Jasmin Kresse usta teknik yardım minnetle kabul edilmektedir.

Kesin endoderm doğru İnsan ESC 1. Farklılaşma <ol><li> 37 ° C&#39;de bir kuluçka insan embriyonik kök hücreleri (ESCs) yetiştirmek ve% 5 CO2. </li><li> Coat bazal membran matris 1 ml yeni 6 oyuklu hücre kültürü plakasının ve oda sıcaklığında en az 30 dakika süre ile kültür eşya inkübe edin. Belirli ayrıntılar için ilgili üreticinin talimatlarına çevirmek lütfen. </li><li> Kültürlü insan EKH (örneğin, 4X) düşük büyütme kullanılarak mikroskop altında% 80 -90% confluency ulaşmış emin olun. steril cam Pasteur pipetiyle orta kapalı emerek boşluklardan gelen orta aspire. Fosfat tamponlu tuz (PBS) çözeltisi ile bir kez hücreler yıkanır. Bunun için, usulca her kuyuya 2 ml PBS eklemek plaka sallamak ve ölü hücreleri ve hücre enkaz kaldırmak için çözüm emmek. </li><li> hücre kümeleri nazik ayrışması için enzim içermeyen pasajlama çözüm reaktif 1 ml ekleyin. 37 ° C, bir hücreleri inkübed% 5 CO 2 hücreleri küçük kümeler halinde bozulma net işaretler göstermek kadar. NOT: İnkübasyon süresi kullanılan reaktif bağlıdır. malzemeler bölümünde belirtilen enzim içermeyen pasajlama çözümü için, kuluçka süresi yaklaşık 7 dk. </li><li> 1 mi DMEM / F-12 ortamı ilave edin ve pipetleme ve 1 ml pipet ucu kullanarak aşağı tek bir hücre içine kalan hücre birikintisinin yok. yüzey hücreleri temizleme ve bir santrifüjleme tüp hücreleri aktarmak için kullanın. Tüm hücreler almak için, DMEM / F-12 ortamı, 1 ml her bir yıkama ve santrifüj tüpüne orta ekleyin. </li><li> g x 300, 5 dakika boyunca hücreler santrifüj. Süpernatant aspire ve 10 uM, Rho-kinaz (rock) inhibitörü içeren 5 ml ES hücre kültürü ortamında tekrar süspansiyon hücreleri. </li><li> hemasitometre kullanarak mikroskop altında hücrelerin sayısı ve 150.000 tohum - kullanılan ES hücre hattı bağlı, 6-kuyu başına ya da başka bir plaka taslağına 400.000 hücreleri. Kullanım cul37 ° C ve% 5 CO2 seviyesinde apoptozu ve kültür, bir kuluçka makinesi içinde hücreleri önlemek için orta ihtiva eden 10 uM ROCK inhibitörü Ture. </li><li> Yaklaşık 24 saat steril cam Pasteur pipet ile orta aspirat tohumlama ve ilkel çizgi indüksiyon orta 2 ml ekleyin sonra. NOT: Bu ortam Gelişmiş RPMI-1640 ortamı içinde% 1 glutamin,% 0.2 FCS, 5 uM CHIR-99.021 ve 50 ng / ml, aktivin A&#39;nın nihai konsantrasyonlar içerir. Genel olarak, 6 oyuklu plakalar içinde kültivasyonu için ortam 2 ml kullanın. </li><li> 48 saat tohumlama sonra, indüksiyon orta endoderm için orta yerine. Günlük bir değiştirilen ortam içinde bir 48 saat daha, bu ortam içinde hücrelerin kültive edilmesi. NOT: Bu ortam Gelişmiş RPMI-1640 ortamı içinde% 1 glutamin,% 0.2 FCS ve 50 ng / ml aktivin A ihtiva etmektedir. Kesin endoderm doğru kararlıyız Hücreler yüzey işaretleyici CXCR4 ifade eder. CXCR4&#39;ün boyama DE-işlenen hücrelerin sayısını belirlemek için kullanılabilir. </li></ol><pclass = &quot;jove_title&quot;&gt; 2. Sitometrisi Analizi CXCR4 + Kesin Endoderm Hücrelerinin boyanması <ol><li> hasat öncesi son 24 saatte, ancak en az 1 saat süre ile hücre kültür ortamına 10 uM ROCK önleyici. </li><li> Kat yani bazal membran matrisi ile yeniden oluşturma, kullanılacak hücre kültürü ürünleri, immünofloresan boyama qPCR analiz veya oda slaytlar 12 oyuklu plakalar. Oda sıcaklığında en az 30 dakika boyunca plakaları veya slaytlar inkübe edin. </li><li> boyama ve / veya sıralama için kullanılan farklılaşmış hücrelerin kuyulardan steril cam Pasteur pipet ile orta aspire. </li><li> hücre kümeleri nazik ayrışması için enzim içermeyen pasajlama çözüm reaktif 1 ml ekleyin. Hücreler küçük kümeler halinde bozulma net belirtileri göstermeye kadar CO 2 37 ° C&#39;de inkübe hücreleri ve% 5. NOT: İnkübasyon süresi kullanılan reaktif bağlıdır. Bakır Aynalar belirtilen enzim içermeyen pasajı çözümü içinals bölümü, kuluçka süresi yaklaşık 7 dk. </li><li> 1 ml DMEM / F-12 orta ekleyin ve yukarı pipetleme ve 1 ml ucunu kullanarak aşağı tek hücre içine hücre agrega kalan bozabilir. yüzey hücreleri temizleme ve bir santrifüjleme tüp hücreleri aktarmak için kullanın. Tüm hücreler almak için, / FCS O W, DMEM / F-12 ortamı, 1 ml her bir yıkama ve santrifüj tüpüne orta ekleyin. </li><li> hemasitometre kullanarak mikroskop altında hücreleri saymak. 6 yuvalı plaka üç kuyu hücre farklılaşmasının üç gün sonra 10-15 x 10 6 hücre ile sonuçlanmalıdır. g x 300, 5 dakika boyunca hücreler santrifüj. Not: Elde edilen hücreler tam sayısı ayırımında kullanılan pluripotent hücre hattına bağlıdır. </li><li> Süpernatant aspire ve 10 uM ROCK inhibitörü içeren PEB tampon içinde tekrar süspansiyon hücreleri. 10&#39;a kadar 7 hücreleri, bu tampon 100 ul kullanın. staini gününde 10 uM ROCK inhibitörü eklemeng. (PEB tamponu + UR olarak anılacaktır) tüm alt uygulamalar için bu tampon kullanın. NOT: PEB tamponu,% 0.5 BSA ve PBS içinde 2 mM EDTA içermektedir. daha fazla hücre lekeli isteniyorsa, buna göre tampon seviyesini ayarlamak. </li><li> Bu kabaca 1:10 seyreltme temsil 100 ul 10 7 hücre başına bir CXCR4-APC antikoru 10 ul ekleyin. NOT: Bir APC bağlı antikor kullanımı zorunlu değildir. Bunun yerine kullanılan mikro-bağlı ikame edilebilir. daha fazla hücre lekeli gerekiyorsa buna göre antikor seviyesini ayarlamak. </li><li> hafifçe parmak boru çevirerek karıştırın ve 15 dakika boyunca bir buzdolabında 4 ° C&#39;de inkübe edin. 1-2 ml PEB tamponu ile tekrar süspansiyon hücreleri. g x 300, 5 dakika boyunca hücreler santrifüj. </li><li> Steril cam Pasteur pipetle süpernatant aspire ve 10 7 hücre başına 80 ul PEB hücre pelletini ve 20 ul anti-APC mikroboncukları ekleyin. NOT: </sdaha fazla hücre lekeli isteniyorsa trong&gt;, buna göre mikro boncuk ses seviyesini ayarlamak. </li><li> hafifçe parmak boru çevirerek karıştırın ve 15 dakika boyunca bir buzdolabında 4 ° C&#39;de inkübe edin. 1-2 ml PEB tamponu + RI ile hücreleri tekrar süspansiyon. g x 300, 5 dakika boyunca hücreler santrifüj. tampon aspire. 500 ul PEB tamponu + RI içinde süspanse. </li></ol> CXCR4&#39;ün + Hücreleri 3. Manyetik Ayırma <ol><li> üretim talimatlarına göre bir manyetik alan içinde orta büyüklükte bir manyetik sütun yerleştirin. 500 ul PEB tamponu + RI ile sütun ön durulayın. sütun tüm hücre süspansiyonu uygulayın. kolona bağlanacağı şekilde tüm hücreler akışı toplamak. Emin CXCR4 + hücreler optimum alımı için sütunları rahatsız etmemek olun. </li><li> sütun 500 ul PEB tamponu + RI ile üç kez yıkayın. üzerinden ilk akışını toplamak ve Adım 3.1 toplanan hücreler ile birleştirmek. manyetik alan manyetik sütun çıkarın ve koyunUygun toplama tüpü. kolona 1 mi PEB tamponu + RI ekleyin. Hücreler sıkıca sütuna pistonu bastırın Zehir için. </li><li> İsteğe bağlı: ayrı ayrı örnekler üzerinden tüm akışını toplamak ve akım sitometri kullanarak CXCR4 + hücrelerin sayısını analiz etmek 20 ul her kullanın. Onların sayısı her yıkama adımda düşüş gerekir. NOT: En az 2 x 10 4 canlı, kapı hücreler güvenilir sonuçlar için sayılmalıdır. </li><li> Tekrarlayın Adım 3.1 numune boyunca toplanan akışı ve yeni bir sütun kullanarak adım 3.2 numune boyunca ilk akışı ile 3.1-3.3 adımları tekrarlayın. Do not önceki sütun yeniden kullanın. piston havası kullanılarak bloke sütunun içine bastırılır. </li><li> hemasitometre kullanarak mikroskop altında hücreleri saymak. 6 x 10 6 hücre farklılaşma kadar etkinliğine bağlı olarak, ilk kriteri ve işlem 10 7 hücreleri kullanıldığında, ikinci bir kolon kullanılarak bir 1 x 10 6 hücre olabilir. </li&gt; <li> 5 dakika boyunca 300 xg&#39;de hücreleri Santrifüj. Süpernatant aspire ve steril bir cam Pasteur pipetle ve ek 10 uM ROCK inhibitörü ile Adım 1.9 1 ml endoderm indüksiyon ortamı hücreleri tekrar süspansiyon. </li><li> hemasitometre kullanarak mikroskop altında hücreleri saymak. Uygun bir yoğunlukta hücreler Tohum, yani ~ 12 oyuklu plakanın her bir kuyucuğu başına 4 x 10 5 hücre (app. 3.6 cm2 yüzey) ya da ~ 8 oyuklu odacık sürgünün oyuk başına 1.5 x 10 5 hücre. </li></ol> 4. İsteğe bağlı: Arıtılmış Kesin Endoderm Nüfus Analizi <ol><li> immünofloresan boyama kabaca 24 saat kesin endoderm (DE) ve / veya Pluripotency işaretleyici proteinleri% 4 formaldehit ve leke tohumlama sonra Adım 3.7 saflaştırılmış hücreleri düzeltmek. Not: Genellikle kullanılan DE belirteçler FOXA2 ve SOX17 arasında, yaygın olarak kullanılan pluripotense belirteçleri OCT3 / 4, Nanog ve Sox2 6, 8 bulunur. </li><li> foR RT-qPCR analizi, doğrudan ya da 24 saat sonra tohumlama saflaştırılmış hücreler hasat Toplam RNA çıkarmak ve çıkarılan toplam RNA örneklerinden cDNA ters transkribe. DE ve pluripotense işaretçi genler 6, 8 ekspresyonunu analiz etmek için RT-qPCR reaksiyon (kopyaların) cinsinden kalıp olarak 10 ng cDNA kullanın. Not: Genellikle kullanılan marker genleri Aşama 4.1&#39;de bahsedilmektedir. Döngü koşulları eğrisi analizi eriterek, ardından 95 ° C&#39;de 5 dakika ve 95 ° C&#39;de 15 saniye 40 döngü, 60 ° C&#39;de 1 dakika, bulunmaktadır. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

Şu anda kullanılan farklılaşma protokolleri nadiren% 100 farklılaşmış hücrelerin neden. hala ele alınması gereken nedenlerden dolayı bazı hücreler farklılaşma sürecini karşı. kullanılan farklılaşma protokolünün verimlilik ve ESC eğilimi bağlı kalan pluripotent hücrelerin belirli bir sayıda yaygın, hatta kesin endoderm içine farklılaşma sonra gözlenir hattı. Bunlar artık hücreler gibi transkriptomik, proteomik ve miRNA ifade analizi olarak aşağı farklılaşmaları veya daha fazla analiz bozabilir. Kalıntı pluripotent hücreler veya diğer istenmeyen soyların da farklılaşma hedefleri müdahale edebilir parakrin etkileri görülebilir. Sonuç olarak, bu hücrelerin çıkarılması daha iyi bir reprodüksiyon neden olabilir. CXCR4 farklılaşma sonra endoderm hücreleri ifade eden + saflaştırılması bu popülasyonlarının zenginleştirmek ve farklılaşma sürecine direnen hücreleri çıkarmak için kullanılabilir.Yüzey DE markör proteinin CXCR4 endoderm hücrelerinin spesifik saflaştırılması için de kullanılabilir. eldeki MACS arıtma protokolü az 2 saat içinde tamamlanabilir ve pahalı laboratuar ekipman ve cihazlar olmadan her hücre kültürü laboratuvarında basit bir masa üstü formatında çalıştırılabilir. FACS arıtma yaygın olarak kullanılan bir tekniktir ancak sert koşullar kullanır. FACS sırasında saflaştırma hücreler genellikle uzun bir süre ile süspansiyon içinde muhafaza ve hücreler, diğer zor faktörler, FACS cihazının ağızlık örneğin, yüksek basınca tabi tutulmaktadır. Buna karşılık MACS prosedürü hızlı ve nazik. Bu saflaştırma işlemi sonrasında yeniden tohumlama esnasında iliştirmeniz hücrelerin yeteneğini geliştirir. daha bu tekrar tespit kolaylaştırmak için bir kaya önleyicisi sonra önce apoptozu önlemek için saflaştırma, kültür ortamına ilave edilir. yatıştırıldı etkileyen bir diğer önemli faktör hücrelerin reseeded edildikleri yoğunluğudur. Bu durum kuvvetle bağımlılığındakikullanılan hücre hattı üzerinde ds. Bu çalışmada ekim için kullanılan hücre sayıları elimizde iyi çalışır temsili hücre sayılardır. Bununla birlikte, farklı hücre hatları için bu numaraları ayarlamak için ihtiyacı olabilir. Her iki tedbir de, bir ROCK inhibitörü eklenmesi ve yeniden tohumlama için hücre sayıları değerlendirilmesi, sıralama sonra daha hücre kültürünün başarısı için kritik öneme sahiptir. Kullanılan DE farklılaşma protokolü ile tipik&gt;% 70 CXCR4 + hücreleri 8 sıralama olmadan elde edilebilir. DE üretimi için kullanılan protokol performans dolayısı ile de daha sonraki MACS arıtma protokolü verimliliğini etkiler. Genel, verimli farklılaşma (&gt;% 80 CXCR4 + hücreleri) MACS (% 95 kadar) sıraladıktan sonra daha yüksek bir saflık verir. Bu durumda, bu saflaştırma yöntemi kullanım esas ancak% 100 saflıkta elde edilemez farklılaşmamış hücrelerin sayısını azaltır. Gelecekte, soy spesifik yüzey işaretleyicileri T tanımlanabilirşapka daha terminal farklılaşmış hücrelerin saflaştırılması izin verecektir. MACS sıralama prosedürü bu amaç için Başbakan seçim.

embriyonik kök hücrelerin (ESCs) halinde pluripotent kök hücreleri, insan vücudunun hemen hemen herhangi bir hücre türü ayırt etmek yeteneğine sahiptir. Bu nedenle, in vitro farklılaşma protokolleri, kardiyomiyositlerde 1, hepatositler 2, beta hücreleri 3 akciğer epitelyal 4 ya da nöronal hücrelerin 5 gibi çok sayıda yetişkin hücre türleri oluşturmak için de kullanılabilir. Bu ESCS çeşitli dejeneratif hastalıkların 3 potansiyel tedavisi için değerli bir araç sağlar. Akciğer, karaciğer ve pankreas yetişkin dokularda doğru EKH in vitro farklılaşma kesin endoderm (DE) 6 andıran hücreleri içine bir sözde Gastrulasyon gerektirir. Bahsedilen somatik hücre tiplerinin üzerinden aşağı doğru farklılaşma önemli ölçüde daha az etkili olduğu için, optimal bir endoderm farklılaşma 7 oran-sınırlayıcı olarak kabul edilir. endoderm soy doğru kararlıyız Hücreler cha geçmesigen ekspresyon profili Karakteristik değişir. Pluripotensin ana düzenleyici genler aşağı düzenlenir gibi 9. CXCR4 Smad2 tarafından Transaktive bilinmektedir FOXA2, SOX17, HNF1B GATA aile üyeleri ve CXCR4 yüksek 6 yukarı düzenlenen bir yüzey reseptörü, 8, diğer transkripsiyon faktörleri salınımı / 3, bağlı, destekleyici bölgesi 10&#39;da spesifik bağlanma sitelerine düğüm / TGF-β sinyalizasyon ve SOX17 aşağı doğru. Böylece raporları 6, 8, 11-13, bir dizi kullanılan çok uygun bir belirtecidir. Bu sentezleme değişiklikler ESCs ilk ilkel bir çizgi-benzeri hücre popülasyonunun özelliklerini kazanmak ve daha sonra endoderm tohumu tabaka 6 olarak tamamlama olan bir sözde-Gastrulasyon etkinliği yansıtmaktadır. Birkaç hücre farklılaşma sürecine karşı veya diğer istenmeyen soyları 14 doğru ayırt edilebilir Ancak, farklılaşma protokolleri nadiren% 100 etkilidir. Bu hücreler, negatif ha olabilirnce ileri farklılaşma. Ayrıca, artık farklılaşmamış hücreler daha sonra transplantasyon deneyler için büyük riskler barındıran ve teratom 15-17 sebebiyet verebilir. Erken yüzey işaretleyici CXCR4 DE 18 doğru işlenen hücrelerin saflaştırılması için de kullanılabilir, bu istenmeyen hücreleri çıkarmak için. Burada, DE farklılaşma kültürlerinden CXCR4 + hücreleri pozitif seçim için bir yöntem tarif eder. Bunun için, yüzey işaretleyici CXCR4 daha sonra da manyetik mikro boncuklar bağlanan bir antikor ile bağlıdır. FACS sıralama sırasında zorlu koşullarda farklı olarak, manyetik olarak etiketlenmiş DE-benzeri hücreler, daha sonra kolayca hafif bir saflaştırma yöntemi kullanılarak bir tezgah üstü bir biçimde saflaştırılabilir. Bu protokol, DE farklılaşma sürecine karşı hücre popülasyonlarının çıkarılması için basit bir yöntem sağlar.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

embriyonik kök hücrelerin (ESCs) halinde pluripotent kök hücrelerin farklılaşması yetenekleri hücre yenileme terapisi için potansiyel bir terapötik uygulama sağlar. Terminal olarak farklılaşmış hücre türleri., Çeşitli dejeneratif hastalıkların tedavisinde kullanılan, akciğer, karaciğer ve pankreas dokularında karşı bu hücrelerin in vitro farklılaşma, bir birinci basamak olarak kesin endodermal hücrelerinin üretilmesini gerektirir edilebilir. Bu adım, oran-sınırlayıcı insülin üreten beta hücrelerinin hepatositlere ya da diğer endoderm türetilmiş hücre türleri terminal olgun hücre tipleri yönünde daha fazla türev içindir. endoderm soy doğru kararlıyız Hücreler çok böyle FOXA2, SOX17, HNF1B GATA aile üyeleri ve yüzey reseptörü CXCR4 olarak transkripsiyon faktörlerinin çok sayıda ifade eder. Ancak, farklılaşma protokolleri nadiren% 100 etkilidir. Burada, farklılaşma sonra CXCR4 + hücre popülasyonunun saflaştırılması için bir yöntem açıklanmaktadırManyetik mikroboncuklarm kullanarak DE içine. Bu saflaştırma ek istenmeyen soy hücreleri ortadan kaldırır. yumuşak bir saflaştırma yöntemi, hızlı ve güvenilir olduğu ve aşağı doğru uygulamalar ve farklılaşmaları geliştirmek için kullanılabilir.

farklılaşma üzerine EKH gen ve protein ekspresyonu köklü değişim geçirirler. 1 başarılı endoderm farklılaşmasını kontrol etmek için kullanılabilecek tipik marker genleri tasvir etmektedir. Bir gen ekspresyon analizi için ana hedeflerdir GSC, FOXA2 ve SOX17 bulunmaktadır. Farklılaşmamış EKH karşılaştırıldığında göreceli gen ekspresyon analizi, özellikle FOXA2 ve SOX17&gt; 2.000 kat artmıştır. GSC önce ilkel çizgi oluşumu sırasında çok erken 24 saat içinde ifade edilir ancak yine de dördüncü günde&gt; 100 kat indüklenir. Bu genlerin sentezlenmesi Sonuç olarak CXCR4 yüzey işaretleyici 6 kullanılarak sıralama sonra artar. Bu genlerin ekspresyonu halen dört gün sonra tespit edilebilir, ancak bu OKT3 / 4 (POU5F1) ve NANOG olarak pluripotensinin ana regülatör önemli ölçüde aşağı regüle edilir. bu indicabazı hücreler yeterince CHIR-99021 ve aktivin A. SOX7 gen ifadesi ile tedavi rejimine yanıt vermeyen tes genellikle DE karşı ekstra-embriyonik endoderm oluşumunu ayırt hitap etmektedir. İlk durumda SOX17 birlikte ifade SOX7 ve ikinci durumda SOX17 birlikte ifade FOXA2 sahip olmasıdır. Şekil 1&#39;deki sonuçlar henüz SOX7 + hücreleri boyamak için mümkün olmamıştır, ancak DE birlikte bazı ekstra embriyonik hücreler, farklılaşma sırasında meydana gelmiş olabileceğini göstermektedir. Şekil 2 DE içine EKH farklılaşma sonra mevcut olan farklı hücre popülasyonları göstermektedir. Aşama 1 EKH tek hücreler olarak tohumlanır ve sonra dört gün CHIR-99.021 ve aktivin A ile muamele ile ayırt. DE lekelenme SOX17 ve FOXA2 (Şekil 2A) hem belirteçler eşit eş Expresse olduğunu göstermektedir işaretleyicileriçekirdek içindeki, d. Bu DE bağlılık damgasını olarak kabul edilir. Bununla birlikte, bazı hücreler farklılaşma sürecine karşı iki DE işaretleyici proteinler (Şekil 2A) ne de ifade eder. Aslında, iki farklı hücre popülasyonları dört günlük farklılaşmanın sonra gözlenir. Birçok hücre DE işaretleyici FOXA2 ifade ederken hala Pluripotency işaretleyici Sox2 (Şekil 2B) ifade kalan hücreler vardır. Bu iki protein, iki ayrı popülasyonları olarak ifade edilmiştir ve hiç birlikte ifadesi, (Şekil 2B) gözlenebilir. gün üç veya farklılaşma dört yüzey proteini CXCR4 DE-taahhüt CXCR4 + nüfusu sıralamak ve böylece kalan pluripotent hücreler ve diğer istenmeyen soy kaldırmak için kullanılır. Kullanılan hücre dizisi farklılaşması verimliliğine bağlı olarak&gt;% 80 CXCR4 + hücreleri Aşama 1. 8 de tarif farklılaşma protokolü kullanılarak elde edilebilir </sus&gt;. Burada kullanılan HES3 hattı DE ve doğru farklılaşmadan sonra + hücreler sıralama ve% 92 ±% 4 sıralama sonra (n = 3). Boyama ve CXCR4&#39;ün MACS saflaştırmadan sonra veri akış sitometrisi betimlediği Şekil 3 daha önce% 66 ±% 3, CXCR4-pozitif hücrelerin vermiştir önce ve MACS saflaştırmadan sonra immünofloresan (IF) lekeleme kullanarak yaygın DE ve pluripotense markör proteinlerin ifadesini gösterir. Aşama 2&#39;de tarif edilen CXCR4 için immünofloresan boyama ile yaklaşık% 60 CXCR4 + hücreleri (Şekil 3A, orta panel) ürün elde edilmiştir farklılaşma üçüncü günde. CXCR4 + hücreleri APC konjuge anti-CXCR4 antikoru ile boyanma üzerine Q1 Q4 hareket. MACS saflaştırma Aşama 3&#39;te tarif sonra CXCR4 + popülasyonu% 85 zenginleştirilmiştir. Saflaştırma yöntemi özellikle, ancak, kültürlerden istenmeyen soyları (Şekil 3A, sağ panel) ortadan kaldırmaz. MACS saflaştırmadan sonra,CXCR4 + hücreleri daha fazla analiz için ekilmiş edilebilir veya isteğe bağlı olarak sıralama bir ikinci tur yüksek saflık ancak daha az canlılığı elde etmek için gerçekleştirilebilir. (Yeşil lekeli) Pluripotency işaretleyici Sox2 ve yaygın ifadesini farklılaşmasını önce IF boyama ile tespit edilir. Buna karşılık, (kırmızı lekeli) DE markör FOXA2 (Şekil 3B) tespit edilemez. Şekil 3C CXCR4 +, hücreler FOXA2 (yeşil) için antikorlar ile boyandı ve pluripotense markör Sox2 (kırmızı) birlikte boyandı. Arıtılmış CXCR4 + hücreleri tohumlama sonra sadece birkaç Sox2 + hücreler tespit edilir. numaralı seribaşı hücrelerin çoğunluğu DE işaretleyici FOXA2 için olumludur. <img alt="Şekil 1" src="/files/ftp_upload/53655/53655fig1highres.jpg" width="700" /> Dört günlük bir endoderm farklılaşması sırasında farklı pluripotense ve endoderm marker genlerinin gen ekspresyonu 1. Örnek değişiklikler Şekil. (A) </protokol güçlü&gt; Çizim gen ekspresyon analizi ve ardından endoderm farklılaşması için kullanılır. Rastgele RP referans protokolü 7, A yalnız aktivin ile bir tedavi ve CA-A kullanılarak farklılaşma gösterir, herhangi bir büyüme faktörleri olmadan kültür koşullarına gösterir (CHIR-99021 ve aktivin A) sıralama MACS için kullanılan protokol, (8 detaylara bakınız). CA-A protokolde kullanılan medya burada ilkel çizgi indüksiyon orta ve endoderm indüksiyon ortamı olarak adlandırılır. Tasvir (B) olmadan kesin endoderm taahhüt üzerine ifade GSC, SOX17 ve FOXA2 RT-qPCR tarafından ölçülen gen ifadesi daha fazla MACS sıralama. POU5F1 (Zeiss OCT3 / 4) ve Nanog Pluripotency düzenleyicileri ve SOX7 ekstra embriyonik endoderm ifade edilir ise genellikle aşağı, farklılaşma üzerine düzenlenir. gen ekspresyonu &lt;(üç stabil olarak ifade edilen hazırlık geninin karşı normalize edildiem&gt; CNRQ değerleri ile sonuçlanır TBP, TUBA1A, G6PD). farklılaşmamış hücreleri, yukarıda belirtilen genlerin ekspresyonu 1&#39;e ayarlandı ve değişiklikler gen ekspresyonu kat değişiklik olarak çizilmiştir. Değerler ortalama ± SEM, n = 4-5. ANOVA artı Bonferroni post hoc testi. ** P ≤ 0.01 Rastgele ve #P ≤ 0.05 ile karşılaştırıldığında, RP (bu rakam içindeki tüm veriler son zamanlarda 8 yayınlanmıştır) ile karşılaştırıldığında 0.01 ≤ ## P. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53655/53655fig1highres.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53655/53655fig2.jpg" /> Endoderm farklılaşma sonra 2. Farklı hücre popülasyonlarının Şekil. DE (A) ile boyanarak SOX17 ve farklılaşma d4 ilgili antikorlar ile FOXA2 kendi homojen birlikte-lokalizasyonunu ortaya işaretler. Bununla birlikte, bazıHücreler farklılaşma sürecini direndi ve (mavi çekirdek boyama için) bu belirteçler ifade etmezler. Yeşil ve kırmızı boyama birleştirme sarı gösterilir. (B), iki farklı hücre popülasyonları vardır DE farklılaşmadan sonra. farklılaşma sürecini direnen hücreler hâlâ Pluripotency işaretleyici Sox2 ifade oysa DE-benzeri hücreler FOXA2 ifade eder. (AB) Çekirdekler DAPI (mavi) ile zıt. Panel (A) &#39;deki ölçek çizgisi 50 um ve panelde (B), 100 uM&#39;dir. Görüntüleme 670 nm (kırmızı, Cy5), 520 nm (yeşil FITC) ve 433 nm (mavi, DAPI) yürütülmüştür, sırasıyla. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53655/53655fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/53655/53655fig3highres.jpg" width="700" /> Farklılaşmış DE hücre popülasyonlarının ve temsili st sıralama Şekil 3. MACSsıraladıktan sonra Aining. (A) CXCR4 + lekeli hücreler (Q1) sıralama MACS sonra zenginleştirilmiştir. CXCR4- hücreleri (Q4) sayısı azaltılır. Hücre hattı bağlı farklılaşma protokol verimleri&gt;% 80 CXCR4-pozitif hücreler 8 ve MACS onları daha da zenginleştirmek için kullanılabilir. (B) ayrım hücreleri Pluripotency işaretleyici Sox2 (yeşil) ifade değil DE işaretleyici FOXA2 kullanılan (kırmızı sıralanan nüfus neredeyse eşit DE işaretleyici FOXA2 (yeşil) ifade oysa sadece çok az farklılaşmamış Sox2 + hücreler sıralama MACS sonra). (C), (kırmızı) kalır. (BC) Çekirdekler DAPI (mavi) ile zıt. Panel (C) &#39;deki ölçek çizgisi 100 mikron ve tüm paneller için geçerlidir. Görüntüleme 670 nm (kırmızı, Cy5), 520 nm (yeşil FITC) ve 433 nm (mavi, DAPI) yürütülmüştür, sırasıyla. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53655/53655fig3highres.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Burada, alt uygulamalar ve diğer farklılıklar iyileştirilmesi için kesin endoderm doğru kararlı farklılaştırılmış insan embriyonik kök hücrelerinin saflaştırılması için bir yöntem açıklanmaktadır.

İnsan Embriyonik Kök Hücreleri Yaratılan Endoderm Hücrelerinin Saflaştırılması Hızlı ve Etkin Yöntem

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

8.3K Görüntüleme.  Hannover Medical School.  Burada, alt uygulamalar ve diğer farklılıklar iyileştirilmesi için kesin endoderm doğru kararlı farklılaştırılmış insan embriyonik kök hücrelerinin saflaştırılması için bir yöntem açıklanmaktadır. 

Video: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

No cure has been discovered for age-related macular degeneration (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex multifactorial disease with an unknown etiology, although it is largely thought to occur due to death or dysfunction of the retinal pigment epithelium (RPE), a monolayer of cells that underlies the retina and provides critical support for photoreceptors. RPE cell replacement strategies may hold great promise for providing therapeutic relief for a large subset of AMD patients, and RPE cells that strongly resemble primary human cells (hRPE) have been generated in multiple independent labs, including our own. In addition, the uses for iPS-RPE are not limited to cell-based therapies, but also have been used to model RPE diseases. These types of studies may not only elucidate the molecular bases of the diseases, but also serve as invaluable tools for developing and testing novel drugs. We present here an optimized protocol for directed differentiation of RPE from stem cells. Adding nicotinamide and either Activin A or IDE-1, a small molecule that mimics its effects, at specific time points, greatly enhances the yield of RPE cells. Using this technique we can derive large numbers of low passage RPE in as early as three months.

Stem cell-derived retinal pigment epithelium (RPE) cells may be used for multiple applications including cell-based therapies for retinal degeneration, disease modeling, and drug studies. Here we present a simple protocol for reproducibly deriving RPE from stem cells.

Kök Hücreleri Retina pigment epiteli hücrelerinin Verimli türetilmesi

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Gelişim Biyolojisi

The Production of Pluripotent Stem Cells from Mouse Amniotic Fluid Cells Using a Transposon System

Induced pluripotent stem (iPS) cells are generated from mouse and human somatic cells by forced expression of defined transcription factors using different methods. Here, we produced iPS cells from mouse amniotic fluid cells, using a non-viral-based transposon system. All obtained iPS cell lines exhibited characteristics of pluripotent cells, including the ability to differentiate toward derivatives of all three germ layers in vitro and in vivo. This strategy opens up the possibility of using cells from diseased fetuses to develop new therapies for birth defects.

In this study, we generate induced pluripotent stem cells from mouse amniotic fluid cells, using a non-viral-based transposon system.

Bir Transpozon Sistemi Kullanılarak Fare Amniyotik Sıvı Hücreleri pluripotent kök hücrelerin üretimi

Induced pluripotent stem (iPS) cells are generated from mouse and human somatic cells by forced expression of defined transcription factors using ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality microscopic images is not entirely dependent upon the quality of the microscope, but also upon the methods of tissue processing, which often involve multiple critical actions or steps. Furthermore, mesenchymal cell types in the skin and other tissues represent a new challenge for tissue preparation and imaging. Here, we present a complete process, from tissue harvest to microscopy. Our technique, called &#34;horizontal whole mount,&#34; is one that novices can quickly become proficient in and that allows for antigen preservation and detection in 60-300 &#181;m-thick sections cut with a cryostat. Sections of this thickness provide enhanced visualization of tissue microarchitecture in a three-dimensional environment. In addition, the protocol preserves mesenchymal cells in a manner that enhances image quality when compared to standard cryostat or paraffin sections, thereby increasing the efficacy and reliability of immunostaining. We believe that this protocol will benefit all laboratories that visualize skin, and possibly other tissues and organs.

This work presents a novel processing and imaging protocol for thick, three-dimensional tissue cross-section analysis that enables the full exploitation of confocal imaging modalities. This protocol preserves antigenicity and represents a robust system to analyze skin histology and potentially other tissue types.

Yatay Dağ Dağı: Derinin kalın, üç boyutlu doku kesitleri için yeni bir İşleme ve Görüntüleme Protokolü

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing a detailed and thorough protocol is to clearly demonstrate each step and to make this readily available to researchers in the field. This protocol results in a homogenous layer of RPE with minimal or no manual dissection needed. The method presented here has been shown to be effective for induced pluripotent stem cells (iPSC) and human embryonic stem cells. Additionally, we describe methods for cryopreservation of intermediate cell banks that allow long-term storage. RPE generated using this protocol might be useful for iPSC disease-in-a-dish modeling or clinical application.

This protocol describes how to produce retinal pigment epithelial cells (RPE) from pluripotent stem cells. The method uses a combination of growth factors and small molecules to direct the differentiation of stem cells into immature RPE in fourteen days and mature, functional RPE after three months.

Hızlı, yönlendirilmiş farklılaşma insan embriyonik veya İndüklenmiş Pluripotent kök hücrelerinden retina Pigment epitel hücrelerinin

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause disease when disrupted. Scientists have developed clever techniques to investigate characteristics and natural dynamics of these cells within intact tissue by expressing fluorescent proteins in subsets of cells. However, at times, experiments require more selected visualization of cells within the tissue, sometimes at the single-cell or population-of-cells manner. To achieve this and visualize single cells within a population of cells, scientists have utilized single-cell photoconversion of fluorescent proteins. To demonstrate this technique, we show here how to direct UV light to an Eos-expressing cell of interest in an intact, living zebrafish. We then image those photoconverted Eos+ cells 24 h later to determine how they changed in the tissue. We describe two techniques: single cell photoconversion and photoconversions of populations of cell. These techniques can be used to visualize cell-cell interactions, cell-fate and differentiation, and cell migrations, making it a technique that is applicable in numerous biological questions.

Here, we present a protocol to show how cell photoconversion is achieved through UV exposure to specific areas expressing the fluorescent protein, Eos, in living animals.

Yaşam sağlam Zebra balığı tek hücreli Photoconversion

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

Çekirdeklerin dağıtım, proteinler ve sitoiskeleti çalışmaya Caenorhabditis elegans Germline sayısal analizi

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis and visual clarity. Human pluripotent stem cell (hPSC)-derived LESCs provide a promising cell source for corneal cell replacement therapy. Undefined, xenogeneic culture and differentiation conditions cause variation in research results and impede the clinical translation of hPSC-derived therapeutics. This protocol provides a reproducible and efficient method for hPSC-LESC differentiation under xeno- and feeder cell-free conditions. Firstly, monolayer culture of undifferentiated hPSC on recombinant laminin-521 (LN-521) and defined hPSC medium serves as a foundation for robust production of high-quality starting material for differentiations. Secondly, a rapid and simple hPSC-LESC differentiation method yields LESC populations in only 24 days. This method includes a four-day surface ectodermal induction in suspension with small molecules, followed by adherent culture phase on LN-521/collagen IV combination matrix in defined corneal epithelial differentiation medium. Cryostoring and extended differentiation further purifies the cell population and enables banking of the cells in large quantities for cell therapy products. The resulting high-quality hPSC-LESCs provide a potential novel treatment strategy for corneal surface reconstruction to treat limbal stem cell deficiency (LSCD).

This protocol introduces a simple two-step method for differentiating corneal limbal epithelial stem cells from human pluripotent stem cells under xeno- and feeder cell-free culture conditions. The cell culture methods presented here enable cost-efficient, large-scale production of clinical quality cells applicable to corneal cell therapy use.

Verimli ve ölçeklenebilir yönlendirilmiş farklılaşma klinik olarak uyumlu kornea Limbal epitel kök hücrelerden insan Pluripotent kök hücreler

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver failure&#8212;which can be caused by chronic alcohol intake, hepatitis, acute poisoning, or other insults&#8212;is a severe condition that can culminate in bleeding, jaundice, coma, and eventually death. However, approaches to treat liver failure, as well as studies of liver function and disease, have been stymied in part by the lack of a plentiful supply of human liver cells. To this end, this protocol details the efficient differentiation of human pluripotent stem cells (hPSCs) into hepatocyte-like cells, guided by a developmental roadmap that describes how liver fate is specified across six consecutive differentiation steps. By manipulating developmental signaling pathways to promote liver differentiation and to explicitly suppress the formation of unwanted cell fates, this method efficiently generates populations of human liver bud progenitors and hepatocyte-like cells by days 6 and 18 of PSC differentiation, respectively. This is achieved through the temporally-precise control of developmental signaling pathways, exerted by small molecules and growth factors in a serum-free culture medium. Differentiation in this system occurs in monolayers and yields hepatocyte-like cells that express characteristic hepatocyte enzymes and have the ability to engraft a mouse model of chronic liver failure. The ability to efficiently generate large numbers of human liver cells in vitro has ramifications for treatment of liver failure, for drug screening, and for mechanistic studies of liver disease.

This protocol details a monolayer, serum-free method to efficiently generate hepatocyte-like cells from human pluripotent stem cells (hPSCs) in 18 days. This entails six steps as hPSCs sequentially differentiate into intermediate cell-types such as the primitive streak, definitive endoderm, posterior foregut and liver bud progenitors before forming hepatocyte-like cells.

Insan pluripotent kök hücrelerinin karaciğer hücrelerine verimli farklılaşma

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

Somite türevleri indüklenen insan nesil Vitro Pluripotent kök hücreler

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a three-dimensional system. Here we present a relatively straightforward and inexpensive method that yields brain organoids. In this protocol human pluripotent stem cells are broken into small clusters instead of single cells and grown in basic media without a heterologous basement membrane matrix or exogenous growth factors, allowing the intrinsic developmental cues to shape the organoid&#39;s growth. This simple system produces a diversity of brain cell types including glial and microglial cells, stem cells, and neurons of the forebrain, midbrain, and hindbrain. Organoids generated from this protocol also display hallmarks of appropriate temporal and spatial organization demonstrated by brightfield images, histology, immunofluorescence and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). Because these organoids contain cell types from various parts of the brain, they can be utilized for studying a multitude of diseases. For example, in a recent paper we demonstrated the use of organoids generated from this protocol for studying the effects of hypoxia on the human brain. This approach can be used to investigate an array of otherwise difficult to study conditions such as neurodevelopmental handicaps, genetic disorders, and neurologic diseases.

This protocol was generated as a means to produce brain organoids in a simplified, low cost manner without exogenous growth factors or basement membrane matrix while still maintaining the diversity of brain cell types and many features of cellular organization.

İnsan Embriyonik Kök Hücrelerinden Beyin Organoidleri Üretmek için Statik Kendi Kendini Yöneten Bir Yöntem

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...