sadece kadar-80 ° C'de.</li>
	<li>Buz gibi yetkili hücreleri 50 µL aliquot madde 3 te yukarıda bozulma yapı 5 µL ile karıştırın. Elektroporasyon cuvettes (0.2 cm mesafe elektrot arasındaki ile) karışımı ekleyin. Staphylococcus aureus modu istihdam (1,8 kV, 600 Ω, 10 µF, 1 darbe) elektroporasyon cihazları için electroporate.</li>
	<li>BHI suyu 500 µL hücrelerde hemen elektroporasyon sonra askıya alma ve süspansiyon 50 µL Spektinomisin içeren BHI agar plakaları ekleyin. 
	Not: Ekstra kuluçka süresi sonra adım gerekli değildir. Ancak, 1-2 h için kuluçka elektroporasyon sonra dönüşüm verimliliği artırabilir.</li>
	<li>2-6 gün anaerobik koşullarda 37 ° C'de plaka kuluçkaya. 
	Not: S. mutans çoğunlukla Δ gtfB yukarıda açıklandığı gibi inşa edilmiştir. Tüm kodlayıcı bölge gtfB gen eritromisin direnç gene 8 S. mutans çoğunlukla Δ'yerine olur gtfB. Her S. mutans çoğunlukla zorlanma BHI suyu anaerobik koşullarda 37 ° C'de içinde kültürlü.</li>
</ol> 5. Gene bozulma ve depolama doğrulama <ol><li>Pick rastgele kolonileri ve onları koloni PCR Tablo 2 ve Tablo 3 göre gerçekleştirmek için PCR karışımı içine aşılamak. PCR astar, reaktifler ve amplifikasyon döngüleri özetlenir Tablo 1, Tablo 2 ve Tablo 3, sırasıyla.</li>
	<li>PCR reaksiyon karışımı spc r onaylamak için % 1'özel jel üzerinde yük-belirli DNA band.</li>
	<li>Steril bir kürdan ve alt kültür hücreleri BHI Spektinomisin içeren 10 ml kullanarak pozitif koloni anaerobik koşullarda 37 ° C'de 2 gün suyu alın.</li>
	<li>S. mutans çoğunlukla Δ nesil doğrulamak gtfC.
	<ol><li>Hücre süspansiyon eşit bölün. Yukarıda açıklanan hücreleri genomik DNA ayıklamak (2.3 adımlar. için 2.5.5.). GtfC bozulma (Tablo 1) Tablo 2 ve Tablo 3 başına doğrulanması için primerler kullanılarak PCR şablon olarak PCR genomik DNA ile gerçekleştirmek. 
		Not: PCR astar, reaktifler ve amplifikasyon döngüleri Tablo 1, Tablo 2 ve Tablo 3, sırasıyla özetlenir.</li>
		<li>PCR karışımı bir % 2 özel jel üzerinde yük ve uygun amplicon . nesil onaylamak için beklenen Grup boyutu ile güçlendirilmiş grup boyutunu karşılaştırın</li>
		<li>4'te kalan hücre süspansiyon için 2.000 × g de 15 dk santrifüj kapasitesi ° C. Resuspend hücre Pelet PBS 5 mL.</li>
		<li>2.000 × g 4 de 15 dakika santrifüj ° C. hücre cips 1,5 mL % 25 gliserol içeren BHI suyu ve mağaza-80 ° Cor -20 ° c Resuspend</li>
	</ol></li></ol> 6. Fenotipik analizi <ol><li>çizgi her S. mutan s zorlanma BHI agar plaka üzerine. Gecede 37 ° C'de anaerobik koşullarda plaka kuluçkaya.</li>
	<li>Steril bir kürdan kullanarak bir koloni kadar almak ve 2 mL BHI suyu ile veya olmadan uygun antibiyotik içine aşılamak. Gecede anaerobik koşullarda 37 ° C'de kuluçkaya.</li>
	<li>2 mL cam tüp bebek antibiyotik olmadan %1 veya % 5 Sükroz içeren BHI suyu içine gecede kültür süspansiyon 20 µL aşılamak; 37 ° C anaerobik koşullarda eğimli bir konumda bir gecede test tüpünde hücrelerle kültür.</li>
	<li>Girdap cam test tüpleri için 10 s ve kültür süspansiyonlar dikkatle boşaltmak. Test tüpleri üç kez distile su ile yıkayın. 1 mL % Coomassie parlak mavi (CBB biyofilmler leke) tüp duvara ve 1 dk. için kuluçkaya 0,25 ekleyin</li>
	<li>Boyama çözüm dikkatle boşaltmak test tüpleri üç kez distile su ile yıkayıp kurulayın test tüpleri.</li>
	<li>Renk yoğunluğu ve uzantısı CBB lekeli-görsel olarak fenotipik analizde biyofilm şekillendirme yeteneği belirlemek için biyofilm değerlendirmek.</li>
</ol>

<ol>
	<li>Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+hybrid+genes+without+the+use+of+restriction+enzymes:+gene+splicing+by+overlap+extension.">Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.</a> Gene. 77 (1), 61-68 (1989).</li><li>Horton, R. M., Cai, Z., Ho, S. M., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 54 (3), 129-133 (2013).</li><li>Kuwayama, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+generation+of+a+gene+disruption+construct+without+the+use+of+DNA+ligase+and+plasmid+vectors.">PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors.</a> Nucleic Acids Res. 30 (2), E2 (2002).</li><li>Sakurai, I., Mizusawa, N., Wada, H., Sato, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digalactosyldiacylglycerol+is+required+for+stabilization+of+the+oxygen-evolving+complex+in+photosystem+II.">Digalactosyldiacylglycerol is required for stabilization of the oxygen-evolving complex in photosystem II.</a> Plant Physiol. 145 (4), 1361-1370 (2007).</li><li>Aoki, H., Shiroza, T., Hayakawa, M., Sato, S., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+a+Streptococcus+mutans+glucosyltransferase+gene+coding+for+insoluble+glucan+synthesis.">Cloning of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan synthesis.</a> Infect Immun. 53 (3), 587-594 (1986).</li><li>Hanada, N., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+the+Streptococcus+mutans+gtfC+gene,+coding+for+synthesis+of+both+soluble+and+insoluble+glucans.">Isolation and characterization of the Streptococcus mutans gtfC gene, coding for synthesis of both soluble and insoluble glucans.</a> Infect Immun. 56 (8), 1999-2005 (1988).</li><li>LeBlanc, D. J., Lee, L. N., Inamine, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+nucleotide+base+sequence+analysis+of+a+spectinomycin+adenyltransferase+AAD(9)+determinant+from+Enterococcus+faecalis.">Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis.</a> Antimicrob Agents Chemother. 35 (9), 1804-1810 (1991).</li><li>Macrina, F. L., Tobian, J. A., Jones, K. R., Evans, R. P., Clewell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cloning+vector+able+to+replicate+in+Escherichia+coli+and+Streptococcus+sanguis.">A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis.</a> Gene. 19 (3), 345-353 (1982).</li><li>Murata, T., Hanada, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+chloride+channel+permease+to+fluoride+resistance+in+Streptococcus+mutans.">Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.</a> FEMS Microbiol Lett. 363 (11), (2016).</li><li>Perry, D., Wondrack, L. M., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+putative+cariogenic+properties+in+Streptococcus+mutans.">Genetic transformation of putative cariogenic properties in Streptococcus mutans.</a> Infect Immun. 41 (2), 722-727 (1983).</li><li>Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., Cvitkovitch, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+ligation+mutagenesis+in+transformable+streptococci:+application+and+efficiency.">PCR ligation mutagenesis in transformable streptococci: application and efficiency.</a> J Microbiol Methods. 49 (2), 193-205 (2002).</li><li>Ge, X., Xu, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+gene+deletions+in+Streptococcus+sanguinis+by+high+throughput+PCR.">Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR.</a> J Vis Exp. (69), (2012).</li></ol>

Yazarlar ifşa gerek yok.

Mevcut protokolünde astar 1st PCR için yaklaşık 1 kb upstream ve downstream genom hedef bölgede bölgelerinde kanat yükseltmek için tasarlanmış olmalıdır. Homolog rekombinasyon verimliliğini artırmak gerekli uzun kanat böyle dizileridir.
Astar dizisi (up-geri, aşağı-ileri, spcr-ileri ve spcr-ters) Bu protokol için otomatik olarak bozulma yapı birleşme ücreti göre belirlenmiştir. Her astar 15 üsleri tamamlayıcı 2nd PCR şablon bölge 5' adlı sonuna içerir. Daha uzun bir bağlama site daha verimli üretim kesintileri yapı sağlar. Bölge 5' her astar en az 10 tamamlayıcı üslerini dahil9tavsiye edilir.
İç içe geçmiş astar (N_up-ileri ve N_up-geri) en dıştaki astar (yukarı-ileri ve aşağı-geri) yerine 2nd PCR için kullanılmıştır. 2nd PCR için en dıştaki astar kullanılması bazı durumlarda faydalıdır; S. mutans çoğunlukla ΔgtfB bozulma yapı başarılı amplifikasyon (veri gösterilmez) en dıştaki primerler kullanılarak sağlanır. Ancak, en dıştaki astar kullanımı 2nd PCR adım için sık sık şekil 3' te gösterildiği gibi yetersiz PCR güçlendirme olmaktadır. İç içe geçmiş astar kullanılması bu sorunu9gidermek için bulundu. Bozulma yapı önemli ölçüde bile iç içe primerler kullanılarak güçlendirilmiş değil, ancak, yeniden tasarımı 1 PCR kullanılan astar gerekli olabilir.
Koloni PCR gen alt üst baskı uygun tarama sağlar. Astar bilinen sıralarının spcrkullanarak gen alt üst soy nesil için uygulanabilir. Elektroporasyon kullanılarak elde dönüşüm verimliliği genellikle diğer yordamlar tarafından etkin daha yüksek olduğu gibi elektroporasyon S. mutans çoğunlukla WT, bozulma yapıları, giriş için kullanıldı. At serum veya at serum yetkinlik uyarıcı peptidler ile kullanarak dönüştürme streptokok10,11,12' yaygın olarak kabul edilir. Bir elektroporasyon aparat gerekli olmasına rağmen yetkili hücre hazırlık gibi dahil daha basit daha fazla alternatif yöntemler10,11olan işlemlerdir. Buna ek olarak, elektroporasyon açısından hayvan refah önerilir.
Mevcut iletişim kuralı numarası ofantibiotic işaretçileri bağlı olarak birden çok gen bozulma için geçerlidir. GtfC- ve gtfBoluşturmak için- S. mutans çoğunlukla suşları, örneğin, DNA yapısı gtfCiçin kesintiye-2-adım PCR tarafından inşa bozulma S. mutans çoğunlukla Δ dönüştürülmüşgtfB. GtfC ve gtfB bu durumda bitişik olduğundan, S. mutans çoğunlukla ΔgtfC ve S. mutans çoğunlukla ΔgtfB genleri 2-adım PCR için şablonlar olarak için homolog sıralarını korumak için kullanılması gerekir homolog Rekombinasyon. Hatta, gen kesintiye S. mutans çoğunlukla iki katına zorlanma daha önce bu protokolü9tarafından inşa.
S. mutans çoğunlukla gene bozulma için mevcut iletişim kuralı gen kesintiye suşların çeşitli tür üretimi için adapte. Bu iletişim kuralı geleneksel iletişim kuralları'nda ilgili Gen Klonlama adım gerekli değildir. Buna ek olarak, PCR tek gerekli enzimatik reaksiyon olduğunu; Bu nedenle, plazmid vektörel çizimler, Escherichia coli, ligaz ve enzimleri gerekli değildir. Ayrıca, yapı tasarım restriksiyon enzimi hedef gen sitelerin bağımsız olarak mevcut Protokolü bozulma yapı tasarım açısından daha fazla esneklik sunar. Araştırmacılar silinmiş veya ters yönde kanat bölgeleri amplifikasyon için ters astar ve akış aşağı kanat bölgeleri amplifikasyon için ileri astar tasarlamak için genom korunmuş bölgelerde tespit edebilir. Bu bölgeler kanat hemen ters yönde ve DNA bölgesinin hemen aşağı akım silinmek üzere sırasıyla istenen. Gibi esneklik yakın genlerin ifade üzerinde kutup etkileri gibi dış etkilerden azaltmak için kullanılabilir.

Gene işlev analiz genellikle bir vahşi tipi yük ve ilgi belirli bir gen getirilmiş bir yük arasında fenotipik bir karşılaştırma içerir. Bu gen-bozulma teknik gen işlevi analizleri takson, memeliler için bakterilerden geniş bir alanda kullanılmıştır. Gen alt üst baskı üretimi için gerekli bir gen-bozulma yapıdır; Bu deoksiribonükleik asit (DNA) yapı akış yukarı ve aşağı akım hedef gen bölgelerinde kanat erimiş antibiyotik direnci marker gen oluşur ve homolog rekombinasyon ile genom içine dahil edilmiştir. Gen kesintiye zorlanma antibiyotik içeren seçmeli medya kullanarak izole olabilir. Gen kesintiye zorlanma yapımı için kullanılan geleneksel yöntem Polimeraz zincir tepkimesi (PCR), gen ligasyonu içine uygun bir plazmid, hazım ile sınırlama tarafından hedef gen amplifikasyon gibi karmaşık adımlar gerektirir enzimler ve antibiyotik direnç marker gen eklemek için religation. Her adım başarısını bağlı olarak birkaç hafta için birkaç gün alarak zaman alıcı bir süreçtir. Buna ek olarak, tasarım kesintileri yapıları, hedef gen restriksiyon enzimi sitelerinde bağlıdır. Bu sorunları gidermek için DNA PCR tabanlı yapıştırma yöntemleri1,2 tasarım Dictyostelium discoideum3 ve Synechocystis sp. PCC68034 mutant gen bozulduğu için bildirilmiştir. Bu da çalışmanın, kesintiye uğraması yapımı için (2-adım füzyon PCR belirlenmiş) değiştirilmiş bir PCR tabanlı yöntemi kullanan bir nispeten hızlı, facile ve ucuz şekilde bir gen kesintiye streptokok yük oluşturmak için bir yöntem geliştirildi yapý ve elektroporasyon genetik dönüşüm.
PCR genomik DNA, antibiyotik direnci marker gen PCR şablon olarak ve dört çift uygun şekilde gerektirir 2-adım füzyon Oligonükleotid astar tasarlanmış. İlk adım (1st PCR), hedef gen, hedef 1-kb aşağı akım kanat bölge 1-kb ters yönde kanat bölge gen ve antibiyotik direnç marker gen PCR ile güçlendirilmiş. 5' bölgeleri ters astar ve amplifikasyon upstream ve downstream için ileri astar bölgeler, sırasıyla, kanat 15 üsleri marker gen sonuna kadar tamamlayıcı içerir. İleriye ve geriye doğru astar marker gen amplifikasyon için 5' bölgeleri aynı şekilde 15 üsleri hedef gen ters yönde kanat bölgesinin alt sonuna ve akış aşağı kanat hedef gen bölgesinin üst sonu için tamamlayıcı dahil, anılan sıraya göre. Bu nedenle, üç güçlendirilmiş parçaları üst üste gelen 30-baz çifti bölgesini fusion sitesinde içerir. İkinci adımda (2nd PCR), PCR 1st PCR Şablonlar olarak tarafından güçlendirilmiş üç parçaları kullanarak iç içe geçmiş PCR astar ile gerçekleştirilir. Şablonlar tamamlayıcı bölgelerinde Ayrıca 2nd PCR birbirine bağlıdır. Son olarak, yapı homolog rekombinasyon için vahşi tipi zorlanma için elektroporasyon tarafından tanıtıldı. Başarılı gene bozulma belirli primerler kullanılarak PCR tarafından doğrulanmadı. Yüksek sadakat DNA polimeraz kullanarak bozulma yapısı güçlendirilmiş, DNA ligasyonu veya DNA sindirim, gibi ek enzimatik reaksiyonları yapı oluşturmak gerekli değildir. Buna ek olarak, genom bir silinmiş veya korunmuş bölge esnek astar tasarım göre seçmiş olabilirsiniz.
Mevcut çalışma, Streptococcus mutans çoğunluklaglucosyltransferase kodlar, gtfC gen tüm kodlayıcı bölge silme hızlı, kolay gen bozulma yönteminde bir streptokok türleri göstermek için gerçekleştirildi. Ayrıca, bir gtfB-kesintiye zorlanma aynı şekilde oluşturulur. GtfC ve gtfB tarafından kodlanmış glucosyltransferases katkıda bulunmak için cariogenic diş biyofilm geliştirme5,6. Vahşi türü biyofilm oluşturmayan yetenekler (S. mutans çoğunlukla WT), gtfCsoy-kesintiye zorlanma (S. mutans çoğunlukla ΔgtfC) ve gtfB-kesintiye zorlanma (S. mutans çoğunlukla ΔgtfB) değerlendirildi fenotipik karşılaştırmalı analizler için. Bu iletişim kuralı gene bozulma için ek bir tür için bir iki adım yöntemi uygulanması genişletir ve çalışmalar gen fonksiyonunu kullanabilirsiniz takson daha geniş bir yelpazesi için değiştirilebilir.

<table><tbody><tr><td>&lt;em&gt;Streptococus mutans&lt;/em&gt;</td><td>Stock strain in the lab.</td><td></td><td>Wild-type strain (Strain UA159)</td></tr><tr><td>Genomic DNA extraction kit</td><td>Zymo Research</td><td>D6005</td><td></td></tr><tr><td>Bead-beating disruption apparatus</td><td>Taitec</td><td>GM-01</td><td></td></tr><tr><td>Synthetic genes</td><td>Eurofins Genomics</td><td>Custom-ordered</td><td>Spectinomycin- and erythromycin-resistance gene</td></tr><tr><td>Thermal cycler</td><td>Astec</td><td>PC-708</td><td></td></tr><tr><td>PCR primers</td><td>Eurofins Genomics</td><td>Custom-ordered</td><td>35 bases in length</td></tr><tr><td>DNA polymerase</td><td>Takara</td><td>R045A</td><td>High-fidelity DNA polymerase</td></tr><tr><td>Gel extraction kit</td><td>Nippon Genetics</td><td>FG-91202</td><td>DNA extraction from agarose gel</td></tr><tr><td>Gel band cutter</td><td>Nippon Genetics</td><td>FG-830</td><td></td></tr><tr><td>Spectrophotometer</td><td>Beckman Coulter</td><td>DU 800</td><td></td></tr><tr><td>Electroporator</td><td>Bio-rad</td><td>1652100</td><td></td></tr><tr><td>Electroporation cuvette</td><td>Bio-rad</td><td>1652086</td><td>0.2-cm gap</td></tr><tr><td>Anaeropack</td><td>Mitsubishi Gas Chemical</td><td>A-03</td><td>Anaerobic culture system</td></tr><tr><td>Brain heart infusion broth</td><td>Becton, Dickinson</td><td>237500</td><td>Bacterial culture media</td></tr><tr><td>Spectinomycin</td><td>Wako</td><td>195-11531</td><td>Antibiotics</td></tr><tr><td>Erythromycin</td><td>Wako</td><td>057-07151</td><td>Antibiotics</td></tr><tr><td>Sucrose</td><td>Wako</td><td>196-00015</td><td>For biofilm development</td></tr><tr><td>CBB R-250</td><td>Wako</td><td>031-17922</td><td>For biofilm staining</td></tr></tbody></table>

generation of a gene-disrupted streptococcus mutans strain without gene cloning

Tipik yöntemleri için belirli bir gen işlevini aydınlatma vahşi tipi zorlanma ve faiz gen getirilmiş bir yük karşılaştırmalı fenotipik analizlerini içerir. Uygun antibiyotik direnci marker gen içeren bir gen-bozulma DNA yapısı gen kesintiye suşları bakterilerde nesil için yararlıdır. Ancak, Gen Klonlama adımlar gerektirir, geleneksel inşaat yöntemleri karmaşık ve zaman alıcı protokolleri içerir. Burada, Streptococcus mutans çoğunlukla hedeflenen gene bozulma için nispeten facile, hızlı ve uygun maliyetli bir yöntem açıklanmıştır. Yöntem 2-adım füzyon Polimeraz zincir tepkimesi (PCR) bozulma yapý ve elektroporasyon genetik dönüşüm oluşturmak için kullanır. Bu yöntem does değil istemek dışında PCR, enzimatik reaksiyon ve ayrıca bozulma yapı tasarım açısından daha büyük esneklik sağlar. Elektroporasyon istihdam yetkili hücreleri hazırlanması kolaylaştırır ve dönüşüm verimliliği artırır. Mevcut yöntem gen kesintiye suşların çeşitli tür üretimi için adapte olabilir.

1st PCR, her ürün boyutunu gösteren Şekil 2 üzerinde % 1'özel jel gözlemlediği gibi yaklaşık 1 kb tahmini boyutu ile iyi anlaşma içinde yapıldı. Şekil 3 2nd PCR ürünlerinin Jel Elektroforez analizini gösterir. Şekil 4 S. mutans çoğunlukla kolonileri bozulma yapý ve koloni PCR ürünleri bir Jel Elektroforez analizi ile dönüştürülmüş gösterir. Amplicons bütün kolonilerden tahmini boyutu vardı. Şekil 5 gtfC bozulma ve Jel Elektroforez PCR ürünlerin doğrulanması için astar bağlayıcı siteleri gösterir. GtfC -özel astar kümesini kullanarak amplifikasyon tarafından elde edilen PCR ürünler doğruladı S. mutans çoğunlukla WT ama S. mutans çoğunlukla ΔgtfC, PCR ürünleri spcrkullanılarak elde ise-belirli astar kümesi içinde S. mutans çoğunlukla ΔgtfC, teyit ama S. mutans çoğunlukla içinde WT 6 rakam Sükroz kaynaklı biyofilm şekillendirme yeteneği her S. mutans çoğunlukla baskı gösterir değil. Yapisan bir biyofilm S. mutans çoğunlukla WT Sükroz huzurunda tarafından kuruldu; S. mutans çoğunlukla ΔgtfB yapisan biyofilm şekillendirme yeteneği daha düşük S. mutans çoğunlukla WT çok düşük yapisan biyofilm oluşumu Sükroz varlığında S. mutans çoğunlukla ΔgtfC sergiledi.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56319/56319fig1.jpg"> 
Bir yolunu 1:Strategy 2-adım fusion PCR için. Sşematik gösterimi. mutans çoğunlukla ΔgtfC inşaat gösterilir. Gen uzunlukları değildir ölçek. (A) Upstream ve downstream kanat gtfC ve spcr bölgelerinde loci PCR tarafından güçlendirilmiş. Astar bağlayıcı siteleri şablonu tarafından aynı modelleri belirtilir. (B) ikinci PCR adım (şablon olarak) ilk PCR adım iç içe astar ile güçlendirilmiş 3 parçaları kullanılarak gerçekleştirildi. (C) bozulma yapı içinde bakteri suşları homolog rekombinasyon için elde edildi. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56319/56319fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56319/56319fig2.jpg"> 
Resim 2: Temsilcisi Jel Elektroforez 1st PCR ürünlerinin. Amplicons gtfC ters yönde kanat bölge ve akış aşağı kanat bölge gtfC ve spcr gösterilir. M: moleküler işaretçisi. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56319/56319fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56319/56319fig3.jpg"> 
Şekil 3: temsilcisi Jel Elektroforez gelen 2nd PCR ürünleri. Ürünler iç içe astar ile güçlendirilmiş ve en dıştaki astar gösterilir. Katı ok bozulma yapı tahmini boyutunu gösterir. M: moleküler işaretçisi.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56319/56319fig4.jpg"> 
Şekil 4: Koloni PCR (A). tarafından gtfC bozulma için eleme S. mutans çoğunlukla kolonileri Spektinomisin içeren BHI agar plaka üzerinde; Her daire içinde koloni kimliği gösterir (B) temsilcisi Jel Elektroforez koloni PCR ürünlerinin; Her daire içinde lane şekil 4Akarşılık gelen koloni kimliği gösterir. M: moleküler marker, WT: Wild-türü genomik DNA şablon olarak kullanılabilir. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56319/56319fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56319/56319fig5.jpg"> 
Şekil 5: Doğrulama PCR tarafından gtfC bozulma. (A) astar bağlayıcı siteleri; Gen uzunluğu değil ölçek. PCR S. mutans çoğunlukla genomik DNA şablon olarak kullanıp gerçekleştirildi. Astar kümeleri: gtfC yukarı-ileri ve gtfC yukarı-ters ( gtfCözel); gtfC aşağı-ileri ve gtfC aşağı-ters ( gtfCözel); gtfC yukarı-ileri ve spcr2-ters ( spcriçin özel); spcr2-ileri ve gtfC aşağı-ters ( spcriçin özel). (B) temsilcisi Jel Elektroforez PCR ürünlerin; her daire içinde lane şekil 5A' ayarlamak karşılık gelen astar gösterir. Tek bir elektroforetik görüntü işaretçisi bantları etiketlemek için ayrılmıştır. M: moleküler işaretleyici (100-baz çifti merdiven). <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56319/56319fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56319/56319fig6.jpg"> 
Şekil 6: fenotipik analizi dayalı biyofilm Development'da. Sükroz kaynaklı biyofilmler her S. mutans çoğunlukla zorlanma tarafından kurulan ile Coomassie parlak mavi lekeli. WT: S. mutans çoğunlukla WT, ΔgtfB: S. mutans çoğunlukla ΔgtfB, ΔgtfC: S. mutans çoğunlukla ΔgtfC. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56319/56319fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Astar çifti</td>
			<td colspan="2">Sıra (5'-3')</td>
			<td>Beklenen Grup boyutu (bp)</td>
		</tr>
		<tr>
			<td>2-adım PCR gtfC bozulma için</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>1 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>yukarı-ileri yukarı geri çevir</td>
			<td colspan="2">AAGATATTTTGATAAGCAATCTGGGAACATGTATC 
			CGAACGAAAATCGA TATTTCCTCCAAAAAT AGTTA</td>
			<td>1,036</td>
		</tr>
		<tr>
			<td>SPCr-ileri 
			SPCr-ters</td>
			<td colspan="2">ATTTTTGGAGGAAATA TCGATTTTCGTTCG TGAAT 
			CTTCTAAGATAAGTA CATATGCAAGGGTTT ATTGT</td>
			<td>1,188</td>
		</tr>
		<tr>
			<td>aşağı-ileri aşağı-ters</td>
			<td colspan="2">AAACCCTTGCATATG TACTTATCTTAGAAG AATAG TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC</td>
			<td>1,059</td>
		</tr>
		<tr>
			<td>2 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>N_up ileri N_down-ters</td>
			<td colspan="2">TTTTATTGAAAACGAAGAAGGTAAATGGCTGTATC GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG</td>
			<td>3,132</td>
		</tr>
		<tr>
			<td>Doğrulama gtfC bozulma</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>Colony PCR tarama için</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>S_spcr-ileri S_spcr-ters</td>
			<td colspan="2 colspan=""></td colspan="2></tr></tbody></table>"> GGATCAGGAGTTGAGAGTGGACTAAAACCAAATAG CAGCCACTGCATTTCCCGCAATATCTTTTGGTATG
			<td>535</td>
		
		<tr>
			<td>Son doğrulama</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>gtfC yukarı-ileri 
			gtfC up-ters</td>
			<td colspan="2">TACGGCCGTATCAGTTATTACGATGCTAACTCTGG GGTTGGTTGAGATGTTGCTGAAGTTGCTGTACTTG</td>
			<td>498</td>
		</tr>
		<tr>
			<td>gtfC aşağı-ileri 
			gtfC aşağı-ters</td>
			<td colspan="2">GCCTTAATTGGTTGGCATGTTGTTGAAGGAAGACG TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG</td>
			<td>557</td>
		</tr>
		<tr>
			<td>gtfC yukarı-ileri 
			spcr2-ters</td>
			<td colspan="2">Yukarıda açıklanan CCACTCTCAACTCCTGATCCAAACATGTAAGTACC</td>
			<td>641</td>
		</tr>
		<tr>
			<td>spcr2-ileri 
			gtfC aşağı-ters</td>
			<td colspan="2">GTGGCTGAATCTTCTCCATTAGAACATAGGGAGAG Yukarıda açıklanan</td>
			<td>623</td>
		</tr>
	

Tablo 1: astar kullanılan bu protokol için. Altı çizili dizisi ' up-ters ve spcr-İleri ' ve 'spcr-ters ve aşağı-ileri ' tamamlayıcı niteliktedir. Kalın yazılan dizisi ' up-ters ve spcr-İleri ' ve'spcr- r ve aşağı-ileri' tamamlayıcı vardır.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reaktif</td>
			<td>Konsantrasyon hisse senedi çözümleri</td>
			<td>Birim</td>
			<td>Son konsantrasyonu</td>
		</tr>
		<tr>
			<td>DNA polimeraz Premiks</td>
			<td>2 ×</td>
			<td>25 μL</td>
			<td>1 ×</td>
		</tr>
		<tr>
			<td>İleri astar</td>
			<td>5 MİKRON</td>
			<td>2 μL</td>
			<td>0.2 ΜM</td>
		</tr>
		<tr>
			<td>Ters astar</td>
			<td>5 MİKRON</td>
			<td>2 μL</td>
			<td>0.2 ΜM</td>
		</tr>
		<tr>
			<td>Şablon DNA</td>
			<td>Değişken</td>
			<td>Değişken</td>
			<td>Değişken * ** ***</td>
		</tr>
		<tr>
			<td>Deiyonize su</td>
			<td>-</td>
			<td>En fazla 50 μL</td>
			<td>-</td>
		</tr>
	</tbody>
</table>
Tablo 2: PCR reaktifler. * 1st için adım PCR; 100 ng. ** 2nd için PCR; 1st adım PCR amplicon her 30-50 ng. Koloni için PCR; reaksiyon karışıma bakteri hücreleri doğrudan eklenmesi.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Döngüsü adım</td>
			<td>Sıcaklık</td>
			<td>Zaman</td>
			<td>Döngü sayısı</td>
		</tr>
		<tr>
			<td>İlk denatürasyon</td>
			<td>98 ° C</td>
			<td>2 dk</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denatürasyon Tavlama Uzantısı</td>
			<td>98 ° C 55 ° C 72 ° C</td>
			<td>10 s 5 s Amplicon bağımlı (1 dk/1 kbp)</td>
			<td>35</td>
		</tr>
		<tr>
			<td>Son uzantısı</td>
			<td>72 ° C</td>
			<td>Amplicon bağımlı (1 dk/1 kbp)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Tablo 3: PCR güçlendirme döngüleri.

Watch this Scientific Journal Video about Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning at JoVE.com

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Streptococcus mutans çoğunlukla gen kesintiye üretimi için facile, hızlı ve nispeten ucuz bir yöntem tarif suşları; Bu teknik gen kesintiye suşların çeşitli tür üretimi için adapte olabilir.

Nesil bir gen kesintiye Streptococcus mutans çoğunlukla zorlanma olmadan Gen Klonlama

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

generation-gene-disrupted-streptococcus-mutans-strain-without-gene

Nanyang Technological University

Research

JoVE Journal

Genetics

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

7.6K Görüntüleme.  Tsurumi University School of Dental Medicine. Streptococcus mutans çoğunlukla gen kesintiye üretimi için facile, hızlı ve nispeten ucuz bir yöntem tarif suşları; Bu teknik gen kesintiye suşların çeşitli tür üretimi için adapte olabilir.

Video: Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different conditions often leads to the production of new compounds. Therefore, production cultures of the strains are extracted with ethyl acetate and the crude extracts are analyzed by HPLC. Furthermore, the extracts are tested for their bioactivity by different assays. For structure elucidation the compound of interest is purified by a combination of different chromatography methods.
Genome sequencing coupled with genome mining allows the identification of a natural product biosynthetic gene cluster using different computer programs. To confirm that the correct gene cluster has been identified, gene inactivation experiments have to be performed. The resulting mutants are analyzed for the production of the particular natural product. Once the correct gene cluster has been inactivated, the strain should fail to produce the compound.
The workflow is shown for the antibacterial compound polyketomycin produced by Streptomyces diastatochromogenes T&#252;6028. Around ten years ago, when genome sequencing was still very expensive, the cloning and identification of a gene cluster was a very time-consuming process. Fast genome sequencing combined with genome mining accelerates the trial of cluster identification and opens up new ways to explore biosynthesis and to generate novel natural products by genetic methods. The protocol described in this paper can be assigned to any other compound derived from a Streptomyces strain or another microorganism.

Here we present a detailed protocol of (A) the identification of a natural product with antibiotic activity, (B) the purification of the compound, (C) the first model of its biosynthesis, (D) genome sequencing/-mining and the (E) verification of the biosynthetic gene cluster.

dan Polyketomycin kullanma A Gösteri: Its Biyosentetik Gen kümesi için bir Doğal Ürün dan<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Genetik

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Çoklu Gen Delesyonlar Taşıma Maya Suşlarında Nesil için Yeşil Canavar Süreci

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Biyoloji

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Streptococcus mutans'larda Yüksek Moleküler Kütle Proteininin Saflaştırılması

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

İmmünoloji ve Enfeksiyon

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Genom çapında Gen Delesyonlar içinde<em&gt; Streptococcus sanguinis</em&gt; Yüksek Verimli PCR ile

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Pseudomonas aeruginosa In-Frame Gen Silme Mutantlar Üretimi ve Enfeksiyon Basit Bir Fare Modelinde Virülans Zayıflama sıiçin Test

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Markerless Gene Deletion by Floxed Cassette Allelic Exchange Mutagenesis in Chlamydia trachomatis

Chlamydia trachomatis is an obligate intracellular pathogen that has been historically difficult to genetically manipulate. Definitive progress in elucidating the mechanisms that C. trachomatis use to create and maintain a privileged intracellular niche has been limited due to a lack of genetic tools. Fortunately, there have recently been several new advances in genetic manipulation techniques. Among these is the development of fluorescence-reported allelic exchange mutagenesis (FRAEM). This method allows targeted gene deletion coupled with insertion of a selection cassette encoding antibiotic resistance and green fluorescent protein (GFP). Reliance on this strategy can be complicated when targeting genes within polycistronic operons due to the potential of polar effects on downstream genes. Floxed cassette allelic exchange mutagenesis (FLAEM), the protocol for which is described here, was developed to alleviate cassette-induced polar effects. FLAEM utilizes Cre-loxP genome editing to remove the selection cassette after targeted deletion by allelic exchange. The resulting strains contain markerless gene deletions of one or more coding sequences. This technique facilitates direct assessment of gene function and expands the repertoire of tools for genetic manipulation in C. trachomatis.

Markerless Gene Deletion by Floxed Cassette Allelic Exchange Mutagenesis in Chlamydia trachomatis

Described here is a method for targeted, markerless gene deletion in Chlamydia trachomatis using floxed cassette allelic exchange mutagenesis, FLAEM.

Klamidya trachomatis Floxed Kaset Allelic Exchange Mutagene tarafından Markerless Gen Deletion

Chlamydia trachomatis is an obligate intracellular pathogen that has been historically difficult to genetically manipulate. Definitive progress in ...

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, studies in this serotype have been hindered by the lack of genetic tools to modify it. In this study, we describe a method to genetically modify a serotype 1 clinical isolate (strain 519/43). Interestingly, this was achieved by exploiting the Pneumococcus&#8217; ability to naturally acquire DNA. However, unlike most pneumococci, the use of linear DNA was not successful; to mutate this important strain, a suicide plasmid had to be used. This methodology has provided the means for a deeper understanding of this elusive serotype, both in terms of its biology and pathogenicity. To validate the method, the major known pneumococcal toxin, pneumolysin, was mutated because it has a well-known and easy to follow phenotype. We showed that the mutant, as expected, lost its ability to lyse red blood cells. By being able to mutate an important gene in the serotype of interest, we were able to observe different phenotypes for loss of function mutants upon intraperitoneal and intranasal infections from the ones observed for other serotypes. In summary, this study proves that strain 519/43 (serotype 1) can be genetically modified.

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

Serotip 1 Streptococcus pneumoniae suşunda Mutantların İnşası 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

Bakteriyel Glikoziltransferazların Bakteriyel Motilitedeki Rolünü Aydınlatmak için Boş Mutantların Üretilmesi

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

Üretilmesi<em&gt; Enterobacter</em&gt; Sp. YSU oksotroflan transpozon mutajenezi kullanarak,

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Model siyanobakteri Türlerinde İşaretli ve belirtisiz Mutants Üretimi

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

Nesil bir gen kesintiye Streptococcus mutans çoğunlukla zorlanma olmadan Gen Klonlama

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

dan Polyketomycin kullanma A Gösteri: Its Biyosentetik Gen kümesi için bir Doğal Ürün dan