Biz MIA modeli, otizm ve şizofreni araştırma ilerleme katkılarından dolayı merhum Dr. Paul H. Patterson onurlandırmak istiyorum. Biz bu protokole onun büyük destek Sarkis K. Mazmanian kabul; idari yardım için Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni ve Leslie A. Neumann; filme yardım için Ali Khoshnan ve Jan C. Ko; MIA indüksiyon onların tavsiye için Elaine Y. Hsiao ve Natalia Malkova; kendi uzman hayvancılık için Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, ve Natalie A. Verduzco. Bu eser (Paul H. Patterson NIH 5P50MH086383-04) NIH Conte Merkezi Ödülü ile desteklenmiştir; Otizm (Paul H. Patterson # 7670) konuşuyor; (Sarkis K. Mazmanian için # 322839), Simons Vakfı; NIH Eğitim Grant (K.-HC NIH / NRSA T32GM07616); (ZY için) Caltech Yaz Lisans Araştırma Bursu (SURF); Amgen Akademisyenler Caltech&#39;te (ZY için) Programı; ve Doktora Sonrası Araştırma Bursu from Ulusal Bilim Konseyi, Tayvan (MGK 101-2917-I-564-039 W.-LW için).

Tüm protokoller Teknoloji Kurumsal Hayvan Bakım ve Kullanım Kurulu California Institute (IACUC) onayı altında gerçekleştirildi. Zamana-eşleşme çiftleri 1. Hazırlık <ol><li> gen ekspresyon analizi için en az 6, davranışsal deneyler için baraj ve 3 kullanın. Not: farelerin sadece% 50 zamanlı-çiftleşme gelen tıkanırlar olarak, tahmin edilen dişi farelerin iki kat kullanın. </li><li> daha önce hiçbir gebelik ve yaş 8-16 haftalık dişi fareler kullanın. NOT: Dişi fareler erkek farelere önce cinsel maruz kalma var ama hamile olmamıştır kabul edilebilir. </li><li> Ev dişi fareler ve birlikte yanyana onların östrus döngüsü senkronize etmek için kafesleri yerleştirin. 5 yetişkin farelerin konut sağlamak için 5.5 inç üzerinde bir yükseklikte ve 75 inç kare iç zemin ile standart fareler kafes kullanın. bir kulak yumruk kullanarak her kadın fare etiketleyin. </li></ol> 2. Zamanlı-mat kurmaing Çifti <ol><li> karanlık döngüsü başlamadan önce zamanlanmış-çiftleşme 0-2 saat ayarlayın. Her kafeste iki dişi farelerin yerleştirin. fareler çıkarın ve bunları tek tek tartın. Her dişi fare vücut ağırlığı kaydedin. </li><li> İki dişi fareler her kafesin içine bir erkek fare yerleştirin. baba karıştırıcı etkisini en aza indirmek için üçlü çiftleşme kullanın. </li></ol> 3. Vajinal Plug Kontrol (E0.5) <ol><li> karanlık döngüsü sona erdikten sonra dişi fareler 0-4 saat kontrol edin. Yavaşça kuyruk tabanından kadın fare kaldırın ve kablolu fare ızgara, kafes top, ya da kafes kenar kapmak için izin verir. </li><li> Vajinal fiş belirtilerini arayın: vajinal fiş vajinal açılışında görünür beyazımsı kitledir. Fiş açık değilse, yavaşça vajinal açılış içine 200 ul pipet yerleştirin. koagülasyon gelen direnç vajinal tıkacı oluşumunu onaylar. günde bir kez vajinal fişi kontrol edin. NOT: Vajinal fişi g nedenle değil çiftleşme oluştuğunu ancak bir göstergesidir veuarantee gebelik. Vajinal tamponun farelerin bazı suşları tespit etmek zor olabilir. Fiş kimlik doğruluğunu artırmak için deneyimli fareler bakıcı yardım isteyin. </li><li> Yeni bir kafese takılı fareler taşımak ve grup onlara ev. embriyonik 0.5 gün (E0.5) olarak vajinal fiş görünüm günü belirleyin. </li></ol> E10.5-11.5 4. Gebelik olup olmadığını kontrol edin <ol><li> Yavaşça kuyruk tabanını kaldırın ve kablolu fare ızgara, kafes top, ya da kafes kenar kapmak için izin verir. Gebelik, örneğin, karında bir çıkıntı (Şekil 1) belirtilerini kontrol etmek için karın alan gözlemleyin. NOT: Gebelik işareti her zaman E10.5 olduğundan daha E11.5 daha açıktır. </li><li> gebelik doğrulamak için fareler tartılır. Hamile fare genellikle E10.5 yaklaşık% 20 daha ağır ve bir gebe olmayan fare (Şekil 2) ile karşılaştırıldığında E12.5% ​​30 ağır bastığından. Tek Evi temiz kafeslerde hamile fareler. </li></ol> 5. 20 mg /kg Poli (I: C): <ol><li> gen ekspresyon analizi için grup başına en az 6 Davranış deneyler için grup başına baraj ve 3 kullanın. solüsyonu: poli (C I) tekabül eden miktar hazırlayın. </li><li> 40 mg / ml bir nihai konsantrasyon yapmak için bir 50 ml konik bir tüp içinde: (Cı) Toz poli tartılır. en aza indirmek ve enjeksiyon hacmi kaynaklanan stres standart poli 5 ul enjekte etmek için (I: C) fare vücut ağırlığı (5 ul / g veya 5 ml / kg) her bir gramı için çözüm. kg&#39;ı başına (Cı) MIA neden olmak için, poli 20 mg enjekte edilir. Not: poli konsantrasyonu (I: C) gerekli çözeltisi (20 mg / kg) / (5 ml / kg) = 4 mg / ml&#39;dir. poli yana (I: C) Toz,% 10 poli içeren çözelti (I: C), biz (4 mg / ml) /0.1= 40 mg / poli ml (Cı) bir son konsantrasyon yapmak gerekir. DİKKAT: poli (I: C) toz çok hafif. konik tüp spatula aktarma sırasında herhangi bir toz kaybetmemek için dikkatli olun. </li><li> Konik küvet içine,% 0.9 sodyum klorid (tuz) karşılık gelen ses eklemeE ve kapağını kapatın. Çözelti berrak olana kadar: (C I) toz hafifçe poli üzerinde tuzlu damlacık haddeleme tozu eritin. 1 dakika boyunca (Şekil 3C) 800 xg&#39;de konik tüp santrifüjleyin. (C I) 0.22 mikron filtre ile çözüm poli Filtre. Bir 1.5 ya da 2 ml mikrosantrifüj tüpüne (Cı) solüsyonu poli aktarın. İsteğe bağlı: Çözüm: poli (C I) 260/280 oranını ölçmek için bir spektrofotometre kullanın. Oranı, üretici tarafından tarif edildiği gibi 1,54-1,82 (Şekil 3) arasında olduğundan emin olun. NOT: (: C I) toz ve steril ve ilaç sınıf olmalıdır kontrol enjeksiyonu olarak hizmet poli eritmek için kullanılan tuz. </li></ol> 6. Salin ya da poli (I: C) E12.5 Enjeksiyon <ol><li> ölçekte fare tartılır ve kafes içine geri koymak. (C I) fareler: vücut ağırlığı (g) 5 ile çarpılarak = istenen enjeksiyon hacmi (ul) tuzlu ve poli hem de enjeksiyon hacmini hesaplamak için aşağıdaki formülü kullanın. 0.3 mi Insul kullanın(C I) çözüm, örneğin, bir 30 g fare için 150 ul şırınga tuzlu hesaplanan hacim veya 20 mg / kg poli hazırlamak için. </li><li> Yavaşça kuyruk tabanı ile fare pick up ve kafesin üstüne yerleştirin. stresi ile oluşturulan karıştırıcı etkileri önlemek için yavaşça fareyi tutun. Iki üst meme (Şekil 4) merkezi haline fare yaklaşık 20 ° göreceli, yukarı konik, iğne takın ve tuz ya da poli (I: C) enjekte çözüm. Not: iğne enjeksiyonundan sonra her bir fare için değiştirilmelidir. </li><li> geri evde kafes fare yerleştirin. diğer karıştırıcı etkilerini önlemek için sessiz, düşük trafik odasında kafesleri yerleştirin. </li></ol> 7. Poli Day After (I: C) Enjeksiyon (E13.5) <ol><li> Aşağıdaki sabah enjekte edilen fareler kontrol edin. vücut ağırlığını ölçmek için bir ölçek kullanın. NOT: Poly: tuzlu inj sonraki gün farelere enjekte daha (C) hamile fareler genellikle daha az kilo enjekteection. </li><li> yavrular doğar kadar fareler rahatsız etmeyin. </li></ol> MIA Offspring 8. Ölçer <ol><li> MIA indüksiyon karıştırıcı etkilerini en aza indirmek amacıyla, MIA yavruların kullanımını ölçmek için aşağıda listelenen yönergeleri izleyin. <ol><li> çöp boyutu 5&#39;ten küçük preterm veya gecikmiş doğuştan veya eğer ibrelerin hariç tutun. </li><li> Çöp boyutu 10 büyükse CO 2 tarafından aşırı yavrular euthanize. </li></ol></li></ol> 9. İsteğe bağlı: MIA sonra akut inflamatuar Tepki inceleyin <ol><li> kurumun Hayvan Bakım Komitesi tarafından onaylanmış bir protokol anlatılan yöntem kullanılarak enjeksiyon: tuzlu su ya da poli (Cı) sonra hamile farelere 3 saat Kurban. NOT: Servikal dislokasyon genellikle baraj ve embriyo üzerinde CO 2 / ötenazi ilaçların etkisini en aza indirir olarak tercih edilmektedir. </li><li> plasenta ve fetal sutyen erişkin gebe farelerin dalak toplayın ve izolestereomicroscope altında. <ol><li> dalak toplama, diseksiyon plaka üzerinde fare koymak ve hamile farelerin karın alanda% 70 etanol sprey. deri yoluyla göğüs kafesi altında karın alanının merkezinde dikey kesim yapmak için steril bir makas kullanın. </li><li> Dalak sol üst kadranda oturur. dalak izole etmek için forseps kullanabilir. organın etrafında yağ doku kaldırmak için hassas görev silecekleri üzerinde dalak yuvarlayın. dalak dokusunun yaklaşık 50 mg toplayın ve nükleik asit bozulmasını önlemek için tampon veya TRIzol stabilize 500 ul RNA ile Eppendorf tüpleri tek tek koyun. kullanılana kadar -80 ° C&#39;de derin dondurucuda Örnekleri saklayın. </li><li> plasenta toplanması için hafifçe vücuttan rahim boynuzları çekin. otoklavlanmış fosfat tamponlu tuzlu su (PBS) ile dolu bir Petri kabındaki rahim boynuzları yerleştirin ve buz üzerinde bir çanak bırakın. rahim duvarına açık gözyaşı ve amniyotik kese maruz iki forseps kullanabilir. <ol><li>Dikkatle plasenta ve fetusun zarar vermeden amniyotik kese açmak için forseps kullanabilir. fetus plasenta ayrılması ve mümkün olduğunca plasentaya yakın göbek kordonu kesti. Plasenta amniyon kesesi enkaz kaldırmak. tek tampon veya TRIzol stabilize 500 ul RNA ile Eppendorf tüpleri plasenta yerleştirin. kullanılıncaya kadar -80 ° C derin dondurucuda de örnek saklayın. </li></ol></li><li> fetal beyin koleksiyonu için, diseksiyon kadar adım 9.2.2 den tampon stabilize RNA fetusu saklayın. stereomicroscope altında hassas 5. forseps kullanarak beynin ventrikül pial zarı kapalı alay. Dikkatle fetal beyin tüm membran kaldırmak. tek tampon veya TRIzol stabilize 500 ul RNA ile Eppendorf tüpleri fetal beyinleri yerleştirin. kullanılıncaya kadar -80 ° C derin dondurucuda de örnek saklayın. </li></ol></li><li> doku RNA Özü ve cDNA&#39;ya RNA&#39;nın dönüştürün. Gerçek t cDNA Il6 gen ekspresyonunu analizime PCR. </li><li> TRIzol imalatı protokolünü takip ederek dokulardan RNA ayıklayın. dokular RNA stabilizasyonu tampon saklanır varsa. örnek çözülme ve tampon aşağı doğru döndürün. 500 ul TRIzol başka Eppendorf ucuyla doku aktarın ve RNA ekstraksiyon devam edin. </li><li> konsantrasyon, 260/280 ve 260/230 RNA oranını ölçmek için bir spektrofotometre kullanın. oranlar 2.0 üzerinde olduğundan emin olun. </li><li> 10 | il son hacim olması için işlemden DNase I Karışım 1 ug RNA, RNA, 1 ul 10x reaksiyon tamponu, 1 ul Rnaz içermeyen Dnaz ve nükleaz içermeyen su ile DNA kontaminasyonu ortadan kaldırır. 30 dakika boyunca 37 ° C&#39;de ana karışımı inkübe edin. reaksiyonu sonlandırmak için 1 ul DNaz durdurma çözüm ekleyin. 10 dakika boyunca 65 ° C&#39;de inkübe karışımı. </li><li> cDNA RNA&#39;yı ters. 20 ul reaksiyonları kullanın ve yukarı reaksiyon başına toplam RNA mikrogram ile 1. transkripsiyon (RT) reaksiyon karışımı tampon ters 5x 4 ul karıştırın, 1 ul reverse transkriptaz, DNaz I ve 4 ul nükleaz içermeyen H2O ile tedaviden sonra 11 ul RNA şablonu bir son 20 ul çözelti yapmak için. RT için termal döngü cihazı koşullarını programlayın. Genel bir durumu şunları içerir: Adım 1: 5 dakika boyunca 25 ° C; Aşama 2: 30 dakika boyunca 42 ° C; Adım 3: 5 dakika boyunca 85 ° C; Adım 4: 4 ° C&#39;de tutun. cDNA 5 kez seyreltilir. Kısa süreli depolama için, 4 ° C&#39;de cDNA saklayın. Uzun süreli depolama için, -20 ° C&#39;de cDNA dondurmak. </li><li> Gerçek zamanlı PCR ile cDNA Il6 gen ifadesini analiz etmek ve p-aktin için gen ekspresyonunu Il6 gen ekspresyonunu normalize. <ol><li> IL-6 ve β-aktin tespiti için bir master miks yapın. 25 ul reaksiyonu kullanın, her gen için master miks 12.5 ul SYBR Green Mix, 10 uM ileri primer 0.5 ul, 10 mM ters astar ve 6.5 ul nükleaz içermeyen H 2 O 0.5 ul içermektedir </li><li> 5 ul 5x seyreltilmiş cDNA a yerleştirinoptik 96 kuyulu reaksiyon plakası kuyunun dibine t. Pipet her bir kuyunun ana karışımı 20 ul son 25 ul PCR karışımı yapmak. Her bir örnek için her bir genin, üç kopya halinde. Optik yapışkan film ile plaka Seal. 4 ° C kullanımı gerçek zamanlı PCR standart bir program 3 dakika boyunca 800 x g&#39;de plaka Spin: Aşama 1: 50 ° C, 2 dakika için; Aşama 2: 10 dakika boyunca 95 ° C; Aşama 3: 15 saniye ve sıcaklık, 1 dakika boyunca 60 ° C sıcaklıkta 95 ° C 40 döngü. ayrışma eğrisi ek bir adım ekleyin. </li></ol></li></ol> 10. MIA Yetişkin Offspring Davranış Patolojilerin (İsteğe bağlı) inceleyin: <ol><li> 8-12 hafta yaşlarda davranış testleri gerçekleştirin. en az 3 gün test öncesi kafes yatakları değiştirin. En az 30 dakika test öncesi davranışsal test odasına fareler alıştırıldı. </li><li> prepulse inhibisyonu (ÜFE) için, bunun altında bir piezo-elektrikli sensörü ile pleksiglas silindir fareler dizginlemek. ÜFE fareler alıştırıldı5 dakika için bir oda oluşmaktadır. 120 dB beyaz gürültü (irkilme) 6 çalışmalar ile fareler Açığa. </li><li> Ardından 15 dB (15 dB daha yüksek arka plan gürültüsü 14 çalışmalarda, irkilme 14 çalışmalarda, prepulse 5 dB (5 dB arka plan gürültü daha yüksek) + irkilme (PPI5) 14 denemeler ve prepulse 14 çalışmaların randomize karışımları ile fareler maruz arka plan gürültüsü + irkilme (PPI15) daha. </li><li> 120 dB çalışmaların ilk 6 denemeleri için irkilme tepkisi ortalama. diğer bireysel uyarımlar için irkilme tepkisi ortalama. (- PPI5 veya PPI15 irkilme) / irkilme tarafından prepulse inhibisyonu değeri gizli. </li><li> Açık alan testi için açık bir kare arena (50 x 50 x 50 cm 3) köşesinde fare yerleştirin. Bir tavana monte kamera ile 10 dakika fare yörüngesini kaydedin. Merkez bölgesi (17 x 17 cm 2) olarak arena merkezini tanımlayın. manuel veya görüntü tabanlı otomatik analiz yazılımı tarafından merkez bölgede harcanan katedilen mesafeyi, merkez bölge girişleri ve zamanı ölçmek. </li&gt; <li> mermer gömme testi için 10 dakika boyunca sıkıştırılmış 5cm derin, temiz, Aspen çam yatak ile bir test kafesine fare gelmesini. onun homecage fare dönün. Yavaşça 4 x 5 düzenlemenin moda 20 lacivert 1.5 cm çapında cam bilye yerleştirin. 10 dakika boyunca mermerler test kafesine geri fare yerleştirin. 10 dk test süresi gömüldü mermerler sayın. </li></ol> 11. MIA Yetişkin çocuklarında Serebellar nöropatoloji (İsteğe bağlı) inceleyin: <ol><li> anestezi ile tuzlu ve MIA yetişkin döl euthanize. kalp-damar sistemi boyunca 50 mi, PBS ile fare ve daha sonra 50 mi% 4 paraformaldehid serpmek. </li><li> dikkatle beyin çıkarın ve 4 ° C&#39;de gece boyunca 4% paraformaldehid beyin postfix ° C. PBS ile üç kez beyin durulayın ve kullanılana kadar 4 ° C&#39;de buzdolabında% 0.02 sodyum azid içeren PBS beyin saklayın. NOT: sabitlendi beyin% 0.02 çim ile PBS içinde saklanabilirBir ay kadar buzdolabında yum azid. </li><li> Bölüm 50 mikron ince dilimler halinde beyin sagittally vibratome kullanarak. yumuşak bir fırça kalem kullanarak beyin bölümleri toplayın. Oda sıcaklığında 30 dakika için% 0.6 hidrojen peroksit bölümleri inkübe edilerek bir endojen peroksidaz etkinliğini iptal eder. </li><li> gece boyunca oda sıcaklığında bloke edici tampon (PBS içinde% 0.1 Triton X-100 ve% 0.02 sodyum azid ile% 10 keçi serumu) içinde seyreltilmiş anti-kalbindin antikoru bölümleri inkübe edin. Daha sonra, oda sıcaklığında 2 saat süre ile blokaj tamponu içinde seyreltilmiş biyotinlenmiş sekonder antikor tekabül eden bölümleri inkübe edin. </li><li> Avidin DH bölümleri inkübe - Biyotinile peroksidaz lH kompleksi tamponu, oda sıcaklığında 1 saat süre ile biyotin tespit etmek. antijeni görselleştirmek için peroksidaz substrat kullanılarak bölümleri geliştirin. adımlar arasında PBS ile üç kez bölümleri yıkayın. mikroskop lamı üzerine bölümleri monte edin. Resim mikroskop altında kesitler. </li></ol&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

farklı zaman camlara MIA indüksiyon kemirgenlerde farklı beyin geliştirme etkinlikleri bozan ve dolayısıyla yavrularda farklı davranış anormallikleri ve nöropatolijilerin yol açar. E12.5 enjeksiyon: Burada, poli (Cı I) farelerde MIA uyarılması için bir protokol tarif. MIA indüksiyon Bu yöntem davranışsal, nörolojik, immünolojik ve yavrularda 8,10,11,16 yılında otizm ve şizofreni ile ilişkili gastrointestinal anormallikler yol açar. MIA bir çevresel risk faktörü olduğu için, dikkat etmek önemlidir, yavru fenotip nörogelişimsel bozuklukların genetik modellerinden farelerin daha yüksek varyasyon olması bekleniyor. Böylece, doğru ve tutarlı MIA ile otizm ve şizofreni ile ilgili fenotipleri oluşturmak için, sonuçların yanıltabilecek ek değişkenler en aza indirmek için özellikle önemlidir. protokol açıklanan zaman çizelgesi yakın takip edilmelidirly. Doğru enjeksiyon zaman penceresi MIA istenilen aşamada yavru beyin gelişimini bozan sağlayacak. Fare E12.5 MIA indüksiyon, insan gebelik 21 ilk trimester sonuna tedirginlikler karşılık - önemli beyin gelişimi kortikal tabakasında Purkinje hücreleri ve kaudat putamen geliştirilmesi ve nöron içeren, meydana geldiği bir döneme. Daha fazla araştırma MIA beyincik Purkinje hücrelerinin kaybı ve beyin gelişiminin erken pertürbasyon arasındaki ilişkiyi kanıtlamak için gerekli olacaktır. tutarlı tedavi, muayene ve barajların bile hayvancılık yavrular fenotip maternal stresin etkilerini minimize edecek olsa da, bizim protokol hala araştırmacılar farkında olmalıdır uyarılar içermektedir. (C: I) ve gebelik geri kalanı boyunca, örneğin biz poli enjeksiyonundan önceki gün evi barajların bekar. Stratejimiz bir undisturbe hamile fareler bırakmaktırd ortam. Ancak, bu eylem anne ortamda stres tepkisine neden olabilir. Bu izolasyon kaynaklı stres yanıtı yavru gelişimi ile müdahale olup olmadığını bilmiyorum rağmen, MIA etkisi bizim prosedürü izleyerek görülebilir. Buna ek olarak, farelerin zorlanma ve genetik arka plan seçilmiş ve MIA indüksiyon için dikkatli bir şekilde test edilmesi gerekmektedir. Şimdiye kadar, MIA etkisi çoğunlukla yabani tip C57BL / 6N fareler 8,10,13,16 yılında çoğaltılır. Diğerleri de BTBR fare suşu 19 MIA etkisi gözlemledik. Döl ek karıştırıcı etkilerini ortaya çıkarabilir genetik olarak farelerde 13,22-24, farklı bağışıklık yanıtlarına, ortaya olabilir: (Cı I) &#39;in O poli gösterilmiştir. Biyolojik kopya sayısı açısından, gen ekspresyonu, protein ya da immüno üzere, grup başına, davranışsal ve fizyolojik deneyler için grup başına en az 6 ibrelerin 3 ibrelerin kullanımıhistokimya yaklaşımları. Bunun yerine, deneysel yanlılığı önlemek için çöp içinde bir veya iki yavru kullanarak bir çöp içindeki tüm yavrular test edin. Biz de bir çöp içindeki tüm yavruları için verilerin ortalamasını ve bir veri noktası (örneğin n = litre sayısı o) önlemek için uygunsuz istatistikler 13 olarak o ortalamayı kullanın. Belirgin bir farkın ortadan MIA modeli 13 gözlenmiştir, çünkü her bir cinsiyet verileri de bir araya getirilmiştir. çöp büyüklüğüne göre MIA yavru ölçme arkasındaki mantığı anne hemşirelik ve bakım kaynaklanan varyasyonu en aza indirmektir. Çöp boyutu fareler 25/6 C57BL stereotipik davranışları ile ilişkili olduğu gösterilmiştir. Biz bu anne hemşirelik ve bakım sırasında kaynakların atama nedeniyle olabilir spekülasyon. Bu karıştırıcı etkiyi önlemek için, standart istenen çöp boyutu C57BL / 6 fareler için 6-10 olduğunu. yakından protokol bile, deneyci tr olabilirEnjeksiyon: poli (C I) sonra hamile farelerde aşırı zayıf ya da aşırı güçlü bir bağışıklık yanıtı karşı. Bunu önlemek için, poli farklı partileri (C I) &#39;pirojenik ve cytokinogenic aktivitesi doğrulamak için gereklidir. Farklı gruplar ve poli çok: farelerde inflamatuvar yanıt farklı düzeylerde yol açabilir aynı şirketten (C); çarpıcı poli özdeş dozlarını enjekte: Farklı gruplar arasında (C), plazma içerisine 10 kat farklı IL-6 seviyeleri 26 ile sonuçlanabilir. dozaj ve poli toplu Belirlenmesi: Gebe olmayan kadın, IL-6 ölçüm okuma daha da MIA deney için (C) MIA indüksiyon itibaren yürürlüğe değişimini azaltmaya yardımcı olabilir. Bu poli spesifik partileri için dozaj değiştirmek için gerekli ise, enjeksiyon için solüsyon enjekte edilen hacim gramı başına yaklaşık 5 ul kalacak şekilde (I: C), (Cı), poli konsantrasyonunu değiştirmek için de önemlidir fare ağırlık. Örneğin, Manuf göreacturer prosedürü, poli (I: C) sözde fizyolojik fosfat tamponlu çözelti içinde bir polinükleotid elde etmek için, su 10 mg / ml&#39;lik ° &#39;de yeniden oluşturulur. Bizim 40 mg / ml solüsyon ile karşılaştırıldığında, daha düşük bir konsantrasyon 4 kat enjeksiyon hacmi artacaktır. Hamile farelere için, tampon enjeksiyon büyük hacimli potansiyel yavrular karıştırıcı etkisi, embriyoların üzerindeki baskıyı artırmak ve istenmeyen tanıtmak olabilir. Enjeksiyon hacmi azaltmak için daha yüksek bir son konsantrasyona sahip% 0.09 sodyum klorür (Cı) Toz Bu nedenle, poli eritmek için seçin. önce araştırma beyin gelişimi ve davranışları üzerindeki MIA etkilerine aracılık kritik bir faktör olarak, IL-6 sinyalizasyon tespit etti, çünkü, IL-6, akut inflamatuvar yanıt belirteç olarak seçilir. Poli aşağıdakı (I: C) tedavisi, IL-6, anne kanı ve plasenta 10,12 en upregüle sitokindir. Daha da önemlisi, Smith ve diğ. birkaçının gösterdiÇok regüle sitokinler, sadece IL-6 MIA ilişkili beyin ve davranış anormallikleri indüksiyonu için hem gerekliliğini ve yeterliliğini sergiledi. Nötralize diğer sitokinler 10 vermedi ederken, etkin bir MIA yavrularda anormal davranış ve transkriptomik anormallikleri önleyebilir anti-IL-6 anne enjeksiyonu olduğunu. Ayrıca, rekombinant IL-6 tek başına (poli olmadan (I: C)) maternal enjeksiyonu MIA fetal beyin ve yavrularda 12,15 görülen MIA ilişkili transkripsiyonel ve davranışsal anormallikler üretir. MIA indükleme diğer yöntemlere göre (örneğin, lipopolisakarit (LPS) ya da influenza), poli (I: C) nispeten güvenli ve bağışıklık yanıtının yoğunluğunu kontrol etmek için kolay bir yol sunar. anne poli (I: C) tarafından ortaya çıkarılan inflamatuar yanıt rağmen yönetim akut ve geçicidir, yavru davranışları ve beyin gelişimi üzerindeki etkisi büyüktür. Genel olarak, MIA t indükleme tekniği kezhrough poli (I: C) E12.5 enjeksiyon hakim olduğu, bir sonra yavrular bu çevresel risk faktörünün etkisini incelemek üzere farklı davranışsal ve biyolojik testleri gerçekleştirmek için devam edebilirsiniz. Aynı zamanda, bir de öncesinde, sırasında genetik modifikasyon ya da diğer tedavilerle kombine yöntemi olabilir, ya da hamilelik sonrası nedenleri ve otizm ve şizofreni mümkün tedavi yaklaşımlarının araştırmak için.

Maternal immün aktivasyon kavramı (MIA) otizm ve şizofreni 1 ile maternal enfeksiyon dernek epidemiyolojik çalışmalar kaynaklanır. Plasentanın veya maternal viral enfeksiyondan 2,3 sonrasında fetal beyninde tespit replike viral patojen olmaması, yavru enfeksiyon etkisi oldukça patojenlere kendisinden daha anne bağışıklık sisteminin aktivasyonu neden olduğu varsayılmaktadır . polisitidilik asit: MIA ve psikiyatrik bozukluklar, kimyasal olarak sentezlenmiş viral taklit çift iplikli RNA Poliinosinik enjeksiyonu arasındaki neden-sonuç ilişkisini aydınlatmak için: Hamile kemirgenler içine (poli (C)) yaygın MIA için hayvan modeli olarak kullanılmıştır 4,5. Poli (I: C) Toll-benzeri reseptör 3 (TLR3) ve poli sistemik uygulama tarafından kabul edilmektedir (I: C) viral benzeri akut inflamatuar yanıtı indükler. mekanizmalardan biri olan poli (l: C) PRyavrularda oduces davranışsal anormallikler ve nöropatolojiler anne-plasental-fetal eksen 6 yanlısı ve anti-inflamatuvar sitokinlerin bir dengesizlik neden gereğidir. Çeşitli gruplar psikiyatrik bozuklukların 7 etiyolojisi anlamak için MIA modelini benimsedik ve bağlı araştırma grupları arasındaki farklı ilgi alanlarına, immün aktivasyon çeşitli zaman noktaları beyin gelişimi ve davranışları 7 farklı tedirginlikler elde etmek için kullanılmıştır. , Embriyonik 12.5 gün hamile farelere başarıyla MIA davranışsal, nörolojik indükleyebilen olduğunu göstermiştir (E12.5), (C I) California Institute of Technology Paul H. Patterson laboratuvar poli enjekte stratejisini benimsemektedir ve otizm ve şizofreni 8-11 ile ilişkili çocuklarında immünolojik değişiklikler. Bizim önceki çalışmalar MIA yavrular davranışsal anormallikler (örneğin, sosyal impairmen görüntülemek göstermektedirt, iletişim eksikliği, tekrarlayan davranış, anksiyete gibi davranış ve gizli inhibisyon açığı 8,10,12), bağışıklık düzensizliği ve sitokinler dengesizlik 8,13,14, fetal beyin gen ifadesinin 15 değişmesi, lobule VII Purkinje hücresinin kaybı beyincik 11, hipokampus 9 sinaptik özelliklerinin değiştirilmesi, gen x çevre etkileşiminin 13, bağırsak geçirgenliğinin değiştirilmesi ve bağırsak Mikrobiyota kompozisyon 16. Bundan başka, tedavi edici ve önleyici stratejileri, bu model sistemi 13,16,17 arasında geliştirilmiştir. E12.5 MIA uyararak, diğerleri MIA serebral sinaptozomal moleküllerinin 17 fetal mikroglial aktivasyon ve bazal ön beyin 18 kolinerjik gelişimsel değişiklik, soy spesifik etkileşim 19, beyin beyin sinaptozomal ultrastrüktürel anormallikleri, beyin mitokondriyal solunum zinciri hiperfonksiyon abnormalties, infekte ürettiğini göstermiştir ,depresif benzeri davranışlar, biliş ve hipokampal uzun vadeli potensiyalizasyon (LTP) bozulma ve yetişkin hipokampal nöron 20 açığı. (C I) yanı sıra, otizm ve şizofreni etiyolojisi incelemek için bu modeli uygulamak için nasıl paradigmaları Burada, poli tarafından E12.5 MIA ikna etmek nasıl ayrıntılı bir yöntem sağlar. MIA bozukluklarının 4 çeşitli bir risk faktörü olduğuna dikkat etmek önemlidir, ve sonuçları zaman ve indüksiyon yöntemi yanı sıra hamile barajlardan hayvancılık son derece duyarlıdır. Bu nedenle, laboratuarlar arasında bile küçük tutarsızlıklar genellikle düşük tekrarlanabilirlik ve / veya yavruda farklı fenotipleri neden olur. Bizim yöntem, özellikle otizm ve şizofreni için bir çevresel risk faktörü olarak MIA okuyan ilgilenenler için tasarlanmıştır ve ayrıntılı bir açıklama araştırmacılar verilerinin tekrarlanabilirlik geliştirmemize yardımcı olacaktır sağladı.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> / Kg poli 20 mg Enjeksiyon: E12.5 (C) anne-plasental-fetal ekseninde bir akut enflamatuar yanıtı uyandırmak ve beyin gelişimi ve davranış fenotipleri 12,13 bir kronik etkisi hızlandırabilir olabilir. proinflamatuvar sitokin yüksek seviyeleri, İnterlökin (IL) -6, MIA sonrası akut inflamatuar yanıtın güvenilir bir göstergesidir. Enjeksiyon 12,13: Il6 gen plasenta ifade ve fetal beyin için zirve zamanı 3 saat sonrası poli (C I) yer almaktadır. Biz poli göstermiştir (I: C) Anne dalak-plasenta-fetal beyin genelinde yüksek Il6 gen ifadesi (Şekil 5) neden olur (Wu uyarlanan veriler ve diğerleri, 2015). 13. Araştırmacılar vb gibi MIA sonrası akut inflamatuar yanıtı, anne diyetler, genetik mutasyona uğramış fareler, anti-inflamatuar ilaçlar, değiştirebilecek etkenlerin incelenmesi, diğer tedavi ile bu paradigmayı birleştirebilirsiniz. <html> &quot;Fo: keep-together.within sayfa =&quot; KBB Öte yandan 1 &quot;&gt;, davranış değişiklikleri MIA modelinin işaretlerinden da birçok davranış testleri, farklı otistik ve şizofrenik gibi göstermek için MIA yetişkin yavru üzerinde yapılabilir. tuzlu yavrular göre davranışlar. Genellikle, MIA yavrular açık alan testi harcanan az merkez bölge girişlerini ve kısa merkez bölge süresini gösterir. Onlar da (Veri adapte testi ve alt ÜFE (Şekil 6) gömme mermer daha sık gömme davranışlar sergileyebilirler Wu ve diğ., beyincik lobule VII Purkinje hücrelerinin 2015) 13. Zarar (MIA yavru başka özelliğidir Shi ve ark., 2009). kalbindin antikoru ile boyanmış zaman beyincik az kalbindin-pozitif Purkinje hücreleri vardır tuzlu kontrol döl (Şekil 7) ile karşılaştırıldığında MIA yavrunun lobülü VII. 3643 / 53643fig1.jpg &quot;/&gt; Şekil 1. gebe farelerin işareti. Orta gebelik fare kendi karın bölgesinde (Ok) şişkinliği ile tespit edilebilir. Doğuştan C57BL / 6 fare suşu burada örnek olarak kullanılmıştır. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53643/53643fig2.jpg" /> (E) embriyonik 0,5-12,5 gün hamile C57BL / 6N farelerde Şekil 2. Vücut ağırlığı değişir. E0.5 mevcut vajinal fişleri ile gebe ve gebe olmayan fareler karşılaştırıldığında, Vücut ağırlığının (A) vücut ağırlığı ve (B) yüzde hamile farelerde E10.5 dramatik bir artış geçirmektedir. Hamile n = 10, Sigara gebe n = 5. Veri Ortalama ± SE olarak sunulmuştur. *** P &lt;0.001, ****p &lt;0.0001. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/53643/53643fig3.jpg" /> Şekil 3. poli absorbans ölçümü (I: C).. Solüsyon 260/280 oranı 1.54-1.82 arasında olduğundan emin olun <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig3large.jpg" target="_blank">, bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 4," src="/files/ftp_upload/53643/53643fig4.jpg" /> Şekil 4. Poli (I: C), embriyonik (E) enjeksiyon 12.5 gün ense gebe fare hafifçe.. Enjeksiyon bölgesi üst meme orta noktasında yer almaktadır. , Iğne enjekte fare yaklaşık 20 ° açıyla yukarı eğim. inbred C57BL / 6 fare suşu burada örnek olarak kullanılmıştır. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 5," src="/files/ftp_upload/53643/53643fig5.jpg" /> Şekil 5. Poli (I: C). Enjeksiyonu Veri Ortalama ± SEM olarak sunulmaktadır barajın dalak-plasenta-fetal beyin ekseninde Il6 gen ifadesini artırır. * P &lt;0.05, ** p &lt;0.01 (veri Wu ve diğ., 2015 ve 13. Maddenin için modifiye aslen). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 6," src="/files/ftp_upload/53643/53643fig6.jpg" /> Şekil 6. &amp; #160;. MIA yetişkin yavrular otizm ve şizofreni endofenotiplerinden ile ilişkili davranışsal anormallikler sergileyen açık alan testinde, MIA yavrular (A) merkez bölgede daha az zaman harcamak merkez daha az sıklıkla bölge ve (B) girin. Mermer gömme testinde (C), MIA yavrular tuzlu kontrol yavru daha fazla mermer gömmek. MIA yavrular (D) prepulse 5 dB prepulse inhibisyonu (ÜFE) açığı ve (E) prepulse 15 dB sergilerler. Ortalama ± SEM. * P &lt;0.05, ** p &lt;0.01 (veri aslında Wu ve diğ., 2015 ve 13. Maddenin değiştirilmiş olan). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig6large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 7," src="/files/ftp_upload/53643/53643fig7.jpg" /> Şekil 7. MIA yetişkin yavrular VII MIA yetişkin yavru gösterilmiştir lobule Purkinje hücrelerinin otizm. Kaybı endofenotiplerinden ile ilgili nöropatolojik anormallikler gösterirler. Ok: Calbindin + Purkinje hücreleri. ML: Moleküler tabaka, GCL: granül hücre tabakası, PCL:. Purkinje hücre tabakası <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig7large.jpg" target="_blank">bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

(C I) Viral Mimik Poli ile Orta gebelik Sahnesi&#39;nde Farelerde Anne Bağışıklık aktivasyonu indüksiyon

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.1K Görüntüleme.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Video: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

SJL Farelerde Deneysel Otoimmün hipofizitis İndüksiyon

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

İmmünoloji ve Enfeksiyon

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Hücreler stellat Yedi Adımda

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Ile Enfekte Fare Bakteriyel Yük ve Bağışıklık Yanıtları Ölçüm Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is a common modifier of heart and lung function, by elaborating cellular infiltration, production of cytokines and growth factors, and by initiating remodeling processes 1.
Compared to the left ventricle, the right ventricle is a low-pressure pump that operates in a relatively narrow zone of pressure changes. Increased pulmonary artery pressures are associated with increased pressure in the lung vascular bed and pulmonary hypertension 2. Pulmonary hypertension is often associated with inflammatory lung diseases, for example chronic obstructive pulmonary disease, or autoimmune diseases 3. Because pulmonary hypertension confers a bad prognosis for quality of life and life expectancy, much research is directed towards understanding the mechanisms that might be targets for pharmaceutical intervention 4. The main challenge for the development of effective management tools for pulmonary hypertension remains the complexity of the simultaneous understanding of molecular and cellular changes in the right heart, the lungs and the immune system.
Here, we present a procedural workflow for the rapid and precise measurement of pressure changes in the right heart of mice and the simultaneous harvest of samples from heart, lungs and immune tissues. The method is based on the direct catheterization of the right ventricle via the jugular vein in close-chested mice, first developed in the late 1990s as surrogate measure of pressures in the pulmonary artery5-13. The organized team-approach facilitates a very rapid right heart catheterization technique. This makes it possible to perform the measurements in mice that spontaneously breathe room air. The organization of the work-flow in distinct work-areas reduces time delay and opens the possibility to simultaneously perform physiology experiments and harvest immune, heart and lung tissues.
The procedural workflow outlined here can be adapted for a wide variety of laboratory settings and study designs, from small, targeted experiments, to large drug screening assays. The simultaneous acquisition of cardiac physiology data that can be expanded to include echocardiography5,14-17 and harvest of heart, lung and immune tissues reduces the number of animals needed to obtain data that move the scientific knowledge basis forward. The procedural workflow presented here also provides an ideal basis for gaining knowledge of the networks that link immune, lung and heart function. The same principles outlined here can be adapted to study other or additional organs as needed.

A specific and rapid protocol to simultaneously investigate right heart function, lung inflammation, and the immune response is described as a learning tool. Video and figures describe physiology and microdissection techniques in an organized team-approach that is adaptable to be used for small to large sized studies.

Akciğer ve Fareler immün Doku Örneklerinde Hasat ile kombinasyon Sağ Ventrikül Sistolik Basınç Ölçümleri

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Sitokin Üretimi Viral Evasion Doğuştan Bağışıklık Sinyalizasyonu Diseksiyon

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Efektör CD4 Evlatlık transferi ile Kemirgen Bağırsak Enflamasyon indüksiyonu<sup&gt; +</sup&gt; CD45RB<sup&gt; Yüksek</sup&gt; Bağışık yetmezliği olan farelere içine T Hücreleri

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Maternal Fetal Arayüz at Fare Dokular lökosit İzolasyonu

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

Çeşitli Dokularda Bağışıklık Hücreleri Hastalık bağımlı Dağıtım Fareler ve Değerlendirilmesi Deneysel Otoimmün Ensefalomyelitli indüksiyon

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

İnsan Plasental ve Desidual Organ Kültürleri Maternal-Fetal Arayüz de Enfeksiyonlar Eğitim için

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in myelin destruction, which not only slows conduction of nerve impulses, but causes axonal injury resulting in motor and cognitive decline. Current treatments for MS focus on attenuating immune cell infiltration into the central nervous system (CNS). These treatments decrease the number of relapses, improving quality of life, but do not completely eliminate relapses so long-term disability is not improved. Therefore, therapeutic agents that protect the CNS are warranted. In both animal models as well as human patients with MS, T cell entry into the CNS is generally considered the initiating inflammatory event. In order to assess if a drug protects the CNS, any potential effects on immune cell infiltration or proliferation in the periphery must be ruled out. This protocol describes how to determine whether CNS protection observed after drug intervention is a consequence of attenuating CNS-infiltrating immune cells or blocking death of CNS cells during inflammatory insults. The ability to examine MS treatments that are protective to the CNS during inflammatory insults is highly critical for the advancement of therapeutic strategies since current treatments reduce, but do not completely eliminate, relapses (i.e., immune cell infiltration), leaving the CNS vulnerable to degeneration.

This protocol describes how to determine whether pharmacological treatments for experimental autoimmune encephalomyelitis show CNS protection as a consequence of suppressing immune cell infiltration or are neuroprotective during the onslaught of immune cell infiltration.

Otoimmün demiyelinizasyonun Farmakolojik Müdahaleler için CNS Koruma karşı Belirlenmesi Bağışıklık Sistemi Bastırma

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...