Bu çalışma Florida Uluslararası Üniversitesi Biyomedikal Mühendisliği Bölümü imkanları kullanılarak yapılmıştır.

1.. Elektrospinning Toplayıcı Kur <ol><li> Dikdörtgen bir parça halinde alüminyum folyo kesilir. </li><li> Dikdörtgen bir şerit içine dikdörtgen parça katlayın, ve bant ile düz metal plaka (Şekil 1) dik takın. Not: fiber mat boyutu, şeridin uzunluğu ve genişliğine bağlıdır. Gerektiğinde Bu nedenle, şerit boyutlar ayarlanabilir. </li></ol> 2.. Polimer çözeltisinden Preparasyon <ol><li> PGD ​​polimerin elde edilmesi için 100 saat boyunca 120 ° C de bir çanak içinde 1:1 mol oranında, gliserol ve dodekandioik asit (DDA) karıştırın. </li><li> Bir 15 ml tüp içinde 1.5:3:95.5 bir ağırlık oranında olan etanol içinde% 65 poli (etilen oksit) (PEO) ve jelatin çözülür, kapağını sıkmak ve karıştırma ile 1 saat boyunca 60 ° C&#39;de bir fırın içinde karışımın ısısının Bir homojen çözelti (Basal çözelti) kadar ısıtılır. </li><li> Elektrospinning için, PGD polimer ve 04:06 ağırlık oranında bazal solüsyon karıştırın. Not: PGT konsantrasyonunun bi varg lif çapına etkisi. % 30 -50 oranında% PGD daha artan lif çapları 5 cm&#39;den elyafların üretilmesi için kabul edilebilir. </li><li> Polimer çözeltisine% 0.1 riboflavin ekleyin ve iyice karıştırın. </li></ol> 3. Elektrospinning <ol><li> Bir 18 G ile bir 5 ml şırıngaya standart polimer çözeltisi Besleme paslanmaz çelik bir iğne köreltilmiş. </li><li> Bir şırınga pompası içine şırınga yerleştirin. </li><li> Metal plaka ve iğne için, pozitif yüklü kurşun için yüksek voltajlı güç kaynağının topraklı kurşun takın. </li><li> 15 cm İğne ve alüminyum folyo şeridi arasındaki mesafe ayarlayın. </li><li> Şeridin ön liflerin birarada toplanmasını önlemek üzere yatay ile yaklaşık 15 ° &#39;lik bir açıda şırınga pompası yerleştirin. </li><li> Şırınga pompası açın ve 0.6 ml / saat için pompa akış hızını ayarlayın. </li><li> Yüksek gerilim güç kaynağı açın ve 14.6 kV işletme gerilimi ayarlayın. </li></ol> 4.Fiber İşleme <ol><li> Toplama işlemi tamamlandıktan sonra, çapraz bağlama için 60 dakika boyunca UV ışığına maruz fiber mat. </li><li> Bir 100 mm Petri kabı alüminyum folyo şeritten elyaf mat transferi, ve sterilizasyon için 20 dakika için, UV ışığına maruz kalmaktadır. </li><li> Bir biyo-güvenlik kabini, bir cerrahi bıçak ile aynı büyüklükte yuvarlak parçalar halinde kesilmiş ve fiber mat, bir 24-yuvalı plaka içine parçaları yerleştirin. </li><li> Hücre ön tohum tedavisi için, fosfat tamponlu salin (PBS) içinde 1 ml fiber örnekleri bırakın ve gece boyunca 37 ° C&#39;de inkübe edin. </li><li> Ertesi gün, aspirat PBS dikkatli bir şekilde, her bir oyuğa (Malzemeler tabloda tarif bakınız) farklılaştırma ortamının 1 ml (DMEM/F12, N2 ve FGF2) ekleyin ve 3 saat boyunca 37 ° C&#39;de inkübe edin. </li><li> Aspire farklılaşma ortam dikkatlice, her elyaf numunesi için 0.2 ml Matrigel ekleyin ve 30 dakika boyunca 37 ° C&#39;de inkübe edin. Not: Laminin da elyaf kaplama için kullanılabilir. 20 ug / ml laminin 0.2 ml ilave edilirElyafa ve 3 saat boyunca oda sıcaklığında inkübe edin. </li><li> Dikkatle her kuyudan aşırı Matrigel kaldırın. Bir kez farklılaştırma ortamının 2 ml ile durulayın. Not: Elyaf örnekleri, hücre kültürü için hazırdır. </li></ol> Elyaf üzerinde 5. Hücre Serpilmesi <ol><li> MES hücre kültürü tabağına Accutase 1 ml ilave edilir ve 37 ° C&#39;de 10 dakika boyunca inkübe </li><li> 10 dakika sonra, MES hücreler kültür kaplarına ayrılır. Plakasına farklılaştırma ortamının 4 ml ekleyin. Koloniler (yaklaşık 15x) kırmak için yukarı ve aşağı bir 15 ml tüp ve pipet hücrelerin içine yüzen MES hücreleri toplamak. </li><li> Farklılaştırma ortamının 4 ml 5 dakika ve yeniden askıya hücreleri için 400 x g&#39;de santrifüjleyin. </li><li> Hemasitometre kullanarak hücreleri saymak. Bir 15 ml tüp içine hücre süspansiyonu 200 ul ve farklılaşma transfer ortam maddesi ile o 10x seyreltin. Yerine bir kapak-slip ile hemasitometre üzerinde bir bölmeye seyreltilmiş hücre süspansiyonu 15 ul aktarın. Saymak1 mm merkez meydanı ve mikroskop altında hemasitometre dört köşe kareler hücreler. Not: ml seyreltme faktörü x 10 4 x kare başına ortalama sayısı = Hücre başına </li><li> Her bir kuyunun üzerine yaklaşık 5 x 10 4 MES hücreleri yerleştirin. Yavaş yavaş lifli keçe kapalı boşalmasını önlemek için bir çözüm yerine, kuyunun tarafına kapalı kayma, elyaf numunelerinin üzerine orta hücre süspansiyonu bırakın. </li><li> Her bir oyuğa farklılaştırma ortamının 1 ml ilave edilir, ve 37 ° C&#39;de bir inkübatör içinde tutmak ve plaka% 5 CO2 hücreleri bağlanma, büyümesini ve farklılaşmasını sağlamak için. </li><li> Her bir oyuktan aspire edin ve eski orta her gün taze farklılaştırma ortamının 1 ml&#39;si ile değiştirin. </li></ol> 6.. Hücre Canlılık <ol><li> Her kuyudan aspire eski orta. </li><li> Kültür ortamı ile Resazurin floresan reaktifi 1/10 hacim th karıştırın ve de her biri 1 ml. </li><li> Inkubasyon37 ° C ve direkt ışıktan korunan 4 saat için% 5 CO2 yedi. </li><li> 4 saat sonra, 96 oyuklu bir plakaya her bir ikinci reaktifi 100 ul 3x transferi ve daha sonra numuneler 560EX nm/590EM filtre ayarları kullanarak bir floresan spektrofotometre üzerinde ölçüldü hazırdır. </li></ol> 7. Real Time PCR <ol><li> Kültür 14 gün sonra, numunelere lizis tampon eklemek ve elyaf numuneleri üzerinde hücrelerden toplam RNA&#39;nın izole edilmesi. </li><li> Ters transkripsiyon ile 20 ul reaksiyon ölçeklerde cDNA&#39;yı sentezlemek için toplam RNA 4 ul kullanın. </li><li> 10 ul ana karışım (2x), 0.2 ul boya, 8 ul nükleaz içermeyen su, 1 ul cDNA, 1 ul primer (Bu çalışmada kullanılan primerler Tablo 1 &#39;de listelenmiştir): her bir optik tüp içinde PCR reaksiyon karışımı hazırlandı. </li><li> Bir: PCR programı kurmak. 95 ° C 2:20 min, 1 döngüsü b. 95 ° C 3 sn → 60 ° C 1 dakika, 40 döngü, c. 95 ° C 15 sn, 1 döngüsü d. 60 ° C 1dak, 1 döngü e. 95 ° C 15 saniye, 1 döngü. Göreceli gen ekspresyon düzeylerinin karşılaştırmalı C T yöntemi seçin. </li><li> PCR tamamlandıktan sonra, StepOne yazılımı ile gerçek-zamanlı PCR sonuçlarını analiz ve Excel sonuçları ihracat. </li></ol>

<ol>
	<li>Migneco, F., Huang, Y. -. C., Birla, R. K., Hollister, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly+(glycerol-dodecanoate),+a+biodegradable+polyester+for+medical+devices+and+tissue+engineering+scaffolds.">Poly (glycerol-dodecanoate), a biodegradable polyester for medical devices and tissue engineering scaffolds.</a> Biomaterials. 30, 6479-6484 (2009).</li><li>Reneker, D. H., Yarin, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospinning+jets+and+polymer+nanofibers.">Electrospinning jets and polymer nanofibers.</a> Polymer. 49, 2387-2425 (2008).</li><li>Wang, Y., Ameer, G. A., Sheppard, B. J., Langer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tough+biodegradable+elastomer.">A tough biodegradable elastomer.</a> Nature biotechnology. 20, 602-606 (2002).</li><li>Panunzi, S., De Gaetano, A., Mingrone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approximate+linear+confidence+and+curvature+of+a+kinetic+model+of+dodecanedioic+acid+in+humans.">Approximate linear confidence and curvature of a kinetic model of dodecanedioic acid in humans.</a> American Journal of Physiology-Endocrinology And Metabolism. 289, (2005).</li><li>Park, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Apparatus+for+preparing+electrospun+nanofibers:+designing+an+electrospinning+process+for+nanofiber+fabrication.">Apparatus for preparing electrospun nanofibers: designing an electrospinning process for nanofiber fabrication.</a> Polymer Internationa l. 56, 1361-1366 (2007).</li><li>Barnes, C. P., Sell, S. A., Boland, E. D., Simpson, D. G., Bowlin, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanofiber+technology:+designing+the+next+generation+of+tissue+engineering+scaffolds.">Nanofiber technology: designing the next generation of tissue engineering scaffolds.</a> Advanced drug delivery reviews. 59, 1413-1433 (2007).</li><li>Li, W. -. J., Mauck, R. L., Tuan, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospun+nanofibrous+scaffolds:+production,+characterization,+and+applications+for+tissue+engineering+and+drug+delivery.">Electrospun nanofibrous scaffolds: production, characterization, and applications for tissue engineering and drug delivery.</a> Journal of Biomedical Nanotechnology. 1, 259-275 (2005).</li><li>Pham, Q. P., Sharma, U., Mikos, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospinning+of+polymeric+nanofibers+for+tissue+engineering+applications:+a+review.">Electrospinning of polymeric nanofibers for tissue engineering applications: a review.</a> Tissue engineering. 12, 1197-1211 (2006).</li><li>Lim, S. H., Mao, H. -. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrospun+scaffolds+for+stem+cell+engineering.">Electrospun scaffolds for stem cell engineering.</a> Advanced drug delivery reviews. 61, 1084-1096 (2009).</li><li>Lowery, J. L., Datta, N., Rutledge, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+fiber+diameter,+pore+size+and+seeding+method+on+growth+of+human+dermal+fibroblasts+in+electrospun+poly+(epsilon-caprolactone)+fibrous+mats.">Effect of fiber diameter, pore size and seeding method on growth of human dermal fibroblasts in electrospun poly (epsilon-caprolactone) fibrous mats.</a> Biomaterials. 31, 491-504 (2010).</li><li>Tillman, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+in+vivo+stability+of+electrospun+polycaprolactone-collagen+scaffolds+in+vascular+reconstruction.">The in vivo stability of electrospun polycaprolactone-collagen scaffolds in vascular reconstruction.</a> Biomaterials. 30, 583-588 (2009).</li><li>Ju, Y. M., Choi, J. S., Atala, A., Yoo, J. J., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bilayered+scaffold+for+engineering+cellularized+blood+vessels.">Bilayered scaffold for engineering cellularized blood vessels.</a> Biomaterials. 31, 4313-4321 (2010).</li><li>McCullen, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+collagen+polymerization+of+layered+cell-seeded+electrospun+scaffolds+for+bone+tissue+engineering+applications.">In situ collagen polymerization of layered cell-seeded electrospun scaffolds for bone tissue engineering applications.</a> Tissue Engineering Part C: Methods. 16, 1095-1105 (2010).</li></ol>

Çıkar çatışması ilan etti.

Basit koleksiyoncular veya şu anda bazı uygulamalar için istenilen uzunluğa ve fiber mat boyutunu elde kısıtlamayı arttırır elektroeğirme için kullanılan toplayıcıları dönen karmaşıklığı sınırlamalar. Buna ek olarak, kültür çanağı ya da başka alt-tabakalar için, zemin toplayıcı elyafların aktarımı bir meydan okuma 5&#39;tir. Bu raporda, topraklı toplayıcı bir alüminyum folyo şeridi takılarak sadece yapılan yeni tasarlanmış koleksiyoncu, bir defada 20 cm 10 cm büyük boy fiber paspaslar kadar almayı başardı. 1. ve 2. tasarlanan şematik olarak göstermektedir kurulum 10 cm kontrollü mat genişliği ile uzun electrospun lifler kadar imalatı için. Iğne ucu ve toplayıcı arasındaki elektrostatik alan tarafından etkilenen, electrospun lifler kolayca başka s aktarılabilir düzgün bir fiber mat, oluşturmak için alüminyum folyo şerit ve topraklanmış toplayıcı arasındaki alanı boyunca gerilmiştirubstrate. Electrospun elyaf hücrelerinin köprü ve gerçek bir üç-boyutlu bir ortamda çok sayıda liflere eklemek için izin gözenekli lifli yapılar temin etmektedir. Bu çalışmada üretilen fiber matlar onları bu yara iyileşmesi ve sinir yenilenmesi gibi geniş bir uygulama yelpazesi için ideal bir aday yapmak için yeterince büyüktür. Elyaf çapı, elektro prosedüründe çeşitli değişkenlerin kontrol ile ayarlanabilir. Bu değişkenler, polimer konsantrasyonu, uygulanan voltajın büyüklüğüne, polimer dağıtım hızı, toplayıcıya iğneden aralıkları, vb 6-8 içerir. Bu çalışmada,% 50 ve% 50, PGD BS,% 40 ve% 60, PGD BS,% 30 ve% 70, PGD BS, ve% 20, PGD ve sırasıyla% 80 BS ile oluşan olan test çözeltiler, için hazırlanmıştır electrospun liflerin imalatı. Elyaflı iskeleleri elyafların çapları ve morfolojileri (Şekil 3) belirlemek için SEM ile incelendi. Beklendiği gibi, daha yüksek konsantrasyonlar p PGDelectrospun liflerin daha büyük çapları roduced. Ayrıca, farklı konsantrasyonlarda PGD göre olan şerit uzunluğunu ayarlamak için çok önemlidir. Bir alt PGT konsantrasyon lifleri oluşumunu sağlamak için kısa bir şerit uzunluğu gerektirir. Sayısız çalışmalar hücre kültürü 9-13 çalışma ile electrospun lifli iskelelerinin biyouyumluluk keşfetmek için yapılmıştır. Güçlü yeşil floresan sinyalleri ile bağlı hücreler, PGD lifler üzerindeki hücre yaşamını belirtilen bu Şekil 4 deki konfokal mikroskopi görüntüler. Buna ek olarak, günde 3 ila 6 gün artan hücre yoğunluğu da PGD lifler üzerindeki hücre çoğalmasını önerdi. Şekil 5&#39;de hücre canlılığı testi de bu sonucu teyit etmiştir. Sinir hücresi işaretleri MAP2&#39;nin ve DCX ve gen ekspresyon MES hücreleri (Şekil 6) iskelelerde sinir hücrelerine ayırt etmek mümkün olduğunu göstermiştir. Sonuç olarak, PGD lifli iskeleleri hücre adhesio destek olabilirn ve proliferasyonu, ve böylece nöral doku mühendisliği uygulamaları için potansiyel gösterir. İşte bazı genel sorun giderme kurallar şunlardır: iğne çıkan lif süreksiz ise, yine polimerik çözümü ısınmak ve iyice karıştırın veya elyaf metal plaka yok cazibe ile alüminyum folyo şerit yapışmasını ise, şerit azaltmak uzunluk veya PGD konsantrasyonu artar. Bazen büyük polimer Neználkovo iğne ucunda oluşturan, yüksek gerilim güç kaynağını kapatın, bir kağıt havlu ile silin, ve pompa teslim oranını azaltmak. Buna ek olarak, alüminyum folyo şeridin üst kenarı üzerine bazen elyaflar toplam şırınga pompası açısını ayarlamak deneyin.

Elektrospinning mikro-to-nanometre boyutlu yapı iskelesi fiber üretmek için etkili bir işlem yöntemlerden biridir. Elektrospinning temel prensibi iğnenin ucu ve bir kolektörü topraklanmış arasında yüksek voltaj uygulayarak bir iğne deliğinin tutulduğu bir solüsyon Taylor koni içerir. Çözelti içindeki elektrostatik itme yüzey gerilimini aştığında, yüklü bir sıvı jet iğne ucu dışarı atılır, çözücü buharlaştırma ile havada hareket ve son olarak topraklı toplayıcı üzerine yatırılır. Şırınga pompası, püskürtme memesinden çıkan sürekli bir solüsyon akışı sağlar ve electrospun elyafların bu şekilde birden fazla kopyası kısa bir süre içinde imal edilebilir. Toplayıcı varmak için meme çıkış seyri sırasında yüklü jet polimer çözeltisinin viskozite ve yüzey gerilimi içerir parametreleri, electrostati bir dizi uygun olarak uzanan ve çırpma uğrayacakc çözelti içinde kuvvet ve dış elektrik alanının etkileşimi, vb 2.. Elektro işleminde, toplayıcı mikro-to-nanometre lifler biriktirilen bir iletken alt-tabaka olarak hizmet eder. Bu çalışmada, fiber toplayıcı yeni bir tür arzu edilen boyutu (uzunluk x genişlik) olan bir lif elde etmek için paspaslar tasarlanmıştır. Geleneksel olarak, alüminyum folyo, bir toplayıcı olarak kullanılan ama başka bir alt-tabaka için, düz bir yüzeye lifleri transfer etmek güçtür. Geleneksel toplayıcı sağlam bir fiber mat hasat zorluğu nedeniyle electrospun lifler toplayıcı yüzeyine güçlü bir şekilde bağlamak olmasından kaynaklanmaktadır. Bu nedenle, dikdörtgen bir şerit halinde bir alüminyum folyo parçası katlanır ve düz metal plakasına dikey takarak toplayıcı değiştirilebilir. Electrospun lifler şeridin ucu ve kolay bir substratı transfer edilebilir metal plaka arasındaki alanı boyunca gerilire. Termal çapraz elastomerik polimerlerde ilgi hızla çünkü poli (gliserol sebasat) (PGS), 2002 3 vulkanize kauçuk benzer. PGS benzer bir polyester tanıttı Robert Langer grubunun öncü çalışmalar büyüyen, başarıyla geliştirdik edilir poli (gliserol-dodekanoat) (PGD) gliserol ve dodekandioik asitin termal yoğunlaşması ile ve eşsiz şekil hafıza özelliğine 1. gösterdi. Sert sentetik malzemeler, poli (hidroksi bütirat) ya da poli (L-laktid) (sırasıyla, 250 Mpa ve 660 MPa arasında Young modülleri) farklı olarak, PGD, sıcaklık 37 ° üzerinde 1.08 MPa arasında bir Young modülüne sahip, kauçuk gibi elastomer cinsi bir özellik arzetmektedir in-situ periferik sinir (0.45 MPa) yakın bir maç olduğunu C,. Ek olarak, PGD biyolojik olarak parçalanabilir ve bozunma süresi gliserol ve dodekandioik asit oranının değiştirilmesiyle ince ayarlı olabilir. Dodekandioik asit oniki-karbon subiki terminal karboksilik gruplar, HOOC (CH2) 10 COOH ile duruş. Sebasik asit ve dodekandioik asit gibi dikarbonik asitler, çift sayılı bir asetil CoA-ve trikarboksilik asit (TCA) / (sitrik asit) döngüsü girmek için metabolize edilebilir. Dikarboksilik asitlerin metabolik ürünü, süksinil-CoA, bir ön-madde gluconeogenetic ve TCA döngüsü 4 arasında bir ara üründür. Bu nedenle, bazı çalışmalar özellikle patolojik koşullarda enteral ve parenteral beslenme için bir alternatif yakıt alt-tabaka olarak kullanılabilir önerdi. Cam geçiş sıcaklığı 31 ° C olduğu için ek olarak, PGD, böylece oda ısısında ve vücut ısısında farklı mekanik özelliklerini göstermektedir, benzersiz şekil bellek sergiler. Sonuç olarak, PGD sinir dokuları benzer mekanik özelliklere sahip eşsiz bir elastik özellikleri sergileyen, biyo-bozunabilir ve biyo-uyumlu; Bu nedenle, bu sinir doku mühendisliği uygulamaları için uygun bir malzemedir. Bu protokolde, electrospunbüyük bir mevduat alanı kapsayan uzun elyaf PGD gelen yeni tasarlanmış toplayıcı ile imal edilmiştir. Lif iskeleleri fare pluripotent kök hücreler büyüme ve farklılaşma destekleyebilir.

<table border="0" cellpadding="0" cellspacing="0" width="729">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Glycerol</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">G7757</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Dodecanedioic acid</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">D1009</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Gelatin</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">D1890</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Poly (ehtylene oxide) (PEO)</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">182028</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Riboflavin</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">132350250</td>
			<td style="width:167px;">0.10%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Mouse embryonic stem cells</td>
			<td style="width:175px;">GlobalStem</td>
			<td style="width:119px;">GSC-5002</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Matrigel</td>
			<td style="width:175px;">Becton Dickinson</td>
			<td style="width:119px;">356234</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">DMEM/F12</td>
			<td style="width:175px;">Thermo Scientific</td>
			<td style="width:119px;">SH30272.02</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">N2 supplement&#160;</td>
			<td style="width:175px;">Invitrogen</td>
			<td style="width:119px;">17502048</td>
			<td style="width:167px;">1%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">FGF2</td>
			<td style="width:175px;">Stemgent</td>
			<td style="width:119px;">03-0002</td>
			<td style="width:167px;">10ng/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Accutase</td>
			<td style="width:175px;">Invitrogen</td>
			<td style="width:119px;">A11105-01</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Phosphate buffered saline (PBS)</td>
			<td style="width:175px;">Invitrogen</td>
			<td style="width:119px;">10010-031&#160;</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Resazurin fluorescence dye&#160;</td>
			<td style="width:175px;">Sigma-Aldrich</td>
			<td style="width:119px;">62758-13-8&#160;</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">SV Total RNA Isolation System</td>
			<td style="width:175px;">Promega</td>
			<td style="width:119px;">Z3100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">GoScript Reverse Transcription System</td>
			<td style="width:175px;">Promega</td>
			<td style="width:119px;">A5000</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">GoTaq&#129; qPCR Master Mix</td>
			<td style="width:175px;">Promega</td>
			<td style="width:119px;">A6001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Syringe pump&#160;</td>
			<td style="width:175px;">Fisher scientific</td>
			<td style="width:119px;">14-831-200</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:268px;">High voltage power source&#160;</td>
			<td style="width:175px;">Spellman High Voltage Electronics Corporation</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">SL30</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">UV light</td>
			<td style="width:175px;">Philips</td>
			<td style="width:119px;">308643</td>
			<td style="width:167px;">15W/G15T8</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Synergy HT Multi-Mode Microplate Reader</td>
			<td style="width:175px;">BioTek</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">Perkin Elmer GeneAmp PCR System 9600</td>
			<td style="width:175px;">Perkin Elmer</td>
			<td style="width:119px;">8488</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:268px;">StepOne Real-time PCR System</td>
			<td style="width:175px;">Applied Biosystems</td>
			<td style="width:119px;">4376357</td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

electrospun fibrous scaffolds of poly(glycerol-dodecanedioate) for engineering neural tissues from mouse embryonic stem cells

Doku mühendisliği uygulamaları için, biyo-bozunabilir ve biyo-uyumlu iskeleleri hazırlanması en çok arzu edilen, ancak zor bir iştir. Çeşitli üretim yöntemleri arasında elektro sadeliği ve çok yönlülüğü dolayı en ilgi çekici biridir. Buna ek olarak, electrospun nanolifler hücre hayatta kalması ve büyümesi için ek destek sağlanması doğal hücre-dışı matrisin boyutu taklit. Bu çalışma Elektrospinning için, yeni tasarlanmış toplayıcı kullanılarak poli (gliserol-dodekanoat) adlı yeni bir biyo-bozunabilir ve biyo-uyumlu polimer için daha büyük bir alan depozito (PGD) 1 yayılan uzun liflerin üretim canlılığı gösterdi. PGD ​​böylece sinir doku mühendisliği uygulamaları için uygun olan, sinir dokularının benzer mekanik özelliklere sahip eşsiz bir elastik özellikleri sergiler. Lifli iskele malzemeleri yapmak için sentez ve üretim set-up, basit ve yüksek tekrarlanabilir ve ucuz. Biyouyumluluktakitest, fare embriyonik kök hücrelerinden elde edilen hücreler uygun ve electrospun PGD lifleri üzerinde artabilir. Özet olarak, bu protokol, fare embriyonik kök hücre kaynaklı sinir soy hücrelerinin gelişimini desteklemek için PGD electrospun liflerin imalatı için çok yönlü bir üretim yöntemi sağlanmaktadır.

Elektrospinning en önemli bileşenleri, Şekil 1 &#39;de gösterilmiştir. Bir büyük boyutlu elyaf mat, genellikle dikey olarak bağlanmış alüminyum folyo şerit ve metal bir plaka elde edilmiştir. Şekil 2, bu kollektör tasarım ve elektro Fiber mat gösterir. Genişliği ve uzunluğu, farklı uygulamalar için ayarlanabilir. PGD ​​polimer ve bazal solüsyon karışımı ile yapılan elyafın uzunluğu 10 cm&#39;dir. Electrospun Elyafların morfolojisi, Şekil 3 &#39;de gösterilmiştir.% 40 PGD konsantrasyon yapılmış elyafların çapları mikrometre aralığındadır. Lifleri üzerinde 3 ve 6 gün için kültürlenmiş hücrelerden türetilen MES farklılaşmış hücreler mikroskopla görsel, Şekil 4 &#39;de gösterilmiştir. Yeşil floresan sinyalleri hücrelerde yeşil floresan protein (GFP) en fazla sentezlenme geldi. Şekil 5&#39;de Resazurin floresan reajanı sonucu MES hücrelerin büyümesine gösterdin Matrigel ve laminin ile PGD lifler kaplama üzerinde eşdeğer hücre canlılığı vardı ve kaplanmamış grubu ile karşılaştırıldığında nispeten daha yüksek bir proliferasyon vardı. Pluripotency ve sinir hücrelerinin belirteçlerinin gen ekspresyonu (Şekil 6), gerçek zamanlı PCR ile belirlenmiştir. Hücrelerin azınlık nöral kök hücre Pax6 ve Nestin işaretleri ifade ederken lifleri üzerinde kültüre MES hücrelerin çoğunluğu Pluripotency belirteçler Oct4, Nanog ve Sox2 dile getirdi. 2 hafta kültürden sonra, lifler üzerinde yetiştirilen MES artış gibi MAP2 ve DCX gibi sinir hücresi bakışı ekspresyon seviyelerini, hem de oligodendrosit işaretleyici Oligo1 ve astrosit işaretleyici GFAP gösterdi. <img alt="Şekil 1" fo:content-width="5in" src="/files/ftp_upload/51587/51587fig1highres.jpg" width="500" /> Şekil 1.. Kurmak elektrospinning. Polimerik çözelti Köreldiğini iğne çıkarılır. Bir yüksek gerilim güç kaynağı gerekçesiyle bir düz metal plakand bir alüminyum folyo şerit aralarında mikro-to-nano metre lifler (mavi) yatırılır. <img alt="Şekil 2," fo:content-width="4in" src="/files/ftp_upload/51587/51587fig2highres.jpg" width="400" /> Şekil 2,. Toplayıcı tasarımı ve electrospun fiber mat. Fiber mat genişliği ve uzunluğu kolayca alüminyum folyo şeridin boyutu ayarlayarak değiştirilebilir. Orada mat genişliği için hiçbir sınırı yoktur ve uzun elyaflar, 10 cm uzunluğunda olabilir. <img alt="Şekil 3," fo:content-width="5in" src="/files/ftp_upload/51587/51587fig3highres.jpg" width="500" /> PGD ​​electrospun ve bazal çözeltisinin 04:06 Şekil 3.. SEM görüntüleri (a / a). Elyafların ortalama çapı yaklaşık 2 mm. PGD ​​konsantrasyonu% 30 azaldığında, elyafların ortalama çapı nanometre aralığı içine düşmektedir. BeyazÖlçek çubuğu 10 mm temsil eder. <img alt="Şekil 4," fo:content-width="4in" src="/files/ftp_upload/51587/51587fig4highres.jpg" width="400" /> Şekil 4,. Lifler üzerinde farklılaşmış MES hücre Konfokal mikroskopi ve görüntüler. Ultraviyole aralığındaki mavi ışığa maruz kaldığında GFP parlak yeşil floresan gösterirler taşıyan hücreleri. 6. günde, yeşil floresan hücrelerinin artan sayıda fiber iskeleleri hücre yapışmasını ve çoğalmasını destekleyebilir gösterir. Beyaz ölçek çubuğu 100 mikron temsil eder. (3. gün ve günde 6). <img alt="Şekil 5," fo:content-width="6in" src="/files/ftp_upload/51587/51587fig5highres.jpg" width="500" /> Şekil 5,. PGD 1 de Matrigel ve laminin ile kaplandıktan elyaf, 3 ve 5 gün MES hücrelerinin hücre canlılığı Resazurin fluore ile belirlenenscence reaktif. edilen hücreler kontrol (p &lt;0.05) olarak kullanılan kaplanmamış lifler üzerinde kültürlenmiştir. <img alt="Şekil 6," fo:content-width="6in" src="/files/ftp_upload/51587/51587fig6highres.jpg" width="500" /> Şekil 6,. PGD lifler üzerinde farklılaşmış MES hücrelerinde gen ekspresyonunun QRT-PCR analizi. 2 hafta sonra belirgin bir nöral hücre işaretleyicileri iskeleler üzerine MES hücrelerin nöral hücrelerin farklılaşmasını olduğunu gösterdi. <table border="0" cellpadding="0" cellspacing="0" width="261"><tbody><tr><td> mGAPDH-L </td><td> AACTTTGGCATTGTGGAAGG </td></tr><tr><td> mGAPDH-R </td><td> ACACATTGGGGGTAGGAACA </td></tr><tr><td> mOct4-L </td><td> CACGAGTGGAAAGCAACTCA </td></tr><tr><td> mOct4-R </td><td> AGATGGTGGTCTGGCTGAAC </td></tr><tr><td> mNanog-L </td><td> AAGTACCTCAGCCTCCAGCA </td></tr><tr><td> mNanog-R </td><td> GTGCTGAGCCCTTCTGAATC </td><html></tr><tr><td> mSox2-L </td><td> CACAGTTCAGCCCTGAGTGA </td></tr><tr><td> mSox2-R </td><td> AGGCCACAACAACAACAACA </td></tr><tr><td> mPax6-L </td><td> AACAACCTGCCTATGCAACC </td></tr><tr><td> mPax6-R </td><td> ACTTGGACGGGAACTGACAC </td></tr><tr><td> mNestin-L </td><td> CCAGAGCTGGACTGGAACTC </td></tr><tr><td> mNestin-R </td><td> ACCTGCCTCTTTTGGTTCCT </td></tr><tr><td> mMAP2-L </td><td> CTTATGGGAATGTGGGATGG </td></tr><tr><td> mMAP2-R </td><td> AAAAAGTGGGCCTTGGAACT </td></tr><tr><td> mDCX-L </td><td> ATGCAGTTGTCCCTCCATTC </td></tr><tr><td> mDCX-R </td><td> ATGCCACCAAGTTGTCATCA </td></tr><tr><td> mOligo1-L </td><td> CTTGCTCTCTCCAGCCAAAC </td></tr><tr><td> mOligo1-R </td><td> GCGAGCCTGAAAAACAGAAC </td></tr><tr><td> mGFAP-L </td><td> CACGAACGAGTCCCTAGAGC </td></tr><tr><td> mGFAP-R </td><td> ATGGTGATGCGGTTTTCTTC </td></tr></tbody></table>ontent &quot;&gt; Tablo 1. PCR primerleri listesi.

Watch this Scientific Journal Video about Electrospun Fibrous Scaffolds of Polyglycerol-dodecanedioate for Engineering Neural Tissues From Mouse Embryonic Stem Cells at JoVE.com

Electrospun Fibrous Scaffolds of Polyglycerol-dodecanedioate for Engineering Neural Tissues From Mouse Embryonic Stem Cells

Poli (gliserol-dodekanoat) adında yeni bir biyolojik polimerden bir yeni tasarlanmış toplayıcı aracılığıyla daha geniş bir alanı kapsayan mevduat electrospun uzun liflerin (PGD) Sentezi ve fabrikasyon bildirildi. Lifler fare pluripotent kök hücrelerinden türetilen hücrelerin büyümesini desteklemek mümkün.

Fare Embriyonik kök hücrelerden Mühendislik Sinir Dokular için Poli electrospun fibröz iskeleleri (gliserol-dodecanedioate)

For tissue engineering applications, the preparation of biodegradable and biocompatible scaffolds is the most desirable but challenging task. &#160;Among ...

electrospun-fibrous-scaffolds-poly-glycerol-dodecanedioate-for

Nanyang Technological University

Research

JoVE Journal

Bioengineering

Electrospun Fibrous Scaffolds of Poly(glycerol-dodecanedioate) for Engineering Neural Tissues From Mouse Embryonic Stem Cells

10.8K Görüntüleme.  Florida International University.  Poli (gliserol-dodekanoat) adında yeni bir biyolojik polimerden bir yeni tasarlanmış toplayıcı aracılığıyla daha geniş bir alanı kapsayan mevduat electrospun uzun liflerin (PGD) Sentezi ve fabrikasyon bildirildi. Lifler fare pluripotent kök hücrelerinden türetilen hücrelerin büyümesini desteklemek mümkün. 

Video: Electrospun Fibrous Scaffolds of Polyglycerol-dodecanedioate for Engineering Neural Tissues From Mouse Embryonic Stem Cells

Elastomeric PGS Scaffolds in Arterial Tissue Engineering

Cardiovascular disease is one of the leading cause of mortality in the US and especially, coronary artery disease increases with an aging population and increasing obesity1. Currently, bypass surgery using autologous vessels, allografts, and synthetic grafts are known as a commonly used for arterial substitutes2. However, these grafts have limited applications when an inner diameter of arteries is less than 6 mm due to low availability, thrombotic complications, compliance mismatch, and late intimal hyperplasia3,4. To overcome these limitations, tissue engineering has been successfully applied as a promising alternative to develop small-diameter arterial constructs that are nonthrombogenic, robust, and compliant. Several previous studies have developed small-diameter arterial constructs with tri-lamellar structure, excellent mechanical properties and burst pressure comparable to native arteries5,6. While high tensile strength and burst pressure by increasing collagen production from a rigid material or cell sheet scaffold, these constructs still had low elastin production and compliance, which is a major problem to cause graft failure after implantation. Considering these issues, we hypothesized that an elastometric biomaterial combined with mechanical conditioning would provide elasticity and conduct mechanical signals more efficiently to vascular cells, which increase extracellular matrix production and support cellular orientation.
The objective of this report is to introduce a fabrication technique of porous tubular scaffolds and a dynamic mechanical conditioning for applying them to arterial tissue engineering. We used a biodegradable elastomer, poly (glycerol sebacate) (PGS)7 for fabricating porous tubular scaffolds from the salt fusion method. Adult primary baboon smooth muscle cells (SMCs) were seeded on the lumen of scaffolds, which cultured in our designed pulsatile flow bioreactor for 3 weeks. PGS scaffolds had consistent thickness and randomly distributed macro- and micro-pores. Mechanical conditioning from pulsatile flow bioreactor supported SMC orientation and enhanced ECM production in scaffolds. These results suggest that elastomeric scaffolds and mechanical conditioning of bioreactor culture may be a promising method for arterial tissue engineering.

Elastomeric PGS scaffolds with vascular smooth muscle cells cultured in a pulsatile flow bioreactor may lead to promising small-diameter arterial constructs with native ECM production in a relatively short culture period.

Elastomerik PGS Arter Doku Mühendisliği Yapı iskeleleri

Cardiovascular disease is one of the leading cause of mortality in the US and especially, coronary artery disease increases with an aging population and ...

Biyomühendislik

Preparation of 3D Fibrin Scaffolds for Stem Cell Culture Applications

Stem cells are found in naturally occurring 3D microenvironments in vivo, which are often referred to as the stem cell niche 1. Culturing stem cells inside of 3D biomaterial scaffolds provides a way to accurately mimic these microenvironments, providing an advantage over traditional 2D culture methods using polystyrene as well as a method for engineering replacement tissues 2. While 2D tissue culture polystrene has been used for the majority of cell culture experiments, 3D biomaterial scaffolds can more closely replicate the microenvironments found in vivo by enabling more accurate establishment of cell polarity in the environment and possessing biochemical and mechanical properties similar to soft tissue.3 A variety of naturally derived and synthetic biomaterial scaffolds have been investigated as 3D environments for supporting stem cell growth. While synthetic scaffolds can be synthesized to have a greater range of mechanical and chemical properties and often have greater reproducibility, natural biomaterials are often composed of proteins and polysaccharides found in the extracelluar matrix and as a result contain binding sites for cell adhesion and readily support cell culture. Fibrin scaffolds, produced by polymerizing the protein fibrinogen obtained from plasma, have been widely investigated for a variety of tissue engineering applications both in vitro and in vivo 4. Such scaffolds can be modified using a variety of methods to incorporate controlled release systems for delivering therapeutic factors 5. Previous work has shown that such scaffolds can be used to successfully culture embryonic stem cells and this scaffold-based culture system can be used to screen the effects of various growth factors on the differentiation of the stem cells seeded inside 6,7.
 This protocol details the process of polymerizing fibrin scaffolds from fibrinogen solutions using the enzymatic activity of thrombin. The process takes 2 days to complete, including an overnight dialysis step for the fibrinogen solution to remove citrates that inhibit polymerization. These detailed methods rely on fibrinogen concentrations determined to be optimal for embryonic and induced pluripotent stem cell culture. Other groups have further investigated fibrin scaffolds for a wide range of cell types and applications - demonstrating the versatility of this approach 8-12.

This work details the preparation of 3D fibrin scaffolds for culturing and differentiating plutipotent stem cells. Such scaffolds can be used to screen the effects of various biological compounds on stem cell behavior as well as modified to contain drug delivery systems.

3D Fibrin hazırlanması Kök Hücre Kültürü Uygulamaları için iskeleleri

Stem cells are found in naturally occurring 3D microenvironments in vivo, which are often referred to as the stem cell niche 1. Culturing stem cells ...

Postproduction Processing of Electrospun Fibres for Tissue Engineering

Electrospinning is a commonly used and versatile method to produce scaffolds (often biodegradable) for 3D tissue engineering.1, 2, 3 Many tissues in vivo undergo biaxial distension to varying extents such as skin, bladder, pelvic floor and even the hard palate as children grow. In producing scaffolds for these purposes there is a need to develop scaffolds of appropriate biomechanical properties (whether achieved without or with cells) and which are sterile for clinical use. The focus of this paper is not how to establish basic electrospinning parameters (as there is extensive literature on electrospinning) but on how to modify spun scaffolds post production to make them fit for tissue engineering purposes - here thickness, mechanical properties and sterilisation (required for clinical use) are considered and we also describe how cells can be cultured on scaffolds and subjected to biaxial strain to condition them for specific applications.
Electrospinning tends to produce thin sheets; as the electrospinning collector becomes coated with insulating fibres it becomes a poor conductor such that fibres no longer deposit on it. Hence we describe approaches to produce thicker structures by heat or vapour annealing increasing the strength of scaffolds but not necessarily the elasticity. Sequential spinning of scaffolds of different polymers to achieve complex scaffolds is also described. Sterilisation methodologies can adversely affect strength and elasticity of scaffolds. We compare three methods for their effects on the biomechanical properties on electrospun scaffolds of poly lactic-co-glycolic acid (PLGA).
Imaging of cells on scaffolds and assessment of production of extracellular matrix (ECM) proteins by cells on scaffolds is described. Culturing cells on scaffolds in vitro can improve scaffold strength and elasticity but the tissue engineering literature shows that cells often fail to produce appropriate ECM when cultured under static conditions. There are few commercial systems available that allow one to culture cells on scaffolds under dynamic conditioning regimes - one example is the Bose Electroforce 3100 which can be used to exert a conditioning programme on cells in scaffolds held using mechanical grips within a media filled chamber.4 An approach to a budget cell culture bioreactor for controlled distortion in 2 dimensions is described. We show that cells can be induced to produce elastin under these conditions. Finally assessment of the biomechanical properties of processed scaffolds cultured with or without cells is described.

Electrospun scaffolds can be processed post production for tissue engineering applications. Here we describe methods for spinning complex scaffolds (by consecutive spinning), for making thicker scaffolds (by multi-layering using heat or vapour annealing), for achieving sterility (aseptic production or sterilisation post production) and for achieving appropriate biomechanical properties.

Doku Mühendisliği için elektrospinning Liflerin Postprodüksiyon İşleme

Electrospinning is a commonly used and versatile method to produce  scaffolds (often biodegradable) for 3D tissue engineering.1, 2, 3 Many tissues in vivo ...

Engineering Skeletal Muscle Tissues from Murine Myoblast Progenitor Cells and Application of Electrical Stimulation

Engineered muscle tissues can be used for several different purposes, which include the production of tissues for use as a disease model in vitro, e.g. to study pressure ulcers, for regenerative medicine and as a meat alternative 1. The first reported 3D muscle constructs have been made many years ago and pioneers in the field are Vandenburgh and colleagues 2,3. Advances made in muscle tissue engineering are not only the result from the vast gain in knowledge of biochemical factors, stem cells and progenitor cells, but are in particular based on insights gained by researchers that physical factors play essential roles in the control of cell behavior and tissue development. State-of-the-art engineered muscle constructs currently consist of cell-populated hydrogel constructs. In our lab these generally consist of murine myoblast progenitor cells, isolated from murine hind limb muscles or a murine myoblast cell line C2C12, mixed with a mixture of collagen/Matrigel and plated between two anchoring points, mimicking the muscle ligaments. Other cells may be considered as well, e.g. alternative cell lines such as L6 rat myoblasts 4, neonatal muscle derived progenitor cells 5, cells derived from adult muscle tissues from other species such as human 6 or even induced pluripotent stem cells (iPS cells) 7. Cell contractility causes alignment of the cells along the long axis of the construct 8,9 and differentiation of the muscle progenitor cells after approximately one week of culture. Moreover, the application of electrical stimulation can enhance the process of differentiation to some extent 8. Because of its limited size (8 x 2 x 0.5 mm) the complete tissue can be analyzed using confocal microscopy to monitor e.g. viability, differentiation and cell alignment. Depending on the specific application the requirements for the engineered muscle tissue will vary; e.g. use for regenerative medicine requires the up scaling of tissue size and vascularization, while to serve as a meat alternative translation to other species is necessary.

Engineered muscle tissue has great potential in regenerative medicine, as disease model and also as an alternative source for meat. Here we describe the engineering of a muscle construct, in this case from mouse myoblast progenitor cells, and the stimulation by electrical pulses.

Elektrik Stimülasyonu murin myoblast Progenitör Hücreler ve Uygulama Mühendislik İskelet Kası Dokular

Engineered muscle tissues can be used for several different purposes, which include the production of tissues for use as a disease model in vitro, e.g. to ...

Electrospinning Growth Factor Releasing Microspheres into Fibrous Scaffolds

This procedure describes a method to fabricate a multifaceted substrate to direct nerve cell growth. This system incorporates mechanical, topographical, adhesive and chemical signals. Mechanical properties are controlled by the type of material used to fabricate the electrospun fibers. In this protocol we use 30% methacrylated Hyaluronic Acid (HA), which has a tensile modulus of ~500 Pa, to produce a soft fibrous scaffold. Electrospinning on to a rotating mandrel produces aligned fibers to create a topographical cue. Adhesion is achieved by coating the scaffold with fibronectin. The primary challenge addressed herein is providing a chemical signal throughout the depth of the scaffold for extended periods. This procedure describes fabricating&#160;poly(lactic-co-glycolic acid) (PLGA) microspheres that contain Nerve Growth Factor (NGF) and directly impregnating the scaffold with these microspheres during the electrospinning process. Due to the harsh production environment, including high sheer forces and electrical charges, protein viability is measured after production. The system provides protein release for over 60 days and has been shown to promote primary nerve cell growth.

This protocol combines electrospinning and microspheres to develop tissue engineered scaffolds to direct neurons. Nerve growth factor was encapsulated within PLGA microspheres and electrospun into Hyaluronic Acid (HA) fibrous scaffolds. The protein bioactivity was tested by seeding the scaffolds with primary chick Dorsal Root Ganglia and culturing for 4-6 days.

Lifli iskelelerinin içine Microspheres ibra Elektroeğirme Büyüme Faktörü

This procedure describes a method to fabricate a multifaceted substrate to direct nerve cell growth.  This system incorporates mechanical, topographical, ...

Electrospun Nanofiber Scaffolds with Gradations in Fiber Organization

The goal of this protocol is to report a simple method for generating nanofiber scaffolds with gradations in fiber organization and test their possible applications in controlling cell morphology/orientation. Nanofiber organization is controlled with a new fabrication apparatus that enables the gradual decrease of fiber organization in a scaffold. Changing the alignment of fibers is achieved through decreasing deposition time of random electrospun fibers on a uniaxially aligned fiber mat. By covering the collector with a moving barrier/mask, along the same axis as fiber deposition, the organizational structure is easily controlled. For tissue engineering purposes, adipose-derived stem cells can be seeded to these scaffolds. Stem cells undergo morphological changes as a result of their position on the varied organizational structure, and can potentially differentiate into different cell types depending on their locations. Additionally, the graded organization of fibers enhances the biomimicry of nanofiber scaffolds so they more closely resemble the natural orientations of collagen nanofibers at tendon-to-bone insertion site compared to traditional scaffolds. Through nanoencapsulation, the gradated fibers also afford the possibility to construct chemical gradients in fiber scaffolds, and thereby further strengthen their potential applications in fast screening of cell-materials interaction and interfacial tissue regeneration. This technique enables the production of continuous gradient scaffolds, but it also can potentially produce fibers in discrete steps by controlling the movement of the moving barrier/mask in a discrete fashion.

Here, we present a protocol to fabricate electrospun nanofiber scaffolds with gradated organization of fibers and explore their applications in regulating cell morphology/orientation. Gradients with regard to physical and chemical properties of the nanofiber scaffolds offer a wide variety of applications in the biomedical field.

Fiber Teşkilatı geçişleri ile electrospun Nanolif iskeleleri

The goal of this protocol is to report a simple method for generating nanofiber scaffolds with gradations in fiber organization and test their possible ...

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Decellularized Akciğer Yapı iskeleleri kullanarak ESC türetilmiş Fare Havayolu Epitel Hücreleri Üretimi

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Microfluidic Bioprinting for Engineering Vascularized Tissues and Organoids

Engineering vascularized tissue constructs and organoids has been historically challenging. Here we describe a novel method based on microfluidic bioprinting to generate a scaffold with multilayer interlacing hydrogel microfibers. To achieve smooth bioprinting, a core-sheath microfluidic printhead containing a composite bioink formulation extruded from the core flow and the crosslinking solution carried by the sheath flow, was designed and fitted onto the bioprinter. By blending gelatin methacryloyl (GelMA) with alginate, a polysaccharide that undergoes instantaneous ionic crosslinking in the presence of select divalent ions, followed by a secondary photocrosslinking of the GelMA component to achieve permanent stabilization, a microfibrous scaffold could be obtained using this bioprinting strategy. Importantly, the endothelial cells encapsulated inside the bioprinted microfibers can form the lumen-like structures resembling the vasculature over the course of culture for 16 days. The endothelialized microfibrous scaffold may be further used as a vascular bed to construct a vascularized tissue through subsequent seeding of the secondary cell type into the interstitial space of the microfibers. Microfluidic bioprinting provides a generalized strategy in convenient engineering of vascularized tissues at high fidelity.

We provide a generalized protocol based on a microfluidic bioprinting strategy for engineering a microfibrous vascular bed, where a secondary cell type could be further seeded into the interstitial space of this microfibrous structure to generate vascularized tissues and organoids.

Mikrosıvısal Bioprinting mühendisliği için doku ve Organoids skarların

Engineering vascularized tissue constructs and organoids has been historically challenging. Here we describe a novel method based on microfluidic ...

Two Methods for Decellularization of Plant Tissues for Tissue Engineering Applications

The autologous, synthetic, and animal-derived grafts currently used as scaffolds for tissue replacement have limitations due to low availability, poor biocompatibility, and cost. Plant tissues have favorable characteristics that make them uniquely suited for use as scaffolds, such as high surface area, excellent water transport and retention, interconnected porosity, preexisting vascular networks, and a wide range of mechanical properties. Two successful methods of plant decellularization for tissue engineering applications are described here. The first method is based on detergent baths to remove cellular matter, which is similar to previously established methods used to clear mammalian tissues. The second is a detergent-free method adapted from a protocol that isolates leaf vasculature and involves the use of a heated bleach and salt bath to clear the leaves and stems. Both methods yield scaffolds with comparable mechanical properties and low cellular metabolic impact, thus allowing the user to select the protocol which better suits their intended application.

Here we present, and contrast two protocols used to decellularize plant tissues: a detergent-based approach and a detergent-free approach. Both methods leave behind the extracellular matrix of the plant tissues used, which can then be utilized as scaffolds for tissue engineering applications.

Doku mühendisliği uygulamaları için bitki dokuların Decellularization için iki yöntem

The autologous, synthetic, and animal-derived grafts currently used as scaffolds for tissue replacement have limitations due to low availability, poor ...

Core/shell Printing Scaffolds For Tissue Engineering Of Tubular Structures

Three-dimensional (3D) printing of core/shell filaments allows direct fabrication of channel structures with a stable shell that is cross-linked at the interface with a liquid core. The latter is removed post-printing, leaving behind a hollow tube. Integrating an additive manufacturing technique (like the one described here with tailor-made [bio]inks, which structurally and biochemically mimic the native extracellular matrix [ECM]) is an important step towards advanced tissue engineering. However, precise fabrication of well-defined structures requires tailored fabrication strategies optimized for the material in use. Therefore, it is sensible to begin with a set-up that is customizable, simple-to-use, and compatible with a broad spectrum of materials and applications. This work presents an easy-to-manufacture core/shell nozzle with luer-compatibility to explore core/shell printing of woodpile structures, tested with a well-defined, alginate-based scaffold material formulation.

Presented here is a simple-to-use, core/shell, three-dimensional bioprinting set-up for one-step fabrication of hollow scaffolds, suitable for tissue engineering of vascular and other tubular structures.

Boru yapıları doku mühendisliği için Çekirdek / kabuk Baskı İskeleler

Three-dimensional (3D) printing of core/shell filaments allows direct fabrication of channel structures with a stable shell that is cross-linked at the ...