The authors have no acknowledgements.

1. תערובת Assay כן <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך 100 μmol / L ריכוזי מניות לכל פריימרים במי כיתה מולקולריים בדיקות במאגר TE pH 8 [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. הערה: בדיקות עבור שתי המטרות מסומנות fluorescently עם 7 fluorophores השונים כמצוין רשימה של חומרים / ציוד. </li><li style=";text-align:right;direction:rtl"> הכינו תערובת אמן על ידי ערבוב, לכל תגובה מתוכננת, 12 μl דיגיטלי תמהיל PCR (2x המניות, ראה רשימה של חומרים / ציוד), 0.216 μl כל קדימה לאחור תחל, 0.06 μl כל בדיקה ניאון, ו 5.016 μl מים nuclease חינם (הריכוז הסופי : פריימר 900 ננומטר כל, 250 ננומטר כל בדיקה). פיפטה מעלה ומטה לפחות 10 פעמים כדי לערבב תוך זהירות שלא להכניס בועות אוויר בתמיסה. </li><li style=";text-align:right;direction:rtl"> פיפטה 18 μl תערובת אמן (משלב 1.2) לתוך צינור או צלחת PCR רגיל, ערבוב תבנית ה- DNA 6 μl (חילוץ כמתואר לשנים קודמותערמומי 13) לעשות תערובת assay עבור דור אגל. אם פועל דגימות בשני עותקים, pipet 36 μl של תמהיל מאסטר ו -12 תבנית ה- DNA μl לבאר כל אחד. השאר את הבארות לשכפל המקביל ריק על הצלחת. כלול בקרות חיוביות (ראה רשימה של חומרים / ציוד) ולא שולט תבנית (NTC) (כלומר עם מי כיתה מולקולריים משמשים תבנית). הערה: בקרה חיובית יש צורך להבטיח את assay פועל כראוי ואת NTC יש צורך להבטיח שאין זיהום בתוך הצלחת ולהגדרת בסיס הניאון בהמשך לניתוח נתונים. משתמשים פעם ראשונה מומלץ להשתמש בשתי דגימות DNA חי ומדולל. </li></ol> 2. דור אגל והגדרת פלייט PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים את תערובת assay ידי pipetting למעלה למטה כ 15 פעמים באמצעות pipet הרב ערוצית. ודא קצה pipet נשאר בתוך נוזל, כדי למנוע עושה בועות עודפות בתוך התערובת. </li><li style=";text-align:right;direction:rtl"> insמחסנית ERT 1 (המכיל 8 בארות) לתוך בעל מחסנית לבן ולחץ על עצומות בעל מחסנית. מחסנית 1 כיום במקומו ולא ניתן וחילצה מבעל תוך יצירת טיפות. שימוש pipet הרב ערוצית, להעביר בעדינות 20 μl של תערובת assay לתוך האמצע של &quot;מדגם&quot; מסומן מחסנית ללא החדרת בועות אוויר. </li><li style=";text-align:right;direction:rtl"> Pipet ב 70 μl של שמן אגל דור אל הצד השמאלי של מחסנית (מסומן &#39;שמן&#39;). </li><li style=";text-align:right;direction:rtl"> מחסנית כיסוי עם אטם מוודא האטם הוא שטוח וקבע באופן שווה על ידי 4 קרציות לעבר קצה המחסנית. לחצו על הכפתור הירוק מואר על הגנרטור אגל לפתוח ולמקם את המחסנית. לחץ ירוק מואר הלחצן שוב כדי לסגור את הגנרטור. הערה: לאחר שהדלת נסגרת, הלחצן מעומעם, הדלת לא ניתן לפתוח מחדש ודור אגל מתחיל ממשיך מיד כ 1 דקות. </li><li style=";text-align:right;direction:rtl"> אם עושים יותר מ -8 תגובות, מחסנית מקום 2 תוך שנייהבעל מחסנית לבן ולהכין באותו אופן כמו מחסנית 1 ואילו דור האגל מתבצע כדי לחסוך זמן התקנה כולל. </li><li style=";text-align:right;direction:rtl"> פתח את דלת גנרטור אגל כאשר הכפתור מואר העמום הופך ירוק המציין השלים דור אגל. הסר את בעל מחסנית לבן המכיל מחסנית 1, להפריש, ומקום מחסנית 2 על גנרטור רביב. </li><li style=";text-align:right;direction:rtl"> הסר את האטם ממחסנית 1 וזורקים. בעדינות להעביר את הנפח הכולל (כ 40 μl) של טיפות שנוצרו מן בטור השלישי של המחסנית (מסומן &#39;טיפות&#39;) לצלחת PCR סופית (נשמרה בטמפרטורת חדר) עבור רכיבה תרמית. הערה: אל ובטל את בעל מחסנית הלבן כמו הפעולה עשוי לשבור את הטיפין החדשות שנוצרו באופן מלאכותי; רק לפתוח את בעל המחסנית אחרי הטיפין הועברו הצלחת הסופית. </li><li style=";text-align:right;direction:rtl"> חזור על שלבים 2.1-2.7 עבור דגימות נוספות. </li><li style=";text-align:right;direction:rtl"> כשכל הטיפין נמצאות צלחת PCR הסופית, להציב לנקבהכיסוי רדיד על גבי צלחת ומניחים אותו על אוטם צלחת. הגדר את האוטם ל -180 ° C, לחץ על &#39;Play&#39; על האוטם ולתת חותמים במשך 10 שניות. </li></ol> 3. רכיבה על אופניים תרמיים וקריאת האגל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניח את הצלחת האטומה על Cycler התרמית, אחד בקנה אחד עם צלחת PCR הסופית המשמשת בשלב 2.7, ומהירות ramping טמפרטורה של 2.0 מעלות צלזיוס / sec. </li><li style=";text-align:right;direction:rtl"> הפעל תכנית תרמית כדלקמן: 10 דקות ב 95 מעלות צלזיוס, ואחריו 40 מחזורים של 30 שניות על 94 מעלות צלזיוס ו -60 שניות על 60 מעלות צלזיוס, ואחריו להחזיק 10 דקות ב 98 ° C (אופציונאלי: עצירה סופית ב 4 או 15 ° C). </li><li style=";text-align:right;direction:rtl"> עם השלמת אופניים, להעביר את הצלחת לקורא אגל למדידה אוטומטית של קרינה בכל אגל בכל טוב. לחלופין, אחסן את הצלחת ב 4 מעלות צלזיוס למשך עד 3 ימים לפני קריאת רביב. ודא הטיפות הן בטמפרטורת החדר לפני שתמשיך עם הקריאה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פתח בתוכנה הנלווית התקנת קריאת רביב. בתפריט ברירת המחדל &#39;הגדרת&#39; המכיל סכמטי של צלחת ריקה 96 באר, לחץ לחיצה כפולה על כן A1 כדי לפתוח את התפריט המכיל שלושה חלקים: &quot;לדוגמא, &#39;&#39; Assay 1 &#39;ו&#39; Assay 2.&quot; </li><li style=";text-align:right;direction:rtl"> בקטע &#39;לדוגמא&#39; הקלד את מזהה המדגם לתוך התיבה שכותרתה &#39;שם&#39; ולחצו אנטר או לסמן את התיבה בצד ימין מסומן &#39;החל&#39;. לאחר מכן, לחץ הנפתח &#39;ניסוי&#39; שכותרתו תפריט ולבחור &quot;RED&quot; (זיהוי אירוע נדיר) ולחץ על Enter. </li><li style=";text-align:right;direction:rtl"> לעבור לקטע כונה &#39;Assay 1.&#39; בקטע &#39;שם&#39; למלא את assay (למשל אנטרוקוקוס) ולחץ על Enter. בתיבת הדו למטה תחת הכותרת &quot;סוג&quot; לחץ על התפריט הנפתח ובחר &#39;ערוץ 1 לא ידוע&#39; ולחץ על Enter. </li><li style=";text-align:right;direction:rtl"> לעבור לקטע כונה &#39;Assay 2. &quot; בקטע &#39;שם&#39; למלא את assay (למשל HF183) ולחץ על Enter. בתיבת הדו למטה תחת הכותרת &quot;סוג&quot; לחץ הנפתחת תפריטd לבחור &quot;ערוץ 2 לא ידוע &#39;ולחץ על Enter. כל המידע מן השלבים 3.3.2 עד 3.3.4 עכשיו להציג היטב A1. </li><li style=";text-align:right;direction:rtl"> שם כל הבארות הבאות המכילות טיפות. כדי לחסוך זמן התקנה כולל, לחץ על &#39;Shift&#39; או &#39;Ctrl&#39; לבחור בארות בו זמנית. </li><li style=";text-align:right;direction:rtl"> כאשר התיאור הדיגיטלי של צלחת מראות הצלחת הגופנית, לחץ על &#39;האישור&#39; בפינה הימנית התחתונה של התפריט. בתפריט החדש שמופיע בחלק העליון של סכמטית הצלחת, תחת הסעיף &#39;Template&#39; לבחור &#39;שמירה בשם&#39; ושם ולשמור הצלחת. </li><li style=";text-align:right;direction:rtl"> כדי השמאלי של המסך ולחץ על &#39;הפעל&#39; ובחר מתאים דיי סט ב-אאוט פופ &quot;הפעלת האפשרויות&quot; החלון. איסוף נתונים יוזם מוצג בזמן אמת בתוכנה. </li></ol></li></ol> 4. ניתוח נתונים ודיווח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כאשר הקורא הוא סיים תופיע תיבה והצהירה &quot;מפעיל שלמים &#39;, לחץ על&#39; אישור &#39;. הערה: רכהכלי מציג את קובץ הנתונים הסופיים, בסעיף &#39;לנתח&#39; של התוכנה. לפי השקפה זו, התוכנה יש את כל הבארות בצלחת שנבחרו מחדל לעלילת הנתונים ד&#39;2 Amplitude &#39;. </li><li style=";text-align:right;direction:rtl"> בדוק את ההפרדה בין הטיפות חיוביות ושליליות. ודא כי הקרינה בכל טיפות בבארות NTC נמצאים בקרבת הבסיס. </li><li style=";text-align:right;direction:rtl"> הקישו על כפתור הנקרא &#39;אירועים&#39;. מהימין של ההיסטוגרמה הציג לחץ על התיבה בשם &#39;סה&quot;כ&#39; והתיבה בשם &quot;יחיד&quot; בתחתית כדי להציג את המספר הכולל של טיפות קבלו בכל טוב. אל תכלול כל בארות המכילות &lt;10,000 טיפות 7-ידי החזקת מקש Ctrl ולחיצה על הבאר (ים) כדי להיות שליליות. </li><li style=";text-align:right;direction:rtl"> לחץ על הכפתור המסומן כמו &#39;1D Amplitude&#39; כדי לקבוע את סף פלורסנט בכ סטיית תקן אחת (500-700 יחידות קרינה) מעל הטיפין השליליות בבארות NTC עבור מטרות שניהם. במקרה הטוב ביותר השמאלי של האו&quot;ם המסךדער את &#39;אוטומטי לנתח ו&quot;הראתה שני כפתורי סף, לבחור את הסמל בצד ימין כי יש קו אופקי ורוד מוצק רץ דרך אותה. </li><li style=";text-align:right;direction:rtl"> לחץ בתיבה מהשמאל &#39;קבע סף&#39; תחת כל הגרפים משרעת והזן את ערכי סף הקרינה המתאימים. ריכוזי היעד להעתיק לכל תגובת μl אז מחושבים באופן אוטומטי. הערה: ספי לא צריך להיות זהה עבור מטרות שונות. </li><li style=";text-align:right;direction:rtl"> לייצא את התוצאות לקובץ csv על ידי לחיצה על כפתור &quot;ייצוא&quot; בפינה השמאלית העליונה במסך 1D משרעת. בקובץ CSV, להכפיל את הריכוז היעד שמייצאת 4 להמיר אותו מעותק של היעד (23S הגן של spp אנטרוקוקוס. או על סמן HF183) לכל תגובה μl להעתיק של היעד לכל μl תבנית ה- DNA. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

ישנם כמה צעדים קריטיים בפרוטוקול. ראשית, ערבוב של תערובות assay יכול להיות קשה, כי את תערובת מאסטר היא צמיגה יותר מאשר תערובות מאסטר qPCR קונבנציונליות. vortexing פשוט עלול להוביל ערבוב מספיק, אשר בתורו מוביל הפצה לא אחידה של תבניות DNA של תערובות assay וכפועל יוצא מזה הטיפות. טכניקת ערבוב האחרת pipetting כמתואר בפרוטוקול חייב להיות אחריו כדי להבטיח כימות dPCR מדויקות. שנית, חשוב להבטיח טיפות נוצרות בכל צורה וגודל אחיד. להיות זהיר של מקרים שבהם הזמן הגנרטור אגל שנדרש כדי להשלים הדור אגל על ​​מחסנית אחת קצרה מהרגיל. זה עשוי להצביע על דור אגל לא טוב. במידת הצורך, הזמן אגל הדור של כל מחסנית ניתן להקליט לפתרון בעיות. שלישית, חשוב להעביר את 40 μl כולו של טיפות שנוצרו מהמחסנית לצלחת PCR הסופית ללא גזטיפות ולהימנע שלא טיפות מספיק כימות. הטכניקות הבאות ניתן להשתמש להעברה: 1) קבעת את pipet רב ערוצית 40 μl והכנס את הטיפים לתוך בחלק הימני של המחסנית (המסומנת &#39;טיפות&#39;) בזווית של 45 מעלות; 2) Pipet הטיפות החוצה לאט להבטיח שכל טיפות הם pipetted למעלה (שימו לב אם בכלל טיפות נותרים מאחור צריך להיות pipetted עד לסיבוב השני); 3) לאחר טיפות יוסרו, להעביר אותם לצלחת הסופי על ידי הצבת קצה pipet בקיר גם כמחצית הדרך למטה ולגרש את טיפות לאט. את assay EntHF183 דופלקס dPCR יש יתרונות גדולים על פני מבחני qPCR הנפרדים הקיימים עבור אותה analytes. ראשית, assay דופלקס dPCR לא צריך עקומות סטנדרטיות עבור אלמונים לכימות, ובכך למנוע הטיות כימות qPCR הקשורים השתנות הסטנדרטים 7. שנית, assay דופלקס dPCR יכול לסבול לעכבאו ריכוזי שהם אחד שני סדרי גודל גבוה יותר מזה נסבל על ידי מבחני qPCR המקבילים 7. תכונה זו הופכת את assay דופלקס dPCR אטרקטיבי לניתוח דגימות סביבתיות (דגימות stormwater למשל) כי בדרך כלל מכילות חומרים מעכבים כדי PCR. שלישית, היכולת לכמת בו זמנית הן spp אנטרוקוקוס. ואת סמן HF183 בדופלקס אחד assay dPCR (לעומת שיש לכמת אותם בנפרד בשני מבחני qPCR) הוא יותר יעיל וחסכוני 7 ומשפר כמות הנתונים על ידי הימנעות השתנות pipetting מצטבר הקשורים מנהלת שני מבחנים נפרדים (לעומת assay dPCR דופלקס אחד). רביעית, assay דופלקס dPCR הפגין גם דיוק גבוה ואת דירות לעומת מבחני qPCR המקבילים, מה שהופך את לשעבר אלטרנטיבה טובה במחקרים השוואתיים 7. עם זאת, מגבלות קיימות בשיטה זו (יתרונות ומגבלות מתוארים בפירוטבמקום אחר 7). ראשית, מספר טיפות קיבל לכל תגובה קובע את היקף כימות העליון (UQL) של dPCR. מכשיר dPCR המשמש בעבודה זו (מעיין הרשימה של חומרים / ציוד) דווח יש UQL 10 5 עותק לכל תגובה. זה מקביל 5 x 10 5 תאים אנטרוקוקוס ו -2 x 10 6 עותקים HF183 ל -100 מ&quot;ל מים בהנחה בעבר 7 תיאר פרוטוקול מיצוי DNA אחריו ו -100 DNA μl מתקבל (כלומר לכל הצעד elution במהלך החילוץ DNA) מ 100 מ&quot;ל מים ללא כל אובדן במהלך עיבוד המדגם לפני dPCR 7. מי סביבה בדרך כלל לא יעלו על ריכוזים כאלה של אנטרוקוקוס ו HF183. עם זאת, דילול מדגם צריך להיחשב עבור דגימות ריכוז גבוהות כגון צואת בעלי חיים, ביוב גולמי דגימות מים נאספות מייד לאחר לשפוך ביוב. שנית, ריכוזים גבוהים של DNA הכולל (including הוא היעד ו- DNA היעד הלא) יכולים להפריע לתהליך מחיצות רביב. זה לא מומלץ להשתמש יותר מ -66 DNA הכולל ng ללא טיפול מקדים על ידי הגבלת אנזימים 7. שלישית, על אף assay דופלקס dPCR EntHF183 הוא משמעותי יותר חזק נגד עיכוב מ qPCR, assay זה עדיין יכול להניב תוצאות שליליות שווא אם עיכוב חמור מונע הגברת PCR התרחשות. אמצעי בקרת עיכוב ולכן עדיין צריך להיות מיושם. שיטות בנוסף או דילול רגיל כמתואר ניתן להשתמש בעבר כדי להעריך עיכוב 7. לאחרונה, assay דופלקס יאומת רק על פלטפורמה אחת dPCR, ואימות שיטה צריכה להתנהל על פלטפורמות PCR דיגיטליות אחרות לפני השימוש. זהו assay PCR הדיגיטלית דופלקס פורסם לראשונה כי במקביל המכמת אינדיקטור איכות מים מקובל סמן מארח הקשורים פופולרי עבור זיהום צואתי 7. היתרונות הפגינוהבטחת assay דופלקס dPCR EntHF183 יישומים שימושיים אחרים בטכנולוגית PCR דיגיטלית מעקב מקור חיידקים, זיהוי של פתוגנים גנים עמידים לאנטיביוטיקה. לדוגמא, מחוון צואתי כללי (אנטרוקוקוס spp., E. coli, כללי Bacteroidales) ועם סמן צואה קשור מארח (HF183, HumM2, CowM2, LeeSeagull) 2 ניתן לזווג דומה (כמו assay דופלקס dPCR EntHF183) ב assay דופלקס dPCR יותר חסכוני כימות מדויקת של זיהום צואתי כללי קשורים מארח. סמני מעקב מקור מיקרוביאלית מיקוד אותו המקור (או מקורות שונים) יכולים גם יש להתאים assay דופלקס dPCR כדי להגדיל את הביטחון באיתור המקור בצואה (או לקבל מידע על מקורות צואה מרובים בו זמנית). הסובלנות התחזק כנגד מעכבי PCR גם עלולה לאפשר ניתוח של נפח דגימה גבוה כדי להגדיל את ההסתברות של פתוגנים גילוי כי יש מינונים זיהומיות נמוך אבל נוכחים רק envirמי onmental בריכוזים נמוכים. יתרונות מתודולוגיים דומים PCR הדיגיטלית מעל qPCR יכולים לחול גם על פיתוח מבחני PCR דיגיטליים כימות של גנים עמידים לאנטיביוטיקה.

PCR כמוני (qPCR) שיטות כבר בשימוש נרחב לניטור איכות מי פנאים ויישומי מעקב מקור חיידקים כי הם מהירים יותר, גמישים יותר ספציפיים בהשוואה לשיטות תרבות המבוססת מסורתיות. כתוצאה מכך, qPCR מומלץ להשגת תוצאות ניטור מים מהירות עבור אינדיקטורים צואתי כלליים כגון spp אנטרוקוקוס. בקריטריוני איכות מי פנאי מתוקן USEPA 1. מבחני qPCR רבים גם פותחו ומאומתים לזיהוי מקורות זיהום צואתי במי סביבת 2. בין אלה, מבחני סמן HF183 הם בין הנפוצות ביותר בשימוש לזיהוי זיהום צואתי הקשורים האדם 3. עם זאת, תוצאות qPCR יכול לעיתים קרובות להיות מוטים כי הם מסתמכים על עקומות סטנדרטיות עבור כימות. qPCR מכמת ריכוזים ידועים של יעד בדגימות על ידי ביון מחזור הכימות שלהם (CQ) מתוך סטןעקומת dard המתארת ​​מערכת יחסים ליניארי בין Cq וכמות לוגריתמים של סט של סטנדרטים בדילול סדרתי. חוסר חומר עזר תקן אמין ועקבי ולכן יכול להטות תוצאות qPCR מאוד. מחקרים הראו כי תוצאות qPCR שונות על ידי כחצי סטנדרטי יומן באמצעות מיצרנים שונים 4 ועל ידי 2-לקפל באמצעות קבוצות שונות של סטנדרטים מאותו הספק 5. PCR דיגיטלי (dPCR) טכנולוגיה מכמתת מדגם לא ידוע על ידי ספירת התדירות חיובית במספרים גדולים של PCRs מיניאטורי המופקים על ידי מחיצות qPCR בתפזורת לתוך אלף או מ&#39;nanoliter האחיד או תגובות picoliter 6. זה נקרא כמו אגל PCR דיגיטלי (כלומר, במאמר זה) או תא דיגיטלי PCR, בהתאמה, אם המחיצות הן טיפות מים ב-שמן (כלומר, במאמר זה) או תא קטן על שבב. ריכוז מדגם גבוה יגרום נוכחות של DNA היעד(ומכאן חיובי PCR), בשיעור גבוה יותר של מחיצות, מערכת יחסים המקורבים על ידי התפלגות פואסון. ככזה, התוצאות בינארי (חיובי או שלילי PCR) נרשמות ואת התדירות של טיפות חיוביות משמשת לחישוב ריכוזים מדגמים לא ידועים ישירות דרך קירוב פואסון, ביטול הצורך עקום סטנדרט כמו qPCR. הטבע בינארי זה של כימות דיגיטלי PCR מספק יתרונות נוספים על פני qPCR 7. בגלל הגברה מתעכבת עדיין יכולה להניב PCR חיובי, כימות dPCR הן חזקות יותר נגד עיכוב המפחיתה יעילה הגברה. באופן דומה, כימות dPCR אינו מושפע השתנות בערכים Cq כמו qPCR, שמוביל דיוק גבוה של dPCR לעומת qPCR 8-10. בנוסף, תהליך יצירת המחיצות מבטיח כמות קטנה מאוד של הנוכחי DNA יעד בכל אגל, מזעור תחרות מצע ביעילות (במהלך amplification של מטרות DNA שונות) כי הם מכשולים נפוצים להשגת דופלקס (כלומר assay מודד בעת ובעונה אחת שתי מטרות DNA) qPCR. ככזה, אם בטווח בדופלקס או סימפלקס (כלומר יעד אחד נמדד ב assay אחת) dPCR מייצרת כימות כמעט נבדלות של שני היעדים 7,11. המטרה של assay PCR הדיגיטלי (EntHF183 dPCR) המתוארת במאמר זה היא להשיג כימות ישירה סימולטני של spp אנטרוקוקוס מחוון צואתי הכללי. ואת סמן HF183 הקשורים אדם-צואה עם דיוק, שחזור וחוסנם משופרים מפני עיכוב לעומת qPCR שלה עמיתים. Assay זה נוצל בהצלחה לכימות זיהום צואתי במים מתוקים סביבה, מים ימיים, חומר צואתי שונה 7, אבל יכול גם להיות מיושם על כל סוגים אחרים של מים ואת wastewaters. assay זה טומן בחובו הבטחה גדולה לניתוח משקע או קרקעות בגלל זהזה סובלנות גבוהה עיכוב, אך בדיקות נוספות נדרשות בשל מורכבות של המעכב מתערבב סוגים אלה של דגימות.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

כתב יד זה מתאר assay PCR דיגיטלית דופלקס (EntHF183 dPCR) כימות סימולטני של spp אנטרוקוקוס. ואת סמן HF183 צואה הקשורים האדם. EntHF183 דופלקס dPCR (המכונה בשם EntHF183 dPCR hereon) assay משתמשת באותו רצפים פריימר בדיקה כמו PCR כמותי הפרט שפורסם שלה (qPCR) עמיתיהם. כמו כן, אותם הליכי סינון מי מיצוי DNA כפי שבוצע לפני qPCR הם אחריו לפני הפעלת dPCR. עם זאת, assay דופלקס dPCR יש מספר יתרונות על פני מבחני qPCR. החשוב ביותר, assay dPCR מבטל את הצורך לרוץ עקומת סטנדרט ומכאן, ההטיה הקשורה ולהבדלים, על ידי כימות ישיר של מטרותיה. בנוסף, בעוד להדפסה דו-צדדי (כלומר כימות סימולטני) אנטרוקוקוס ו HF183 ב qPCR מוביל לעתים קרובות הערכה נמוכה מדי חמורה של היעד השופע פחות במדגם, dPCR מספק כימות עקבית של המטרות הן, לגרותלה לכמת בנפרד או בו-זמנית באותו התגובה. את assay dPCR הוא גם מסוגל לסבול ריכוזי מעכב PCR כי הם אחד שני סדרי גודל גבוה יותר מאלו נסבלים על ידי qPCR. יתרונות אלו הופכים את assay EntHF183 dPCR אטרקטיבי במיוחד משום שהיא בעת ובעונה אחת מספקת מידע מדויק דיר משני הזיהום הכללי ואנושיים הקשורים צואתי במי סביבה, ללא הצורך להפעיל שני מבחני qPCR נפרדים. למרות יתרונותיה מעל qPCR, מגבלת הכימות העליונה של assay dPCR עם מכשור הקיימות כיום כ ארבעה סדרי גודל נמוך מזה השגה על ידי qPCR. כתוצאה מכך, הדילול נדרש למדידת ריכוזים גבוהים של אורגניזמים היעד כגון אלו שנצפו בדרך כלל בעקבות נשפך ביוב.

ריצת דופלקס EntHF183 טובה dPCR צריכה לגרום למספר גבוה היחסי של טיפות קבלו (בערך 10,000-17,000) והבדל גדול יחסית (בערך 5,000) בין ערכי קרינה עבור טיפות שליליות וחיוביות 7. באופן חריג מספר נמוך של טיפות מציין בעיות קרוב בתהליך אגל הדור, וניתוק 10,000 טיפות מוצע מבוסס על נתונים אמפיריים ממערכת אגל dPCR שימוש במאמר זה. הפרדה חלשה יותר (הבדל קרינה קטן כלומר) בין טיפות חיוביות ושליליות עשויה להצביע על עיכוב או בדיקות מושפלות 7. בסך הכל, assay דופלקס dPCR EntHF183 מייצרת תוצאות דומות מאוד לזו מ סימפלקס qPCR כאשר qPCR תוקן הטיות הקשורות סטנדרטים ואין עיכוב 7. תוצאות מן assay דופלקס dPCR EntHF183 ואת corמבחנים להגיב סימפלקס dPCR הם ומתואמים היטב ולעתים קרובות נבדל בין שני הפורמטים 7 (איור 1). בנוסף, assay dPCR גם יכול לסבול מעכב ריכוזי אחד שני סדרי גודל גבוה יותר מזה נסבל על ידי עמיתיהם שלו qPCR 7 (איור 2). <img alt="איור 1" src="/files/ftp_upload/53611/53611fig1.jpg" /> איור 1:. כימות של דגימות צואה ומים ידי assay דופלקס dPCR EntHF183 ואת מבחני dPCR סימפלקס המקביל שמאל לוחות מימין להציג אנטרוקוקוס וכימות HF183, בהתאמה, עם מקדמי מתאם המתאים (p &lt;0.001) בין דופלקס ותוצאות סימפלקס. קווים מוצקים לציין את קווי רגרסיה ואת הגוון האפור מציין את סטיות תקן המקבילות. סמלים מציינים סוגים שונים של דגימות (מעגלים, משולש<html> ים וצלבים לציין צואה, מים מתוקים, דגימות מים ימיות, בהתאמה). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53611/53611fig1large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53611/53611fig2.jpg" /> איור 2: סימפלקס qPCR דופלקס dPCR כימות של הסמן HF183 בדנ&quot;א ביוב נקי ומשובץ ריכוז גדל והולך של מעכבי ה- PCR (חומצה humic) משולשים ו- x-צלבים מציינים כימות dPCR ו qPCR, בהתאמה.. כימות HF183 הצפויות בהעדר המעכבים מוגדרות 95% (כלומר, בין שני קווים מהקווקווים אופקיים). A &quot;-1&quot; התוצאה מצביעה על אי-זיהוי. כימות אנטרוקוקוס תערוכות דומה סובלנות גבוהה יותר למעכבי ידי assay EntHF183 דופלקס dPCR מאשר על ידי assay qPCR המקביל 7.= &quot;Https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53611/53611fig2large.jpg&quot; target = &quot;_ blank&quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

כתב יד זה מתאר assay PCR דיגיטלית דופלקס, שניתן להשתמש בהם כדי לכמת spp אנטרוקוקוס זמנית. ואת סמנים גנטיים HF183 כאינדיקטורים לזיהום צואתי כללית אדם הקשורים במים פנאי.

Assay PCR דיגיטלי דופלקס כימות סימולטני של<em&gt; Spp אנטרוקוקוס.</em&gt; ואת מרקר HF183 הקשורים צואת האדם ווטרס

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Nanyang Technological University

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K Views.  Southern California Costal Water Research Project Authority.  כתב יד זה מתאר assay PCR דיגיטלית דופלקס, שניתן להשתמש בהם כדי לכמת spp אנטרוקוקוס זמנית. ואת סמנים גנטיים HF183 כאינדיקטורים לזיהום צואתי כללית אדם הקשורים במים פנאי. 

Video: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Much of the nutrient cycling and carbon processing in natural environments occurs through the activity of extracellular enzymes released by microorganisms. Thus, measurement of the activity of these extracellular enzymes can give insights into the rates of ecosystem level processes, such as organic matter decomposition or nitrogen and phosphorus mineralization. Assays of extracellular enzyme activity in environmental samples typically involve exposing the samples to artificial colorimetric or fluorometric substrates and tracking the rate of substrate hydrolysis. Here we describe microplate based methods for these procedures that allow the analysis of large numbers of samples within a short time frame. Samples are allowed to react with artificial substrates within 96-well microplates or deep well microplate blocks, and enzyme activity is subsequently determined by absorption or fluorescence of the resulting end product using a typical microplate reader or fluorometer. Such high throughput procedures not only facilitate comparisons between spatially separate sites or ecosystems, but also substantially reduce the cost of such assays by reducing overall reagent volumes needed per sample.

Microplate based procedures are described for the colorimetric or fluorometric analysis of extracellular enzyme activity. These procedures allow for the rapid assay of such activity in large numbers of environmental samples within a manageable time frame.

קביעת מיקרוביאלית התאית אנזים הפעילות במים, קרקעות, ומשקעים באמצעות מבחני Microplate תפוקה גבוהה

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist&#160;of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (&#181;PADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the &#181;PAD. Alternatively, digital images of the reacted &#181;PADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24&#160;hr), justifying its use as an initial screening method for the microbiological quality of agricultural water.

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

A protocol involving integrated concentration, enrichment, and end-point colorimetric detection of foodborne pathogens in large volumes of agricultural water is presented here. Water is filtered through Modified Moore Swabs (MMS), enriched with selective or non-selective media, and detection is performed using paper-based analytical devices (&#181;PAD) imbedded with bacterial-indicative colorimetric substrates.

מבוסס נייר Colorimetric איתור של<em&gt; חיידקי Escherichia</em&gt;,<em&gt; סלמונלה</em&gt; Spp., ו<em&gt; חיידקי ליסטריה</em&gt; מכמויות גדולות של מים לחקלאות

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with &#39;end-point&#39; PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. The methodology includes the co-extraction of DNA and RNA; preparation of DNA-free RNA; and 16S rRNA gene and transcript quantification via RT-q-PCR, including standard curve construction.

הפקת DNA-RNA סימולטני החוף משקעים וכימות של 16S rRNA גנים תעתיקי ידי בזמן אמת PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination control. Developments of some techniques aiming to reduce trace metal contamination in the last couple of decades have resulted in concentrations reported now being orders of magnitude lower than those in the past. These low concentrations often necessitate preconcentration of water samples prior to instrumental analysis of samples. Since contamination can appear in all phases of trace metal analyses, including sample collection (and during preparation of sampling containers), storage and handling, pretreatments, and instrumental analysis, specific care needs to be taken in order to reduce contamination levels at all steps. The effort to develop and utilize "clean techniques" in trace metal studies allows scientists to investigate trace metal distributions and chemical and biological behavior in greater details. This advancement also provides the required accuracy and precision of trace metal data allowing for environmental conditions to be related to trace metal concentrations in aquatic environments.
This protocol that is presented here details needed materials for sample preparation, sample collection, sample pretreatment including preconcentration, and instrumental analysis. By reducing contamination throughout all phases mentioned above for trace metal analysis, much lower detection limits and thus accuracy can be achieved. The effectiveness of "clean techniques" is further demonstrated using low field blanks and good recoveries for standard reference material. The data quality that can be obtained thus enables the assessment of trace metal distributions and their relationships to environmental parameters.

Special care using "clean techniques" is required to properly collect and process water samples for trace metal studies in aquatic environments. A protocol for sampling, processing, and analytical procedures with the aim of obtaining reliable environmental monitoring data and results with high sensitivity for detailed trace metal studies is presented.

נקי דיגום ואנליזה של נהר ושפכי הנהרות ווטרס ללימודי מתכת עקבות

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of scientific publications address microplastic pollution of the sea surface. The protocol below describes the methodology for sampling, sample preparation, separation and chemical identification of microplastic particles. A manta net fixed on an &#187;A frame&#171; attached to the side of the vessel was used for sampling. Microplastic particles caught in the cod end of the net were separated from samples by visual identification and use of stereomicroscopes. Particles were analyzed for their size using an image analysis program and for their chemical structure using ATR-FTIR and micro FTIR spectroscopy. The described protocol is in line with recommendations for microplastics monitoring published by the Marine Strategy Framework Directive (MSFD) Technical Subgroup on Marine Litter. This written protocol with video guide will support the work of researchers that deal with microplastics monitoring all over the world.

The protocol below describes the methodology for: microplastics sampling on the sea surface, separation of microplastic and chemical identification of particles. This protocol is in line with the recommendations for microplastics monitoring published by the MSFD Technical Subgroup on Marine Litter.

פרוטוקול עבור דגימת חלקיקים על פני הים וניתוח לדוגמא

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment during manufacturing and transport. Because of their environmental persistence, they are widely distributed in the oceans and on beaches all over the world. They can act as a vector of potentially toxic organic compounds (e.g., polychlorinated biphenyls) and might consequently negatively affect marine organisms. Their possible impacts along the food chain are not yet well understood. In order to assess the hazards associated with the occurrence of plastic pellets in the marine environment, it is necessary to develop methodologies that allow for rapid determination of associated organic contaminant levels. The present protocol describes the different steps required for sampling resin pellets, analyzing adsorbed organochlorine pesticides (OCPs) and identifying the plastic type. The focus is on the extraction of OCPs from plastic pellets by means of a pressurized fluid extractor (PFE) and on the polymer chemical analysis applying Fourier Transform-InfraRed (FT-IR) spectroscopy. The developed methodology focuses on 11 OCPs and related compounds, including dichlorodiphenyltrichloroethane (DDT) and its two main metabolites, lindane and two production isomers, as well as the two biologically active isomers of technical endosulfan. This protocol constitutes a simple and rapid alternative to existing methodology for evaluating the concentration of organic contaminants adsorbed on plastic pieces.

Microplastics act as vector of potentially toxic organic contaminants with unpredictable effects. This protocol describes an alternative methodology for assessing the levels of organochlorine pesticides adsorbed on plastic pellets and identifying the polymer chemical structure. The focus is on pressurized fluid extraction and attenuated total reflectance Fourier transform infrared spectroscopy.

הפקת חומרי הדברה אורגנוכלורינים מפלסטיק וגלגול סוג פלסטיק

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf mottling, vein yellowing, defoliation, root decay, and ultimately, the death of the citrus plant. When infected, the citrus plants have stunted growth and produce flowers out of season. These flowers rarely yield fruit, and those that do yield small, bitter, irregularly shaped citrus fruit that are not desirable. This disease is spread by the Asian citrus psyllid, Diaphorina citri, and by the grafting of infected citrus tissue. The pathogen has a long and variable incubation period within the citrus plant&#8212;sometimes years, before symptoms appear. Attempts to culture this pathogen in vitro have been unsuccessful, possibly due to the low and uneven concentration of the pathogen within infected citrus tissue, or because it is difficult to replicate the environmental conditions conducive to growth of the pathogen. It is very difficult to identify the disease before it has spread, due to its long incubation period and researchers&#39; inability to culture the pathogen. As a result, the disease only becomes apparent after suddenly destroying a citrus farmer&#39;s entire yield. Presented here is a method for the accurate and specific detection of the citrus greening pathogen, Candidatus liberibacter spp. using a genomic DNA extraction kit and PCR. This method is simple, efficient, cost effective, and adaptable for quantitative analysis. This method can be adapted for use on any citrus tissue; however, it is potentially limited by the amount of pathogen present in the tissue. Nevertheless, this method will allow citrus farmers to identify infected citrus plants earlier, and curb the spread of this destructive disease before it can further spread.

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus Greening is a particularly destructive disease affecting citrus crops globally. Presented here is a simple method using PCR and genomic DNA extraction of citrus leaf tissue for the accurate and precise identification of the citrus greening pathogen, Candidatus liberibacter spp.

ספציפית, איתור מדויק של spp. הפתוגן ירוק הדרים Candidatus liberibacter באמצעות PCR המקובלת על דגימות רקמה עלה הדרים

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). Therefore, knowing the dispersal capacity may help inform trapping/tree removal efforts to prevent this disease more effectively. In this study, we measured the flight velocity and duration and estimated the flight distance of the beetle using a newly developed flight mill. The flight mill is low cost, small, and constructed using commonly available items. Both the flight mill arm and its vertical axis comprise a thin needle. A beetle specimen is glued to one tip of the arm using instant glue. The other tip is thick due to being covered with plastic, thus it facilitates the detection of rotations of the arm. The revolution of the arm is detected by a photo sensor mounted on an infrared LED, and is indicated by a change in the output voltage when the arm passed above the LED. The photo sensor is connected to a personal computer and the output voltage data are stored at a sampling rate of 1 kHz. By conducting experiments using this flight mill, we found that P. quercivorus can fly at least 27 km. Because our flight mill comprises cheap and small ordinary items, many flight mills can be prepared and used simultaneously in a small laboratory space. This enables experimenters to obtain a sufficient amount of data within a short period.

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

We developed a low cost and small flight mill, constructed with commonly available items and easily used in experimentation. Using this apparatus, we measured the flight ability of an ambrosia beetle, Platypus quercivorus.

מדידת היכולת טיסה של החיפושית אמברוזיה, ברווזן Quercivorus (Murayama), באמצעות בעלות נמוכה, קטנה, טיסה מתוכננת בקלות מיל

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, and the majority of extant heteropterans retain this trophic strategy. Some heteropterans have transitioned to feeding on vertebrate blood (such as the kissing bugs, Triatominae; and bed bugs, Cimicidae) while others have reverted to feeding on plants (most Pentatomomorpha). However, with the exception of saliva used by kissing bugs to facilitate blood-feeding, little is known about heteropteran venoms compared to the venoms of spiders, scorpions and snakes.
One obstacle to the characterization of heteropteran venom toxins is the structure and function of the venom/labial glands, which are both morphologically complex and perform multiple biological roles (defense, prey capture, and extra-oral digestion). In this article, we describe three methods we have successfully used to collect heteropteran venoms. First, we present electrostimulation as a convenient way to collect venom that is often lethal when injected into prey animals, and which obviates contamination by glandular tissue. Second, we show that gentle harassment of animals is sufficient to produce venom extrusion from the proboscis and/or venom spitting in some groups of heteropterans. Third, we describe methods to harvest venom toxins by dissection of anaesthetized animals to obtain the venom glands. This method is complementary to other methods, as it may allow harvesting of toxins from taxa in which electrostimulation and harassment are ineffective. These protocols will enable researchers to harvest toxins from heteropteran insects for structure-function characterization and possible applications in medicine and agriculture.

Although many insects in the suborder Heteroptera (Insecta: Hemiptera) are venomous, their venom composition and the functions of their venom toxins are mostly unknown. This protocol describes methods to harvest heteropteran venoms for further characterization, using electrostimulation, harassment, and gland dissection.

קציר ארס מרעלים חרקים טורפים וחרקים אחרים Heteropteran

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and maintenance issues. On the contrary, the nematode Caenorhabditis elegans (C. elegans) has advantages to make it an ideal choice for toxicity testing: a short lifespan, easy cultivation, and efficient reproduction. Here, we describe a protocol for the automatic phenotypic profiling of C. elegans in a 384-well plate. The nematode worms are cultured in a 384-well plate with liquid medium and chemical treatment, and videos are taken of each well to quantify the chemical influence on 33 worm features. Experimental results demonstrate that the quantified phenotype features can classify and predict the acute toxicity for different chemical compounds and establish a priority list for further traditional chemical toxicity assessment tests in a rodent model.

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

A quantitative method has been developed to identify and predict the acute toxicity of chemicals by automatically analyzing the phenotypic profiling of Caenorhabditis elegans. This protocol describes how to treat worms with chemicals in a 384-well plate, capture videos, and quantify toxicological related phenotypes.

וזמינותו תפוקה גבוהה עבור חיזוי של רעילות כימית על ידי אוטומטית פרופילים פנוטיפי של Caenorhabditis elegans

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and ...