The authors have no acknowledgements.

1. Deney karışımı hazırlanması <ol><li> TE pH 8 tamponu tüm moleküler sınıf su içinde primer ve prob [Entero F1A, Entero R1, GPL813TQ 12 100 mol / L stok konsantrasyonları olun; HF183-1, BthetR1, BthetP1 3]. Not: iki hedef için sondalar floresan Malzemeleri / Ekipman Listesinde belirtildiği gibi farklı fluorophores 7 ile etiketlenir. </li><li> Planlı reaksiyon başına, karıştırarak 12 ul dijital PCR karışımı master karışımı hazırlayın, 0.216 ul ileriye her (2x stok, Malzeme / Ekipman listesi) ve astar, 0.06 ul her floresan prob ters ve nükleaz içermeyen su ul 5,016 (son konsantrasyon : 900 nM herbir primer, 250 nM her sonda). çözelti içinde hava kabarcıkları tanıtmak için dikkatli çekerken karışımı aşağı en az 10 kere pipet ve. </li><li> 6 ul DNA şablonunda karıştırma düzenli PCR tüp ya da plaka içine, (adım 1.2 dan itibaren) Pipet 18 ul ana karışımı (tarif Previou olarak çıkarılankurnaz 13) damlacık üretimi için tahlil karışım yapmak. nüsha halinde numune çalışıyorsa, pipet ana karışımı 36 ul ve her kuyuya 12 ul DNA şablonu. plaka üzerinde gelen çoğaltmak kuyu boş bırakın. Pozitif kumandaları (Malzeme / Ekipman Listesi) ve hiçbir şablon kumandaları (NTC) ekleyin (yani şablon olarak kullanılan moleküler sınıf su ile). Not: Pozitif kontrol deneyi düzgün çalıştığından emin olmak için gereklidir ve NTC plaka içinde herhangi bir kirlenme olmadığından emin olmak için ve veri analizi daha sonra floresan taban ayarlamak gerekir. İlk kez kullananlar hem sulandırılmamış ve seyreltilmiş DNA örnekleri kullanılması tavsiye edilir. </li></ol> 2. Damlacık Nesil ve PCR Plate Kurulumu <ol><li> Çok kanallı pipet kullanarak aşağı yaklaşık 15 kat kadar pipetleme tahlil karışımları karıştırın. pipet ucu karışımı içinde aşırı kabarcıklar yapmaktan kaçınmaya sıvı içinde kalır emin olun. </li><li> insert beyaz bir kartuş tutucu içine kartuşu 1 (içeren 8 kuyu) ve kartuş tutucu kapalı tıklayın. Kartuş 1 sıkıca yerinde şimdi ve damlacıklar üretirken sahibinden yerinden edilemez. Bir çok kanallı pipet kullanarak, yavaşça hava kabarcıkları tanıtan olmadan kartuş işaretli &#39;Örnek&#39; orta pozisyona tahlil karışımı 20 ul aktarın. </li><li> Pipetleyin kartuşunun sol tarafına damlacık oluşturma yağı 70 ul ( &#39;Petrol&#39; işaretli). </li><li> Bir conta conta, düz ve 4 ile eşit tutulan emin yapma kapak kartuş kartuşun kenarına doğru keneler. açın ve kartuşu yerleştirmek için damlacık jeneratör yeşil ışıklı düğmesine basın. Basın jeneratör kapatmak için düğmeye tekrar yeşil-lit. Not: Kapı kapanır sonra, düğmesi soluk, kapı yeniden açılamaz ve damlacık oluşturma hemen yaklaşık 1 dakika boyunca devam başlar. </li><li> bir saniye fazla 8 reaksiyonları, yer kartuş 2 yapıyor,damlacık oluşturma toplam kurulum zaman kazanmak için devam ederken, beyaz kartuş tutucu ve kartuş 1 ile aynı şekilde hazırlayın. </li><li> loş ışıklı buton damlacık nesil tamamlandığını belirten yeşile döndüğünde damlacık jeneratör kapağını açın. damlacık jeneratör üzerine beyaz kartuş 1 içeren kartuş tutucu, kenara, ve yer kartuşunu çıkarın 2. </li><li> kartuşun 1 contayı çıkarın ve atın. Yavaşça ısıl çevrimden (oda sıcaklığında muhafaza edilen) son bir PCR plaka üzerine kartuş ( &#39;damlacıklar&#39; işaretli) üçüncü sütunda elde edilen damlacıkların toplam hacmi (yaklaşık 40 ul) aktarın. Not: Yeni oluşturulan damlacıkların kırılabilir eylem olarak beyaz kartuşu yuvasını unclick etmeyin; damlacıkları son plakasına aktarıldıktan sonra sadece kartuş yuvasını açın. </li><li> Tekrarlayın ek örnekler için 2,1-2,7 adımları. </li><li> Bütün damlacıklar, nihai PCR plaka olduğu zaman, bir delinebilir yerplaka üzerine folyo kapağı ve bir plaka kapatıcı üzerine yerleştirin. mühürleyen 180 ° C, basın &#39;Play&#39; ile mühürleyen ayarlayın ve 10 saniye boyunca mühür verelim. </li></ol> 3. Termal Bisiklet ve Damlacık Okuma <ol><li> termal döngü sızdırmaz plakasını, aşama 2.7&#39;de kullanılan nihai PCR plaka ve 2.0 ° C / saniyenin altındaki bir ısı rampa hızı ile uyumlu olan bir. </li><li> şu şekilde ısı programı çalıştırmak: 10 dakika tutuldu, ardından 94 ° C&#39;de 30 saniye 40 döngü, ardından 95 ° C&#39;de 10 dakika ve 60 ° C&#39;de 60 saniye, isteğe 98 ° C&#39;de (en: son tutma 4 ° C&#39;de ya da 15 ° C). </li><li> bisiklet tamamlanması üzerine, her bir her bir damlacık floresans otomatik olarak belirlenmesi için, bir damlacık Reader plaka aktarın. Seçenek olarak ise, damlacık okuma önce 3 gün süreyle 4 ° C&#39;de plaka saklayın. damlacıklar okuma ile devam etmeden önce oda sıcaklığında olduğundan emin olun. <ol><li> kurulum damlacık okuma eşlik yazılımını açın. İçinde&#39;Örnek&#39;, &#39;Deney 1&#39; ve &#39;Deney 2.&#39;: Boş 96 plaka bir şemasını içeren varsayılan &#39;Ayarlar&#39; menüsü, çift, üç bölümden içeren bir menüyü açmak için de A1 tıklayın </li><li> &#39;Örnek&#39; bölümündeki &#39;Adı&#39; ve enter tuşuna basın veya işaretli sağa onay kutusunu etiketli kutunun içine örnek kimliğini yazın &#39;uygulayın.&#39; Sonraki menü etiketli &#39;Deney&#39; açılır tıklayın ve &#39;KIRMIZI&#39; (nadir bir olay algılama) seçin ve girin tıklayın. </li><li> &#39;Deney 1.&#39; belirtilen bölüme taşıyın &#39;Ad&#39; bölümünde tahlili (örneğin Enterococcus) doldurun ve girin tıklayın. etiketli &#39;Türü&#39; aşağıdaki kutuya açılır menüyü tıklayın ve &#39;Kanal Bilinmeyen 1&#39; seçin ve girin tıklayın. </li><li> &#39;Deney 2.&#39; belirtilen bölüme taşıyın &#39;Ad&#39; bölümünde tahlili (örn HF183) doldurun ve girin tıklayın. etiketli &#39;Türü&#39; aşağıdaki kutuya menü açılır tıklayın&#39;Kanal Bilinmeyen 2&#39; seçin ve girin tıklayın d. 3.3.4 3.3.2 şimdi Adımlar tüm bilgiler A1 kuyusunda sunuyoruz. </li><li> damlacıkları içeren sonraki tüm kuyu adı. toplam kurulum Zaman kazanmak için, aynı anda birden fazla kuyu seçmek için &#39;Shift&#39; veya &#39;Ctrl&#39; tıklayın. </li><li> plaka dijital tasviri menüsünün sağ alt köşesinde fiziksel plaka, &#39;Tamam&#39;a basın aynalar zaman. &#39;Şablon&#39; bölümünde plaka şematik üst kısmında görünen yeni menüsünde, &#39;Farklı Kaydet&#39; ve adını seçin ve plaka kaydedin. </li><li> Ekranın solunda &#39;Çalıştır&#39; ı tıklatın ve pop-out &quot;Run Seçenekleri&quot; penceresinde uygun boya Set seçin. Veri toplama başlatır ve yazılım gerçek zamanlı olarak görüntülenir. </li></ol></li></ol> 4. Veri Analiz ve Raporlama <ol><li> okuyucu bitti ve bir kutu &#39;Tam Run&#39; belirterek göründüğünde, &#39;Tamam&#39; ı tıklatın. Not: Yumuşakware yazılım &#39;Analiz&#39; bölümünün altında son veri dosyasını görüntüler. Bu görüşe göre, yazılım &#39;2B Genlik&#39; veri arsa seçilen tüm plaka kuyular ve varsayılan vardır. </li><li> Pozitif ve negatif damlacıklar arasındaki mesafeyi kontrol edin. NTC kuyularda tüm damlacıkları floresan başlangıca yakın olduğundan emin olun. </li><li> etiketli butonuna tıklayın &#39;Olaylar.&#39; sunulan histogramın sağındaki &#39;Toplam&#39; adlı kutu ve başına kabul görmüş damlacıkların toplam sayısını görüntülemek için alt kısımdaki &quot;tek&quot; adlı kutusunu tıklatın. Ctrl tuşunu basılı tutarak ve hariç tutulacak kuyu (ler) üzerine tıklayarak &lt;10.000 damlacıkları 7 içeren herhangi bir kuyu hariç. </li><li> Her iki hedefler için NTC kuyularda olumsuz damlacıklar üzerinde yaklaşık bir standart sapma (500-700 floresan birimleri) floresan eşik ayarlamak için &#39;1D Genlik&#39; olarak ifade butonuna tıklayın. Ekran un çok sol atİki eşik düğmelerini gösteren &#39;Otomatik Analiz&#39; üzerinden çalışan bir katı pembe yatay çizgi vardır sağdaki simgeyi seçin der. </li><li> genlik grafikleri her birinin altında &#39;Set Eşik&#39; Solundaki kutuya tıklayın ve uygun floresan eşik değerleri girin. ul reaksiyon başına kopya hedef konsantrasyonları daha sonra otomatik olarak hesaplanır. Not: eşikleri farklı hedefler için aynı olması gerekmez. </li><li> 1D Genlik ekranın sol üst köşesindeki &#39;Export&#39; düğmesini tıklayarak bir .csv dosyasına sonuçları ihracat. .csv Dosyası, DNA şablonuna ul başına hedef kopyalamak için ul reaksiyon başına hedefin kopyası (Enterococcus spp 23S geni. Veya HF183 işaretleyici) onu dönüştürmek için 4 tarafından ihraç edilen hedef konsantrasyon çarpın. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

protokolde birkaç kritik adımlar vardır. Ana Karışım, geleneksel qPCR ana karışımları daha viskoz olduğundan ilk deney karışımları karıştırılması zor olabilir. Basit vorteksleme da deney karışımları ve daha sonra damlacıklar DNA şablonları eşit olmayan dağılımına neden olur yeterli karıştırma, neden olabilir. protokol açıklanan karıştırma-by-pipetleme tekniği doğru dPCR ölçümünü sağlamak için takip edilmelidir. İkinci olarak, damlacıklar tek yapılı bir şekle ve boyuta üretilen sağlamak için önemlidir. Zaman damlacık jeneratör bir kartuş normalden daha kısadır üzerinde damlacık nesil tamamlamak için gereken zaman vesilelerle dikkatli olun. Bu bırakıyorsa damlacık nesil gösterebilir. Gerekirse, her bir kartuş üzerinde damlacık oluşturma zamanı sorun giderme için kaydedilebilir. Üçüncü olarak, kesme olmayan Son PCR levhasına kartuştan üretilen damlacıkların, tüm 40 ul transfer önemlidirdamlacıkları ve ölçümü için yeterli damlalarına sahip değil kaçının. Aşağıdaki teknikler transferi için kullanılabilir: 1) 40 ul çok kanallı pipetlemeyin ayarlayın ve 45 ° &#39;lik açıyla&#39; damlacıklar &#39;) işaretli kartuşun (sağ bölüme ipuçları eklemek; 2) Pipet damlacıkları yavaşça ve tüm damlacıkları herhangi damlacıkları geride eğer dikkat ve) ikinci tur için pipetle gereken almak (yukarı pipetle emin olun; damlacıkları çıkarıldıktan sonra 3), yaklaşık yarım aşağı kuyu duvarına karşı pipet ucu koyarak son tabagina ve yavaş yavaş damlacıklar sınırdışı. EntHF183 dubleks dPCR deneyi aynı analitler için mevcut bireysel qPCR deneyleri üzerinde büyük avantajlara sahiptir. İlk olarak, çift yönlü dPCR deney böylece aykırı 7 değişkenlik ile ilişkili qPCR miktar sapmaları ortadan kaldırır bilinmeyenler ölçülmesi için standart eğrileri gerek yoktur. İkincisi, dubleks dPCR tahlil inhibit tolere edebilirveya karşılık gelen QPCR deneyleri 7 tolere daha yüksek büyüklükte bir ya da iki emirler konsantrasyonları. Bu özellik genellikle PCR inhibitör maddeler içeren çevresel örnekleri (örneğin yağmursuyu örnekleri) analizi için dubleks dPCR tahlil çok cazip hale getirmektedir. Üçüncü olarak, kapasite eşzamanlı olarak Enterococcus spp., Ve (iki QPCR deneylerinde ayrı ayrı ölçmek için olan genel), bir çift yönlü dPCR deneyde HF183 işaretleyici her iki ölçmek için daha düşük maliyetli 7 ve ilişkili kümülatif pipetleme değişkenliği kaçınarak veri miktarı artırır iletken iki ayrı deneyler (genel bir dubleks dPCR deneyi). Dördüncü olarak, dubleks dPCR deneyi de karşılaştırmalı çalışmalarda 7 eski iyi bir alternatif haline gelen qPCR deneyleri göre daha yüksek hassasiyet ve tekrarlanabilirlik göstermiştir. Bununla birlikte, sınırlamalar bu yöntem için var (avantajları ve sınırlamaları ayrıntılı olarak tarifbaşka 7). İlk olarak, reaksiyon başına kabul damlacıklarının sayısı üst miktar sınırı dPCR bölgesinin (UQL) belirler. Bu çalışmada kullanılan dPCR enstrüman reaksiyon başına 10 5 kopya bir UQL olduğu rapor edilmiştir (Malzeme / Ekipman Listesi bakınız). Bu, daha önce 7 DNA ekstraksiyon protokolü takip edilir ve 100 ul DNA, 100 (örneğin, DNA izolasyonu sırasında yıkama adımı başına) elde edilir tarif varsayarak 5 x 10 5 hücre ve Enterococcus, 100 ml su başına 2 x 10 6 HF183 kopya tekabül dPCR 7 önce örnek işleme sırasında herhangi bir kayıp olmadan ml su. Çevre sular genel olarak Enterococcus ve HF183 gibi konsantrasyonları aşmamaktadır. Ancak, örnek seyreltme bir kanalizasyon sızıntısı aşağıdaki gibi hemen toplanan hayvan dışkısı, kanalizasyon ve su örneklerinde olduğu gibi yüksek konsantrasyon örnekleri için düşünülmelidir. İkinci olarak, toplam DNA konsantrasyonu yüksek (ajanlar dahil olmak üzereng hedef ve hedef olmayan DNA) hem damlacık bölümleme süreci etkileyebilir. 7 enzimleri kısıtlama tarafından ön olmadan fazla 66 ng toplam DNA kullanılması tavsiye edilmez. EntHF183 dubleks dPCR tahlil qPCR daha inhibisyonuna karşı önemli ölçüde daha sağlam olmasına rağmen ciddi inhibisyon meydana gelen PCR engeller Üçüncüsü, eğer bu deney hala yanlış negatif sonuçlara yol açabilir. İnhibisyon kontrol tedbirleri, bu nedenle hala uygulanmalıdır. Daha önce açıklanan inhibisyonu 7 değerlendirmek için kullanılabildiği gibi standart ekleme veya seyreltme yöntemleri. Son dubleks tahlil tek dPCR platformunda onaylanmıştır ve yöntem doğrulama kullanımdan önce diğer dijital PCR platformlarda yapılmalıdır. Bu aynı zamanda yaygın olarak kabul gören su kalitesi göstergesi ve fekal kontaminasyon 7 için popüler bir konak ilişkili işaretleyici rakamlarla yayımlanan ilk dubleks dijital PCR testi olduğunu. gösterdi avantajlarEntHF183 dupleks dPCR deney söz mikrobik kaynak takip dijital PCR teknolojisinin diğer yararlı uygulamaları, patojenler ve antibiyotik direnç genlerinin algılama. Örneğin, genel bir dışkı göstergesi (Enterococcus spp., E. coli, genel Bacteroidales) ve bir ana bilgisayar ile bağlantılı dışkı markör (HF183, HumM2, CowM2, LeeSeagull) 2 (EntHF183 dupleks dPCR deneyinde olduğu gibi) benzer şekilde eşlenebilir daha fazla maliyet-etkin ve genel ve ana-ilişkili fekal kontaminasyon tayini için daha kesin bir dubleks dPCR deneyi. Aynı kaynak (veya farklı kaynaklardan) hedefleyen Mikrobiyal kaynak izleme belirteçleri de fekal kaynağı tespit güveni artırmak (veya aynı anda birden fazla dışkı kaynakları hakkında bilgi edinmek) için dubleks dPCR deneyinde eşleştirilmiş olabilir. PCR inhibitörleri karşı yüksek tolerans aynı zamanda düşük enfektif doz var ama Envir sadece mevcut tespit patojenlerin olasılığını artırmak için yüksek numune hacmi analizi izin verebilirdüşük konsantrasyonlarda onmental su. qPCR üzerinde dijital PCR benzer metodolojik avantajları da antibiyotik direnç genlerinin ölçümü için dijital PCR analizleri geliştirmek için geçerli olabilir.

daha hızlı, daha esnek ve geleneksel kültür temelli yöntemlerle karşılaştırıldığında özel çünkü kantitatif PCR (qPCR) yöntemleri yaygın eğlence su kalitesi izleme ve mikrobiyal kaynak takibi uygulamalarında kullanılmaktadır. Sonuç olarak, qPCR gibi Enterococcus spp gibi genel fekal göstergeler için hızlı su izleme sonuçları elde etmek için tavsiye edilir. Revize USEPA eğlence su kalite kriterleri 1. Birçok qPCR deneyleri de geliştirilmiş ve çevresel sularda 2 fekal kontaminasyon kaynaklarının belirlenmesi için onaylanmıştır. Bunlar arasında, HF183 işaretleyici deneyleri en sık insan ilişkili fekal kontaminasyonu 3 tanımlamak için kullanılan arasındadır. onlar ölçümü için standart eğriler güveniyor Ancak, qPCR sonuçlar genellikle önyargılı olabilir. qPCR bir stan kendi ölçümü döngüsünü (Cq) enterpolasyonlayarak örneklerinde hedefin bilinmeyen konsantrasyonlarını rakamlarlaCq ve seri seyreltilmiş standartların bir dizi logaritmik miktarı arasında doğrusal bir ilişki açıklanır dart eğrisi. güvenilir ve tutarlı standart referans malzeme eksikliği dolayısıyla büyük ölçüde qPCR sonuçlarını taraflı olabilir. Çalışmalar qPCR sonuçları farklı satıcılardan 4 yaklaşık yarım günlük kullanarak standartlarına göre farklılık ve aynı satıcıdan 5&#39;ten standartların farklı toplu kullanarak 2 kat ile gösterdi. Dijital PCR (dPCR) teknolojisi üniforma Nanoliter veya pikolitrelik reaksiyonlar 6 binlerce ya da milyonlarca içine toplu qPCR bölümleme tarafından oluşturulan minyatür PCR&#39;ler çok sayıda pozitif sıklığını sayarak bilinmeyen bir örnek rakamlarla. Bölmeler-içinde-su yağ damlacıkları (örneğin, bu makale) ya da çip küçük fonksiyonlu odalar olması durumunda bu, sırası ile (yani, bu makale) damlacık dijital PCR veya odası, dijital PCR olarak ifade edilir. Daha yüksek bir Örnek konsantrasyonu hedef DNA&#39;nın mevcudiyetinde sonuçlanırbölümleri daha yüksek bir oranda (dolayısıyla pozitif PCR), Poisson dağılımı ile yaklaştırılır bir ilişki. Bu nedenle, ikili sonuçlar (pozitif ya da negatif PCR) kaydedilir ve pozitif damlacıkların frekansı qPCR olarak standart bir eğri olan ihtiyacı ortadan kaldırarak, doğrudan Poisson yaklaşım ile bilinmeyen numune konsantrasyonları hesaplamak için kullanılır. Dijital PCR nicelikleme Bu ikili doğası qPCR 7 üzerinde ek avantajlar sağlamaktadır. gecikmiş amplifikasyon hala olumlu bir PCR sağlayabilir, çünkü dPCR miktar amplifikasyon verimliliği azaltır inhibisyonuna karşı daha sağlamdır. QPCR 8-10 göre dPCR yüksek hassasiyet yol qPCR olarak Benzer şekilde, dPCR miktar Cq değerleri değişkenlik etkilenmez. Buna ek olarak, bölme işlemi etkin bir şekilde amplificatio sırasında (alt-tabaka rekabet en aza indirerek, her damla hedef DNA mevcut çok az miktarda sağlanırqPCR (yani bir tahlil aynı anda iki DNA hedefleri ölçen) duplekslemeyi ulaşmak için ortak engeller farklı DNA hedefleri) n. Bu nedenle, dubleks veya simpleks çalışma (yani bir hedef, tek bir deneyde ölçülen) olmadığını dPCR her iki hedeflerin 7,11 neredeyse ayırt edilemez miktarının üretir. Bu makalede açıklanan dijital PCR deneyi (EntHF183 dPCR) amacı, genel dışkı göstergesi Enterococcus spp Eş zamanlı miktarının elde etmektir. Ve geliştirilmiş hassasiyet, tekrarlanabilirlik ve inhibisyonuna karşı sağlamlığı olan insan dışkı ilişkili HF183 markör olarak qPCR karşılaştırıldığında uzantılarıdır. Bu deney, başarılı bir şekilde, çevresel tatlı su, deniz suyu ve çeşitli dışkı maddesinin 7 dışkı kirlenme ölçülmesi için kullanılmıştır, ama aynı zamanda suları ve atık suların bir diğer türlerine de uygulanabilir. Bu tahlil, kendisine bağlı tortuları veya topraklar analiz etmek için büyük söz sahibidirinhibisyonuna yüksek tolerans s, ancak inhibitör örnekleri, bu tür karışımlar daha fazla test için karmaşıklığı gereklidir.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Bu yazının Enterococcus spp eşzamanlı ölçümü. Ve insan fekal-ilişkili HF183 işaretleyici için bir dubleks dijital PCR testi (EntHF183 dPCR) açıklar. EntHF183 dubleks dPCR (EntHF183 dPCR olarak anılacaktır buradan sonra) deneyi yayınlanmış bireysel kantitatif PCR (qPCR) meslektaşlarıyla aynı primer ve prob dizileri kullanır. Aynı şekilde, önce qPCR uygulandı aynı su filtreleme ve DNA ekstraksiyon prosedürleri dPCR çalıştırmadan önce takip edilmektedir. Ancak, dubleks dPCR tahlil qPCR deneyleri üzerinde birçok avantajı vardır. En önemlisi, dPCR tahlil hedefleri doğrudan ölçümü ile dolayısıyla standart bir eğri çalışan ve ihtiyacını, ilgili önyargı ve değişkenliği, ortadan kaldırır. QPCR (yani eşzamanlı kantifikasyon) enterokokların ve HF183 arkalı önlü ise ek olarak, çoğu kez bir numunede daha az bol hedefin ciddi küçümsenmesi yol açar, dPCR hem hedeflerin tutarlı ölçümü sağlar, uyandırmakona aynı reaksiyonda eş zamanlı olarak tek başına ya da miktarı. dPCR deneyi de qPCR tolere daha yüksek büyüklükte bir ya da iki emirler PCR inhibitörü konsantrasyonları tolere edebilmektedir. aynı anda iki ayrı qPCR deneyleri çalıştırmak için gerek kalmadan çevre sularda hem genel hem de insan-ilişkili fekal kontaminasyon doğru ve tekrarlanabilir bilgi sağlar, çünkü bu avantajlar EntHF183 dPCR tahlil özellikle çekici olun. qPCR üzerindeki avantajlara rağmen, şu anda mevcut cihaz olan dPCR deneyinde üst miktar sınırı yaklaşık qPCR elde edilebilenden daha düşük bir magnitüd dört işlemlerdir. Sonuç olarak, seyreltme, tipik pis su sızıntıları ardından gözlenen hedef organizmaların yüksek konsantrasyonlarının ölçümü için gereklidir.

İyi bir EntHF183 dupleks dPCR çalıştırma kabul damlacıklar (yaklaşık 10,000-17,000) ve negatif ve pozitif damlacıklar 7 floresans değerleri arasında nispeten daha büyük bir fark (yaklaşık 5.000) nispeten yüksek sayıda neden olmalıdır. damlaların alışılmadık az sayıda büyük olasılıkla damlacık oluşturma sürecinde sorunları gösterir ve 10.000 damlacıkların bir kesim bu makalede kullanılan damlacık dPCR sisteminden ampirik verilere dayalı önerilmektedir. Pozitif ve negatif damlacıkları arasında zayıf ayrılma (yani daha küçük floresan farkı) önlenmesine veya bozulmuş sondalar 7 gösterebilir. QPCR standartlarına birleşik sapmaların düzeltilmesi ve hiçbir inhibisyon 7 olduğu zaman genel olarak, EntHF183 dupleks dPCR deney simplex qPCR gelenle da benzer sonuçlar verir. EntHF183 dupleks dPCR tahlili ve cor sonuçlarıyanıt simpleks dPCR tahlilleri son derece tutarlı ve iki formatta 7 (Şekil 1) arasında sık sık ayırt edilemez. Buna ek olarak, dPCR deneyi de inhibitör konsantrasyonu onun qPCR karşıtları 7 (Şekil 2) tarafından tolere daha yüksek büyüklükte bir iki emir tolere edebilir. <img alt="Şekil 1" src="/files/ftp_upload/53611/53611fig1.jpg" /> Şekil 1:. Dışkı ve su EntHF183 dubleks dPCR testi ile örnekleri ve simpleks dPCR deneyleri gelen Sol ve sağ paneller miktarının belirlenmesi dubleks ve simpleks sonuçlar arasındaki karşılıklı ilişki katsayıları (p &lt;0.001), sırasıyla, enterokokların ve HF183 ölçümü gösterir. Düz çizgiler regresyon çizgileri gösterir ve gri gölgeleme gelen standart hataları gösterir. Semboller örneklerin farklı gösterir (Daireler, üçgen<html> lar ve haçlar, dışkı, tatlı su ve deniz suyu örnekleri, sırasıyla) ifade etmektedir. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53611/53611fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53611/53611fig2.jpg" /> Şekil 2:. Simplex qPCR ve temiz kanalizasyon DNA&#39;daki HF183 marker dPCR ölçümü dubleks PCR inhibitörleri konsantrasyonları (hümik asit) Üçgenler ve x-haçlar, sırasıyla dPCR ve qPCR ölçümü göstermek artan çivili. Önleyicilerin yokluğunda beklenen HF183 miktar (iki yatay noktalı çizgi arasında, örneğin,)% 95 güven aralığı olarak tanımlanır. Bir &quot;-1&quot; sonucu olmayan algılama. Gösterir Enterococcus ölçümü gelen qPCR tahlil 7 ziyade EntHF183 dubleks dPCR testi ile inhibitörlerine benzer yüksek tolerans gösterir.= &quot;Https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53611/53611fig2large.jpg&quot; target = &quot;_ blank&quot;&gt; bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Bu yazıda, aynı anda Enterococcus spp ölçmek için kullanılabilecek bir çift yönlü dijital PCR deneyi. Ve eğlence sularda genel olarak insan ilişkili dışkı kirlenme göstergeleri olarak HF183 genetik işaretleyiciler açıklanmaktadır.

Eşzamanlı Niceleme için Dubleks Dijital PCR Testi<em&gt; Enterococcus spp.</em&gt; Ve Waters İnsan Fekal ilişkili HF183 Marker

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Nanyang Technological University

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K Görüntüleme.  Southern California Costal Water Research Project Authority.  Bu yazıda, aynı anda Enterococcus spp ölçmek için kullanılabilecek bir çift yönlü dijital PCR deneyi. Ve eğlence sularda genel olarak insan ilişkili dışkı kirlenme göstergeleri olarak HF183 genetik işaretleyiciler açıklanmaktadır. 

Video: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Much of the nutrient cycling and carbon processing in natural environments occurs through the activity of extracellular enzymes released by microorganisms. Thus, measurement of the activity of these extracellular enzymes can give insights into the rates of ecosystem level processes, such as organic matter decomposition or nitrogen and phosphorus mineralization. Assays of extracellular enzyme activity in environmental samples typically involve exposing the samples to artificial colorimetric or fluorometric substrates and tracking the rate of substrate hydrolysis. Here we describe microplate based methods for these procedures that allow the analysis of large numbers of samples within a short time frame. Samples are allowed to react with artificial substrates within 96-well microplates or deep well microplate blocks, and enzyme activity is subsequently determined by absorption or fluorescence of the resulting end product using a typical microplate reader or fluorometer. Such high throughput procedures not only facilitate comparisons between spatially separate sites or ecosystems, but also substantially reduce the cost of such assays by reducing overall reagent volumes needed per sample.

Microplate based procedures are described for the colorimetric or fluorometric analysis of extracellular enzyme activity. These procedures allow for the rapid assay of such activity in large numbers of environmental samples within a manageable time frame.

Yüksek Verimli Mikroplate Tahliller kullanarak Waters, Topraklar ve tortulları Mikrobiyal Ekstrasellüler Enzim Aktivitesi Belirlenmesi

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Çevre

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist&#160;of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (&#181;PADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the &#181;PAD. Alternatively, digital images of the reacted &#181;PADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24&#160;hr), justifying its use as an initial screening method for the microbiological quality of agricultural water.

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

A protocol involving integrated concentration, enrichment, and end-point colorimetric detection of foodborne pathogens in large volumes of agricultural water is presented here. Water is filtered through Modified Moore Swabs (MMS), enriched with selective or non-selective media, and detection is performed using paper-based analytical devices (&#181;PAD) imbedded with bacterial-indicative colorimetric substrates.

Kolorimetrik Algılama Paper-based<em&gt; Escherichia coli</em&gt;<em&gt; Salmonella</em&gt; Spp. Ve<em&gt; Listeria monocytogenes</em&gt; Tarım Su geniş hacimli

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with &#39;end-point&#39; PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. The methodology includes the co-extraction of DNA and RNA; preparation of DNA-free RNA; and 16S rRNA gene and transcript quantification via RT-q-PCR, including standard curve construction.

Gerçek zamanlı PCR ile Kıyı tortulları ve Niceleme 16S rRNA Genler ve Transkriptler eşzamanlı DNA-RNA Ekstraksiyon

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination control. Developments of some techniques aiming to reduce trace metal contamination in the last couple of decades have resulted in concentrations reported now being orders of magnitude lower than those in the past. These low concentrations often necessitate preconcentration of water samples prior to instrumental analysis of samples. Since contamination can appear in all phases of trace metal analyses, including sample collection (and during preparation of sampling containers), storage and handling, pretreatments, and instrumental analysis, specific care needs to be taken in order to reduce contamination levels at all steps. The effort to develop and utilize "clean techniques" in trace metal studies allows scientists to investigate trace metal distributions and chemical and biological behavior in greater details. This advancement also provides the required accuracy and precision of trace metal data allowing for environmental conditions to be related to trace metal concentrations in aquatic environments.
This protocol that is presented here details needed materials for sample preparation, sample collection, sample pretreatment including preconcentration, and instrumental analysis. By reducing contamination throughout all phases mentioned above for trace metal analysis, much lower detection limits and thus accuracy can be achieved. The effectiveness of "clean techniques" is further demonstrated using low field blanks and good recoveries for standard reference material. The data quality that can be obtained thus enables the assessment of trace metal distributions and their relationships to environmental parameters.

Special care using "clean techniques" is required to properly collect and process water samples for trace metal studies in aquatic environments. A protocol for sampling, processing, and analytical procedures with the aim of obtaining reliable environmental monitoring data and results with high sensitivity for detailed trace metal studies is presented.

Temiz Örnekleme ve Eser Metal Çalışmaları Nehri ve haliç Waters Analizi

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of scientific publications address microplastic pollution of the sea surface. The protocol below describes the methodology for sampling, sample preparation, separation and chemical identification of microplastic particles. A manta net fixed on an &#187;A frame&#171; attached to the side of the vessel was used for sampling. Microplastic particles caught in the cod end of the net were separated from samples by visual identification and use of stereomicroscopes. Particles were analyzed for their size using an image analysis program and for their chemical structure using ATR-FTIR and micro FTIR spectroscopy. The described protocol is in line with recommendations for microplastics monitoring published by the Marine Strategy Framework Directive (MSFD) Technical Subgroup on Marine Litter. This written protocol with video guide will support the work of researchers that deal with microplastics monitoring all over the world.

The protocol below describes the methodology for: microplastics sampling on the sea surface, separation of microplastic and chemical identification of particles. This protocol is in line with the recommendations for microplastics monitoring published by the MSFD Technical Subgroup on Marine Litter.

Deniz Yüzey ve Numune Analizi Microplastics Örnekleme Protokolü

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment during manufacturing and transport. Because of their environmental persistence, they are widely distributed in the oceans and on beaches all over the world. They can act as a vector of potentially toxic organic compounds (e.g., polychlorinated biphenyls) and might consequently negatively affect marine organisms. Their possible impacts along the food chain are not yet well understood. In order to assess the hazards associated with the occurrence of plastic pellets in the marine environment, it is necessary to develop methodologies that allow for rapid determination of associated organic contaminant levels. The present protocol describes the different steps required for sampling resin pellets, analyzing adsorbed organochlorine pesticides (OCPs) and identifying the plastic type. The focus is on the extraction of OCPs from plastic pellets by means of a pressurized fluid extractor (PFE) and on the polymer chemical analysis applying Fourier Transform-InfraRed (FT-IR) spectroscopy. The developed methodology focuses on 11 OCPs and related compounds, including dichlorodiphenyltrichloroethane (DDT) and its two main metabolites, lindane and two production isomers, as well as the two biologically active isomers of technical endosulfan. This protocol constitutes a simple and rapid alternative to existing methodology for evaluating the concentration of organic contaminants adsorbed on plastic pieces.

Microplastics act as vector of potentially toxic organic contaminants with unpredictable effects. This protocol describes an alternative methodology for assessing the levels of organochlorine pesticides adsorbed on plastic pellets and identifying the polymer chemical structure. The focus is on pressurized fluid extraction and attenuated total reflectance Fourier transform infrared spectroscopy.

Plastik Peletlerden Organochlorine Pestisitlerin Çıkarılması ve Plastik Tipi Analizi

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf mottling, vein yellowing, defoliation, root decay, and ultimately, the death of the citrus plant. When infected, the citrus plants have stunted growth and produce flowers out of season. These flowers rarely yield fruit, and those that do yield small, bitter, irregularly shaped citrus fruit that are not desirable. This disease is spread by the Asian citrus psyllid, Diaphorina citri, and by the grafting of infected citrus tissue. The pathogen has a long and variable incubation period within the citrus plant&#8212;sometimes years, before symptoms appear. Attempts to culture this pathogen in vitro have been unsuccessful, possibly due to the low and uneven concentration of the pathogen within infected citrus tissue, or because it is difficult to replicate the environmental conditions conducive to growth of the pathogen. It is very difficult to identify the disease before it has spread, due to its long incubation period and researchers&#39; inability to culture the pathogen. As a result, the disease only becomes apparent after suddenly destroying a citrus farmer&#39;s entire yield. Presented here is a method for the accurate and specific detection of the citrus greening pathogen, Candidatus liberibacter spp. using a genomic DNA extraction kit and PCR. This method is simple, efficient, cost effective, and adaptable for quantitative analysis. This method can be adapted for use on any citrus tissue; however, it is potentially limited by the amount of pathogen present in the tissue. Nevertheless, this method will allow citrus farmers to identify infected citrus plants earlier, and curb the spread of this destructive disease before it can further spread.

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus Greening is a particularly destructive disease affecting citrus crops globally. Presented here is a simple method using PCR and genomic DNA extraction of citrus leaf tissue for the accurate and precise identification of the citrus greening pathogen, Candidatus liberibacter spp.

Belirli ve narenciye Greening patojen olan liberibacter spp. kullanma geleneksel PCR narenciye yaprak doku örnekleri üzerinde doğru tespiti

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). Therefore, knowing the dispersal capacity may help inform trapping/tree removal efforts to prevent this disease more effectively. In this study, we measured the flight velocity and duration and estimated the flight distance of the beetle using a newly developed flight mill. The flight mill is low cost, small, and constructed using commonly available items. Both the flight mill arm and its vertical axis comprise a thin needle. A beetle specimen is glued to one tip of the arm using instant glue. The other tip is thick due to being covered with plastic, thus it facilitates the detection of rotations of the arm. The revolution of the arm is detected by a photo sensor mounted on an infrared LED, and is indicated by a change in the output voltage when the arm passed above the LED. The photo sensor is connected to a personal computer and the output voltage data are stored at a sampling rate of 1 kHz. By conducting experiments using this flight mill, we found that P. quercivorus can fly at least 27 km. Because our flight mill comprises cheap and small ordinary items, many flight mills can be prepared and used simultaneously in a small laboratory space. This enables experimenters to obtain a sufficient amount of data within a short period.

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

We developed a low cost and small flight mill, constructed with commonly available items and easily used in experimentation. Using this apparatus, we measured the flight ability of an ambrosia beetle, Platypus quercivorus.

Ambrosia Beetle, Platypus Quercivorus (Murayama), ucuz, küçük ve kolayca inşa uçuş Mill kullanarak uçuş yeteneği ölçme

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, and the majority of extant heteropterans retain this trophic strategy. Some heteropterans have transitioned to feeding on vertebrate blood (such as the kissing bugs, Triatominae; and bed bugs, Cimicidae) while others have reverted to feeding on plants (most Pentatomomorpha). However, with the exception of saliva used by kissing bugs to facilitate blood-feeding, little is known about heteropteran venoms compared to the venoms of spiders, scorpions and snakes.
One obstacle to the characterization of heteropteran venom toxins is the structure and function of the venom/labial glands, which are both morphologically complex and perform multiple biological roles (defense, prey capture, and extra-oral digestion). In this article, we describe three methods we have successfully used to collect heteropteran venoms. First, we present electrostimulation as a convenient way to collect venom that is often lethal when injected into prey animals, and which obviates contamination by glandular tissue. Second, we show that gentle harassment of animals is sufficient to produce venom extrusion from the proboscis and/or venom spitting in some groups of heteropterans. Third, we describe methods to harvest venom toxins by dissection of anaesthetized animals to obtain the venom glands. This method is complementary to other methods, as it may allow harvesting of toxins from taxa in which electrostimulation and harassment are ineffective. These protocols will enable researchers to harvest toxins from heteropteran insects for structure-function characterization and possible applications in medicine and agriculture.

Although many insects in the suborder Heteroptera (Insecta: Hemiptera) are venomous, their venom composition and the functions of their venom toxins are mostly unknown. This protocol describes methods to harvest heteropteran venoms for further characterization, using electrostimulation, harassment, and gland dissection.

Venom toksinlerin Assassin böcek ve diğer Heteropteran böcekler hasat

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and maintenance issues. On the contrary, the nematode Caenorhabditis elegans (C. elegans) has advantages to make it an ideal choice for toxicity testing: a short lifespan, easy cultivation, and efficient reproduction. Here, we describe a protocol for the automatic phenotypic profiling of C. elegans in a 384-well plate. The nematode worms are cultured in a 384-well plate with liquid medium and chemical treatment, and videos are taken of each well to quantify the chemical influence on 33 worm features. Experimental results demonstrate that the quantified phenotype features can classify and predict the acute toxicity for different chemical compounds and establish a priority list for further traditional chemical toxicity assessment tests in a rodent model.

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

A quantitative method has been developed to identify and predict the acute toxicity of chemicals by automatically analyzing the phenotypic profiling of Caenorhabditis elegans. This protocol describes how to treat worms with chemicals in a 384-well plate, capture videos, and quantify toxicological related phenotypes.

Bir yüksek-den geçerek tahlil tarafından otomatik fenotipik profil oluşturma Caenorhabditis elegans ve kimyasal toksisitesi tahmin için

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and ...