We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Br&#252;ckner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

NOTA: Este trabalho utiliza o eyFLP1; act&gt; y +&gt; Gal4, UAS-GFP; Linha tester FRT82B, banheira-Gal80 marcm 82B Verde 11. Cruzando as virgens testador marcm 82B Verdes para machos de estirpes tais como w; UAS-um; UAS-b RNAi, FRT82B c mut genótipo irá produzir descendência em que a recombinação mitótico irá ocorrer entre os braços direitos dos cromossomos homólogos 3º. Desta forma, os clones mutante homozigótica para o gene c localizada distalmente ao local FRT82B irá ser gerado dentro do neuroepitélio EAD e cérebro. Estes clones irá expressar GFP, e um transgene de ARNcd para o gene b (Figura 1A). Várias linhas de tester eyFLP-marcm para recombinação no X, 2L, 2R, 3L e 3R foram estabelecidas e estão disponíveis dentro da comunidade mosca. 1. O manuseamento Fly, cruzes, e estadiamento <ol><li> Expandir o estoque marcm testador adequado à temperatura ambiente, preenchendo múltipla bottles ao mesmo tempo. Virar os adultos em garrafas frescos a cada 2-3 dias para que as virgens suficientes podem ser recolhidos para cruzamentos subsequentes. NOTA: Quando recolher virgens, evitar uma exposição prolongada ao CO 2, pois isso compromete a fecundidade das fêmeas. </li><li> Dependendo da escala do experimento, configurar cruzes mosca em frascos utilizando pelo menos 10 marcm virgens testador e 4 machos (por exemplo, para geração de imagens de repórteres fluorescentes e imunocoloração) ou em frascos com pelo menos 30 virgens e 10 homens (por exemplo, para isolamento de ARN e quantificação de invasividade). </li><li> Elevar progénie a 25 ° C sob um dia longo de 16 h / 8 h ciclo de luz-escuridão. Virar pais em novos frascos / garrafas a cada 24 horas para facilitar o preparo reprodutível de larvas e para evitar a superlotação. NOTA: Começando no dia 6 após a postura dos ovos (AEL), o terceiro controle instar alimentação das larvas parada final, começar vagando e entrar pupariation. Em contraste, o início da transição larva-pupa pode ser deDefiniu ou inexistente em larvas com EAD portadores de tumores clonais hiperplásicas ou malignos. </li></ol> 2. Coleta de terceiro instar larvas <ol><li> Para imunocoloração, recolher cerca de 20 final de larvas terceiro (vagando na parede e os de um tamanho corporal comparável a partir do alimento). Use uma pinça para escolher cuidadosamente as larvas do frasco ou garrafa e transferi-los para um prato de embrião de vidro cheio com solução salina tamponada com fosfato (PBS). <ol><li> Para o isolamento de ARN e a quantificação da capacidade de invasão, recolher, pelo menos, 80 final de larvas terceiro (vaguear sobre a parede e as de um tamanho comparável a partir do corpo de alimentos). Use uma garrafa de esguicho para esguichar PBS em uma garrafa mosca contendo larvas até que a superfície é coberta. </li><li> Suavizar as camadas superiores de alimento com uma espátula e despeje o purê alimentos que contenham larvas em uma placa de Petri. Utilizando uma pinça, gentilmente pegar larvas e transferi-los para um prato de embrião de vidro cheio de PBS. </li></ol></li><li> Lavar com PBS larvas until todos os alimentos residual é removido. Inspecionar as larvas sob o estereomicroscópio fluorescente com 8 a ampliação de 16x para descartar todos &quot;leopardo larvas&quot; que carregam manchas GFP positivas aleatórias em todo o corpo larval (Figura 2A, 2B e ver seção de discussão). NOTA: Para o isolamento de ARN incluem um passo de lavagem no penúltimo EtOH a 70% durante 1 min. </li><li> Coloque o prato contendo larvas selecionado na PBS em gelo até dissecção. larvas processo no prazo de 30 min para evitar efeitos adversos de frio e fome. </li></ol> 3. Dissecção da Larvas <ol><li> Para dissecar o EAD sob um microscópio estereoscópico, use um par de pinças para pressionar levemente a parte do meio da larva contra o fundo prato de vidro. Com a segunda pinça, pegue os ganchos boca larval e puxá-los para fora do corpo (Figura 2C). NOTA: A força de tracção é muitas vezes suficiente para quebrar os caules óptica que ligam o EAD pair para os lobos cerebrais. Se o cérebro ou suas partes ficar ligado a EAD e a sua presença não é desejada para outras aplicações, cortar os caules óptica com a ajuda dos dois pares de pinças. Para tumores invasivos (por exemplo, ras V12 Scrib 1) a conexão entre EAD e os lóbulos cerebrais torna-se cada vez mais obscurecido com o tempo por overgrowing e migração de células clonais. <ol><li> Para preparar o complexo de EAD / cérebro com um cordão nervoso intacto ventral (VNC) (Figura 2D), utilizar uma pinça para cortar uma larva no meio do corpo. Descarte a metade posterior. </li><li> Segurar a metade anterior do corpo de larvas entre as pontas de um fórceps, inverter a larva de dentro para fora, empurrando os ganchos boca com a ponta do fórceps e as segundas por laminagem a cutícula por cima com o primeiro par de fórceps. </li></ol></li><li> Utilizando uma pinça remova cuidadosamente todos os tecidos estranhos (por exemplo, glândulas salivares, gordura corporal e intestinal), deixando o par EAD ouo complexo EAD / cérebro ligado aos ganchos boca. Separar os ganchos na boca da cutícula sobrejacente. Livre o VNC, cortando as projeções axonal estendendo-se até os músculos do corpo e epiderme (Figuras 1B, 2C, 2D). NOTA: Os ganchos boca para permitir a manipulação segura do tecido com uma pinça e facilitar o afundamento mais eficiente e fácil reconhecimento de tecido durante a lavagem. Dissecados morfologia mudança EAD relativamente rápido quando mantidos unfixed em PBS. Limitar o tempo de dissecção para 20-30 min. </li><li> Para transferir o tecido, revestimento a ponta da micropipeta P20 pipetando o corpo restante carcaças várias vezes para cima e para baixo. Para transferir os complexos maiores EAD / cerebrais, corte a ponta da micropipeta P20 com uma tesoura. NOTA: O procedimento de revestimento é crítico para evitar a aderência e a perda de tecido dissecados durante a transferência. Uso de uma micropipeta P20 minimiza a transferência de fosfato em solução fixadora, limitando a diluição indesejada. <ol><li> Para imunocoloração, transferirEAD dissecado em um tubo de 0,5 ml cheio com 400 ul de paraformaldeido a 4% (PFA) fixador. Use 1,5 ml tubo com 1 ml PFA para ampliar EAD complexos cerebrais / significou para marcação de invasão. CUIDADO: PFA é altamente tóxico. Usar luvas e vestuário de protecção. Evitar o contacto com a pele, olhos ou membranas mucosas. </li><li> Para o isolamento do RNA transferir o EAD dissecado em um novo prato de vidro cheio de PBS frio. Use uma pinça para limpar EAD a partir das glândulas linfáticas e do anel, para minimizar a contaminação da amostra. </li><li> Retire a EAD dos ganchos na boca, cortando a ligação entre os discos de antena e boca ganchos usando uma pinça (Figura 2E). Para evitar RNA degradação e artefatos de expressão gênica, limitar o tempo de dissecção e 30 min. Siga para a etapa 7. Nota: Um investigador experiente pode dissecar cerca de 60 larvas em 30 min Tempo de exclusão necessários para a coleta de larvas e de lavar roupa. Total de rendimentos de ARN depender do tamanho EAD que variam entre os genótipos e DevelopmentAl etapas. Dissecação de 80-100 pares de controle de EAD de larvas terceira final deve render 5-8 ug de RNA total. </li></ol></li></ol> 4. Fixação, imunocoloração e montagem <ol><li> Fix amostras em PFA fixador durante 25 min, enquanto se nutação à temperatura ambiente. O tempo de fixação pode ser prolongado até 60 minutos sem alterar a morfologia do tecido e a antigenicidade de proteínas. </li><li> Retirar as amostras de agente de fixao e lavagem com PBST (PBS com 0,1% de Triton X-100), três vezes durante 10 min, utilizando um nutator. Utilizar um volume suficiente de PBST durante cada passo de lavagem (400 uL / ​​tubo de 0,5 ml). NOTA: Fixo complexos / cérebro EAD significou para marcação de invasão não necessitam de imunocoloração. sinal de GFP continua bem visível após a fixação. Avance para o passo 4.4 para a dissecção final. <ol><li> Para a imunocoloração, tecido bloco em 200 ul de uma solução de bloqueio (PBST com 0,3% de BSA) durante 20 min com agitação suave à temperatura ambiente. <ol><li> Incube com primary anticorpos diluídos em 100 ul de uma solução de bloqueamento durante a noite a 4 ° C enquanto agitando suavemente. Referem-se a folha de dados anticorpo primário ou a literatura publicada para a diluição de anticorpo recomendada. NOTA: A diluição de anticorpo primário pode precisar ser otimizado. </li><li> Após cinco lavagens de 10 min em PBST, tecido mancha com os anticorpos secundários fluorescentes diluído em solução de bloqueio, enquanto agitando durante 2 horas à temperatura ambiente ou durante a noite a 4 ° C no escuro. </li><li> Lavar as amostras três vezes 10 minutos em PBST. </li></ol></li></ol></li><li> Substituir PBST com 500 ul de solução DAPI-coloração. Para marcar F-actina, adicionar faloidina conjugada com um corante fluorescente para solução DAPI-coloração. Depois de 15 min no escuro nutação, lavar o tecido uma vez durante 10 min com PBST. NOTA: rotulagem F-actina pode ser realizada de forma independente da coloração com DAPI. </li><li> Para a etapa de dissecção final, transferir o tecido de volta em um prato de vidro PBS-cheia usando um pi 1 mlpette. Utilizando os dois pares de pinças de clipe para fora dos ganchos boca. <ol><li> Separa-se os cérebros que serão usados ​​para a quantificação da invasividade do EAD cortando a haste óptica como EAD coberto pode dificultar a análise. </li></ol></li><li> Colocar uma gota de meio de montagem (15 ul de uma lamela x 22 mm 22 mm) sobre uma corrediça objectivo. Com a ajuda de fórceps dicas, distribuir o meio numa camada fina. Transferir EAD, cérebros ou os complexos EAD / cerebrais para o meio de montagem com uma micropipeta P20. </li><li> Use as dicas fórceps ou uma haste de tungstênio para distribuir tecidos e endireitar o VNC no slide. </li><li> Para evitar a formação de bolhas durante a montagem, o primeiro toque de uma borda de uma lamela para o meio de montagem e, em seguida, lentamente inferior para o meio de montagem com a ajuda de fórceps. Use pequenos pedaços de papel de filtro ou lenço de papel para absorver o excesso de meio de montagem em torno das bordas lamela. NOTA: DABCO / poli (álcool vinílico) de montagem 4-88 endurece médiasa 4 ° C no decurso de uma hora. As lâminas podem ser armazenadas durante meses a 4 ° C. </li></ol> 5. Imagem Confocal <ol><li> Adquirir seções confocal individuais e pilhas usando um microscópio confocal equipado com 20X, objetivos petróleo 40X e 60X. </li><li> Evitar a saturação pixel. Use mesmos parâmetros de aquisição de imagem, incluindo a resolução da imagem, potência de entrada laser, ganho, offset, quadro de média, um tamanho de passo em uma série z e manter essas configurações para todos os genótipos para permitir comparações de intensidades de pixel entre os diferentes genótipos 21,22. NOTA: Para a visualização do complexo / cérebro EAD, gerar projeções máximas e costurar respectivas imagens, vizinhos. Para a preparação da imagem final, use pós software de processamento de imagem para a montagem do painel e para ajustar o brilho e contraste. </li></ol> 6. A quantificação de invasividade tumoral <ol><li> Definir um sistema de pontuação que vai caracterizar os diferentes níveis de invasivenes tumoraiss considerando o padrão espacial de invasão e a quantidade de células positivas para GFP espalhar para o cérebro e VNC. Prepare fichas de avaliação para documentação (Figura 3A). </li><li> Mount pelo menos 80 fixa cérebros intactos para cada genótipo em um slide utilizando 40 ul do meio de montagem por 24 milímetros x 50 mm lamela. <ol><li> Para permitir pontuação imparcial, pergunte a um partido neutro anonimizar os slides, para que o procedimento de pontuação é imparcial. Avaliar lâminas anónimos por dois membros do laboratório de forma independente. Divulgar genótipos somente após a contagem estiver concluída. </li></ol></li><li> Avaliar o grau de malignidade por um placar cega de cérebros montados sob um microscópio estereoscópico fluorescente equipado com um conjunto de filtros GFP. Use um marcador para rotular cérebros que já foram vistos a fim de evitar a dupla contagem (Figura 3B). </li><li> Calcula-se a percentagem de cérebros de queda em cada uma das categorias definidas por genótipo invasivos. Determinar os s estatísticosignificance usando um teste qui-quadrado (Figura 3C). </li></ol> 7. Isolamento RNA, DNase Tratamento e Verificação da Qualidade NOTA: Todos os reagentes (soluções, utensílios de plástico) utilizado nos passos seguintes deve ser isento de actividade de RNase. Use sempre luvas e usar um capuz química para o trabalho com solventes orgânicos. <ol><li> Transfira a EAD limpo com uma ponta de micropipeta P20 revestido em 1,5 ml tubo. </li><li> Deixe dissipador de tecido para o fundo do tubo, cuidadosamente remover PBS e substituí-la com 100 ul de reagente de lise de ARN (suficiente para até 140 DAE). </li><li> Lyse tecido em vórtex. Neste ponto, as amostras podem ser congelados em azoto líquido e armazenado a -80 ° C ou directamente processada com um protocolo de isolamento de ARN padrão. NOTA: As amostras de genótipos similares de várias rodadas de dissecação pode ser agrupada vez em reagente de lise RNA. </li><li> Encher o volume da amostra de 0,9 ml, com reagente de lise de ARN. Adicionar 0,2 ml de clorofórmio e misturar amostras Vigorously durante 15-20 seg. </li><li> Após 2 a 3 minutos de incubação à temperatura ambiente, centrifugar as amostras a 10.000 xg durante 15 min a 4 ° C. </li><li> ARN de transferência superior incolor fase aquosa contendo em um novo tubo, sem perturbar a interfase. Fique longe da interfase, pois contém proteínas e DNA genômico. NOTA: O volume recuperado deve ser de cerca de 60% do volume de reagente de lise de ARN usado para a homogeneização. </li><li> Precipitar o ARN por adição de 0,5 ml de álcool isopropílico. Vortex e incubar as amostras à temperatura ambiente durante 10 min. </li><li> Centrifugar as amostras a 10.000 xg durante 15 min a 4 ° C. </li><li> Descartar o sobrenadante e lavar o sedimento de ARN, uma vez com 600 ul de etanol a 75%. Depois de um curto vórtice e centrifugação (10.000 xg durante 7 minutos a 4 ° C) descartar todo o etanol e deixar o sedimento de ARN de ar seco durante 5-10 minutos colocando o tubo aberto em um tecido limpo limpar. NOTA: O sedimento de ARN pode ser visível como uma pequena branco opaco r /maduro na parte inferior do tubo ou invisível. As gotas de etanol restantes podem ser removidos cuidadosamente com ponta P10 micropipeta. </li><li> Dissolve-se o ARN em 50 jil de água tratada com DEPC em vortex ou solução que passa algumas vezes através de uma ponta de pipeta. </li><li> Para minimizar a contaminação com ADN genómico, tratar de ARN total com ADNase pela adição de 50 ul de uma mistura contendo 1 ul de ADNase (2 U / ul) e 10 ul de tampão de ADNase 10x em água tratada com DEPC. Vortex e girar para baixo. </li><li> Incubar as amostras a 37 ° C num banho de água ou de um bloco de aquecimento durante 30 a 40 min. Após a incubação, adicionar 100 ul de água tratada com DEPC para cada amostra. </li><li> Para inactivar a actividade enzimática e RNA limpo de ADNase, adicionar 200 ul de fenol: clorofórmio: álcool isoamílico (25: 24: 1) soluções, vortex durante 1 min e centrifuga-se as amostras a 10.000 xg durante 7 minutos a 4 ° C. </li><li> Transferir cuidadosamente a fase aquosa superior contendo ARN para um tubo fresco. Adicionar um volume igual (200 ul)de clorofórmio, misturar e repetir o passo de centrifugação a partir de cima. </li><li> Recolher cuidadosamente a fase superior e precipitar o ARN por adição de 1/10 do volume de 3 M de acetato de sódio, pH 5,2, preparada em DEPC H2O e 2,5 volumes de etanol a 100%. Misture bem em vórtice. NOTA: A adição de 0,5 ul de glicogénio (20 mg / mL) a uma mistura de precipitação ajuda a visualizar o sedimento de ARN. Para minimizar a perda de ARN, usar siliconada, tubos de ligação de baixa microcentrífuga de 1,5 ml. </li><li> Precipitar o RNA a -20 ° C durante pelo menos 1 h. NOTA: A incubação pode ser realizada durante a noite. As amostras podem ser colocadas a -80 ° C, bem. </li><li> Sedimento de ARN por centrifugação a 10000 xg durante 30 min a 4 ° C. Lave e pellet seco seguindo a descrição em 7,9. </li><li> Dissolve-se o ARN em 10-15 ul de água tratada com DEPC. ARN armazenar a -80 ° C. </li><li> Determinar a quantidade e a pureza do RNA através da medição OD a 230 nm, 260 nm e 280 nm utilizando um espectrofotómetro. Calcule RNA concentration, aplicando a convenção de que 1 DO a 260 nm é igual a 40 ug / ml de ARN. NOTA: O rácio A 260/280 de ARN &quot;pura&quot; é igual a 2,0, enquanto uma razão A 260/230 deve estar na gama de 2,0-2,2. As amostras de ARN com um A 260/280 razão entre 1,7 e 2,0 são adequados para aplicações a jusante, tais como a síntese de cDNA. Para a preparação de bibliotecas de ARNm-seq a qualidade e quantidade de ARN deve ser verificada utilizando um sistema de electroforese automatizada. A proporção 28S / 18S deve estar acima de 1,8. </li></ol>

<ol>
	<li>Miles, W. O., Dyson, N. J., Walker, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+tumor+invasion+and+metastasis+in+Drosophila.">Modeling tumor invasion and metastasis in Drosophila.</a> Dis Model Mech. 4 (6), 753-761 (2011).</li><li>Stefanatos, R. K. A., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+invasion+and+metastasis+in+Drosophila:+a+bold+past,+a+bright+future.">Tumor invasion and metastasis in Drosophila: a bold past, a bright future.</a> J Genet Genomics. 38 (10), 431-438 (2011).</li><li>Patel, P. H., Edgar, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+design:+How+Drosophila+tumors+remodel+their+neighborhood.">Tissue design: How Drosophila tumors remodel their neighborhood.</a> Semin Cell Dev Biol. 28, 86-95 (2014).</li><li>Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+melanogaster:+a+model+and+a+tool+to+investigate+malignancy+and+identify+new+therapeutics.">Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics.</a> Nat Rev Cancer. 13 (3), 172-183 (2013).</li><li>Lee, T., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+for+Drosophila+neural+development.">Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development.</a> Trends Neurosci. 24 (5), 251-254 (2001).</li><li>Xu, T., Rubin, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+genetic+mosaics+in+developing+and+adult+Drosophila+tissues.">Analysis of genetic mosaics in developing and adult Drosophila tissues.</a> Development. 117 (4), 1223-1237 (1993).</li><li>Struhl, G., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organizing+activity+of+wingless+protein+in+Drosophila.">Organizing activity of wingless protein in Drosophila.</a> Cell. 72 (4), 527-540 (1993).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118 (2), 401-415 (1993).</li><li>Wu, J. S., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+in+Drosophila.">A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila.</a> Nat Protoc. 1 (6), 2583-2589 (2006).</li><li>Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=scribble+mutants+cooperate+with+oncogenic+Ras+or+Notch+to+cause+neoplastic+overgrowth+in+Drosophila.">scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.</a> EMBO J. 22 (21), 5769-5779 (2003).</li><li>Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+Drosophila+for+metastatic+behavior.">A genetic screen in Drosophila for metastatic behavior.</a> Science (New York, NY). 302 (5648), 1227-1231 (2003).</li><li>Uhlirova, M., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JNK-+and+Fos-regulated+Mmp1+expression+cooperates+with+Ras+to+induce+invasive+tumors+in+Drosophila.">JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila.</a> EMBO J. 25 (22), 5294-5304 (2006).</li><li>Turkel, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BTB-zinc+finger+transcription+factor+abrupt+acts+as+an+epithelial+oncogene+in+Drosophila+melanogaster+through+maintaining+a+progenitor-like+cell+state.">The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.</a> PLoS Genet. 9 (7), e1003627 (2013).</li><li>Cordero, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Ras+Diverts+a+Host+TNF+Tumor+Suppressor+Activity+into+Tumor+Promoter.">Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter.</a> Dev Cell. 18 (6), 999-1011 (2010).</li><li>Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Drosophila,+RhoGEF2+cooperates+with+activated+Ras+in+tumorigenesis+through+a+pathway+involving+Rho1-Rok-Myosin-II+and+JNK+signalling.">In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling.</a> Dis Model Mech. 6, 661-678 (2013).</li><li>Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sds22/PP1+links+epithelial+integrity+and+tumor+suppression+via+regulation+of+myosin+II+and+JNK+signaling.">Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling.</a> Oncogene. 30 (29), 3248-3260 (2011).</li><li>Figueroa-Clarevega, A., Bilder, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malignant+Drosophila+Tumors+Interrupt+Insulin+Signaling+to+Induce+Cachexia-like+Wasting.">Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting.</a> Dev Cell. 33 (1), 47-55 (2015).</li><li>Newsome, T. P., Asling, B., Dickson, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Drosophila+photoreceptor+axon+guidance+in+eye-specific+mosaics.">Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics.</a> Development. 127 (4), 851-860 (2000).</li><li>Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology+of+the+eyeless+gene+of+Drosophila+to+the+Small+eye+gene+in+mice+and+Aniridia+in+humans.">Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans.</a> Science. 265 (5173), 785-789 (1994).</li><li>K&#252;lshammer, E., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+actin+cross-linker+Filamin/Cheerio+mediates+tumor+malignancy+downstream+of+JNK+signaling.">The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling.</a> J Cell Sci. 126 (Pt 4), 927-938 (2013).</li><li>North, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+is+believing?+A+beginners'+guide+to+practical+pitfalls+in+image+acquisition.">Seeing is believing? A beginners' guide to practical pitfalls in image acquisition.</a> J Cell Biol. 172 (1), 9-18 (2006).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+and+precision+in+quantitative+fluorescence+microscopy.">Accuracy and precision in quantitative fluorescence microscopy.</a> J Cell Biol. 185 (7), 1135-1148 (2009).</li><li>Igaki, T., Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+cell+polarity+drives+tumor+growth+and+invasion+through+JNK+activation+in+Drosophila.">Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila.</a> Curr Biol. 16 (11), 1139-1146 (2006).</li><li>K&#252;lshammer, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interplay+among+Drosophila+transcription+factors+Ets21c,+Fos+and+Ftz-F1+drives+JNK-mediated+tumor+malignancy.">Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy.</a> Dis Model Mech. 8 (10), 1279-1293 (2015).</li><li>Pastor-Pareja, J. C., Wu, M., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+innate+immune+response+of+blood+cells+to+tumors+and+tissue+damage+in+Drosophila.">An innate immune response of blood cells to tumors and tissue damage in Drosophila.</a> Dis Model Mech. 1 (2-3), 144-154 (2008).</li><li>Chatterjee, N., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+&#934;C31+based+reporter+system+for+measuring+AP-1+and+Nrf2+signaling+in+Drosophila+and+in+tissue+culture.">A versatile &#934;C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture.</a> PloS One. 7 (4), e34063 (2012).</li><li>Petraki, S., Alexander, B., Br&#252;ckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+Blood+Cell+Populations+of+the+Drosophila+melanogaster+Larva.">Assaying Blood Cell Populations of the Drosophila melanogaster Larva.</a> J Vis Exp. (105), (2015).</li><li>Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peripheral+nervous+system+supports+blood+cell+homing+and+survival+in+the+Drosophila+larva.">The peripheral nervous system supports blood cell homing and survival in the Drosophila larva.</a> Development. 138 (24), 5379-5391 (2011).</li><li>Kurucz, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemese,+a+hemocyte-specific+transmembrane+protein,+affects+the+cellular+immune+response+in+Drosophila.">Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila.</a> Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).</li><li>Andersen, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+TNF+receptor+Grindelwald+couples+loss+of+cell+polarity+and+neoplastic+growth.">The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth.</a> Nature. 522 (7557), 482-486 (2015).</li><li>Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+remodeling+is+essential+for+Drosophila+disc+eversion+and+tumor+invasion.">Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion.</a> Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).</li><li>Larionov, A., Krause, A., Miller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+curve+based+method+for+relative+real+time+PCR+data+processing.">A standard curve based method for relative real time PCR data processing.</a> BMC Bioinformatics. 6 (1), (2005).</li><li>Blair, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+techniques+for+studying+Drosophila+development.">Genetic mosaic techniques for studying Drosophila development.</a> Development. 130 (21), 5065-5072 (2003).</li><li>Mirth, C. K., Shingleton, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrating+body+and+organ+size+in+Drosophila:+recent+advances+and+outstanding+problems.">Integrating body and organ size in Drosophila: recent advances and outstanding problems.</a> Front Endocrinol. 3 (49), (2012).</li><li>French, V., Feast, M., Partridge, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Body+size+and+cell+size+in+Drosophila:+the+developmental+response+to+temperature.">Body size and cell size in Drosophila: the developmental response to temperature.</a> J Insect Physiol. 44 (11), 1081-1089 (1998).</li><li>Ashburner, M., Bonner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+gene+activity+in+drosophila+by+heat+shock.">The induction of gene activity in drosophila by heat shock.</a> Cell. 17 (2), 241-254 (1979).</li><li>Frazier, M. R., Woods, H. A., Harrison, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactive+effects+of+rearing+temperature+and+oxygen+on+the+development+of+Drosophila+melanogaster.">Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster.</a> Physiol Biochem Zool. 74 (5), 641-650 (2001).</li><li>Lai, S. L., Lee, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+with+dual+binary+transcriptional+systems+in+Drosophila.">Genetic mosaic with dual binary transcriptional systems in Drosophila.</a> Nat Neurosci. 9 (5), 703-709 (2006).</li><li>Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Q+system:+a+repressible+binary+system+for+transgene+expression,+lineage+tracing,+and+mosaic+analysis.">The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis.</a> Cell. 141 (3), 536-548 (2010).</li><li>del Valle Rodr&#236;guez, A., Didiano, D., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+tools+for+gene+expression+and+clonal+analysis+in+Drosophila.">Power tools for gene expression and clonal analysis in Drosophila.</a> Nature Methods. 9 (1), 47-55 (2011).</li><li>Rynes, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+Transcription+Factor+3+Regulates+Immune+and+Metabolic+Homeostasis.">Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis.</a> Mol Cell Biol. 32 (19), 3949-3962 (2012).</li><li>Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+role+of+the+steroid-deficiency+protein+ecdysoneless+in+pre-mRNA+splicing.">Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing.</a> PLoS Genet. 10 (4), e1004287 (2014).</li><li>Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+Specific+Cell+Population+by+Fluorescence+Activated+Cell+Sorting+(FACS).">Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS).</a> J Vis Exp. (41), (2010).</li><li>Tauc, H. M., Tasdogan, A., Pandur, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+intestinal+stem+cells+from+adult+Drosophila+midguts+by+FACS+to+study+stem+cell+behavior+during+aging.">Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging.</a> J Vis Exp. (94), (2014).</li></ol>

The authors declare that they have no conflict of interest.

As técnicas para gerar mosaicos genéticos em Drosophila estão entre as ferramentas mais sofisticadas para analisar e manipular a função do gene 33. O sistema eyFLP-marcm provou poderoso e robusto, uma vez que permite a indução do visualmente marcados, clones geneticamente definidas de uma maneira espacialmente restrita, isto é, em tecidos em que o potenciador é activa sem olhos 9,18. Isto é particularmente importante quando múltiplas lesões genéticas são combinados nas mesmas células. Enquanto estes remendos altamente aberrantes permitir o desenvolvimento das larvas quando restrito a EAD e cérebro neuroepithelia, eles podem causar letalidade quando espalhados por todo o corpo larval como no caso dos clones de choque de calor controlados FLP (hsFLP). Significativamente, a indução de clones no epitélio mosca EAD em que activado oncogenes combinam com perda de supressores de tumor recapitula o surgimento e progressão de tumores epiteliais sólidos em alguns cancros humanos. HoWever, o sistema também tem as suas limitações que serão discutidas brevemente. Dado que os insectos têm um sistema circulatório aberto, como verdadeiros metástases observadas em cancros humanos não ocorrem. Por conseguinte, o complexo processo de disseminação metastática não pode ser modelado fielmente em Drosophila. No entanto, os tumores EAD, como os clones ras V12 Scrib 1 exibem propriedades malignas como eles quebram a membrana basal em torno do EAD e invadir o cérebro adjacente 11,12,31. O grau de agressividade do tumor pode ser quantificada e comparada entre os genótipos diferentes, tal como descrito neste estudo. É também importante notar que a presença de lesões genéticas específicas em EAD mosaico pode afectar a temporização e a duração do desenvolvimento do crescimento das larvas. Encenação de larvas irá determinar se a análise do tecido mosaico será feita utilizando animais da mesma fase cronológica ou de desenvolvimento. A realização de uma experiência piloto para avaliar o impacto de umnovo genótipo clonal EAD no tempo de desenvolvimento é desejável. Há limitações técnicas. Primeiro, o número de diferentes genótipos clonais que pode ser construído com a ferramenta eyFLP-marcm é grande, mas não é infinito. Por exemplo, a combinação de dois alelos mutantes que residem em diferentes cromossomos é prejudicada pela baixa eficiência de recombinação em ambos os cromossomos simultaneamente, e genes localizados no cromossomo pequeno quarta são geralmente inacessíveis. Gene knockdown usando RNAi transgênico é uma solução alternativa. No entanto, é importante perceber que os transgenes não são expressos imediatamente após a recombinação mitótica - não até que o repressor Gal80 é degradada. A actividade do sistema de expressão / Gal4 UAS pode ser reforçada por larvas de crescer a 29 ° C. É, no entanto, importante ter em mente que a temperatura elevada afeta vários parâmetros de desenvolvimento, fisiológicos e moleculares, incluindo a taxa de crescimento, o tempo de desenvolvimento, Metabolism ea expressão gênica 34-37. Assim, adaptações dos protocolos fornecidos, tais como preparo das larvas ou o número de EAD dissecados para profiling transcriptoma seria necessário. Os testadores eyFLP-marcm não estão entre as cepas mais saudáveis. Os múltiplos transgenes em um compromisso genoma voar de fitness e fecundidade. Estes estoques requerem atenção extra para ser mantido e ampliado para grandes coleções de fêmeas virgens. Conforme documentado no presente estudo, a linha tester marcm 82B Verde 11, embora viável quando homozigoto, é geneticamente instável. Isto é óbvio a partir do aparecimento espontâneo de &quot;larvas leopardo&quot; que são apresentados clones ectópica, marcado com GFP dentro de vários tecidos poliplóides incluindo o intestino, traqueia, gordura corporal, e da epiderme de larvas. Este fenómeno ocorre em todos os cruzamentos independente do genótipo paterno. Presumimos que os patches GFP ectópicas resultar de descontrolado recombinação, estocástica entre os dois FRSites de T na cassete FLP-out, causando a remoção do marcador + amarela e da &quot;cassete STOP&quot;. Nos tecidos poliplóides, a tubulina conduzido pelo promotor Gal80 repressor pode ser insuficiente para bloquear a actividade de GAL4. A presença de células geneticamente modificadas em outros tecidos do que a EAD e o cérebro pode provocar sinais sistémicos que possam afectar o comportamento dos clones experimentais. Estes &quot;larvas leopardo&quot; deve, portanto, ser excluídos da análise. Além disso, nós rotineiramente restabelecer o testador marcm 82B Verde de cruzamentos único macho-fêmea. Apesar das armadilhas mencionadas acima, as aplicações do sistema eyFLP-marcm para estudar as funções dos genes e as interacções entre tumores clonais e seu ambiente são múltiplas. Introdução dos sistemas de Gal4 / UAS independente de expressão binária, como LexA / LexOp 38 ou drogas QF controlável / quas / QS 39,40 proporcionaria uma multa controle sobre exp transgeneression e / ou rotulagem simultânea e manipulação de diferentes populações de células, incluindo células clonais, não-clonais epiteliais e hemócitos. Tais tecidos de mosaico pode ser novamente processado de acordo com os protocolos aqui descritos. O método para a dissecção de complexos / cerebrais mosaico EAD e EAD da larvas de terceiro estádio (Protocolo secção 3) pode ser aplicada a fases precoces do desenvolvimento, bem. É importante ressaltar que o protocolo para complexos EAD / cerebrais permita a cobrança da asa, haltere e perna discos imaginais. Caso estes ser utilizados para o isolamento de ARN (secções 3.3.2 Protocolo e 7), o disco de interesse devem ser limpos de tecido estranho e processados ​​de forma semelhante ao EAD. Dada a sua dimensão menor, o número de discos de haltere e perna recolhidos deve ser aumentado de adquirir uma quantidade suficiente de ARN. O protocolo para a extracção de ARN total de DAE (secção Protocolo 7) baseia-se em reagente de lise de ARN disponíveis a partir de diferentes v comercialendors (ver lista de materiais / equipamentos). O sucesso global do procedimento depende principalmente: (i) ter número suficiente de larvas, (ii) ser rápido e preciso, enquanto dissecando, e (iii) manter amostras livres de RNases. Manter o espaço de trabalho e instrumentos limpo, usando luvas, usando utensílios de plástico livre de RNase e soluções, e manter as amostras em gelo reduzem a degradação do RNA. Para evitar a contaminação de ARN com qualquer ADN genómico que não pode ser completamente removida pelo tratamento com DNase (Protocolo secção 7.11), é crítico para evitar a interfase ao recolher a fase aquosa, pela primeira vez (Protocolo secção 7.6). Tanto a contaminação de ADN e da degradação de ARN pode ser revelada por execução de amostras num sistema de electroforese automatizada (Figura 6B, 6C). O protocolo de isolamento do RNA tem uma aplicação mais ampla. Ele tem sido usado com sucesso para a extracção de ARN a partir de larvas de todo em diferentes fases de desenvolvimento, a partir de adultos, e váriosórgãos larval. O RNA obtido foi adequado para a análise de transcriptoma do genoma por ARNm-20,24,41,42 SEQ qRT-PCR e. Comparado a qRT-PCR que quantifica dezenas de mRNAs selecionados, no máximo, imparcial sequenciamento mRNA permite análises de expressão de todo o genoma. Assim, pode-se comparar inteiras assinaturas transcriptoma de tumores induzidos por lesões genéticas específicas em fases distintas de tumorigênese 24. É importante ter em mente que o RNA vem dos discos inteiros, de modo que os resultados não só irá reflectir as alterações nos clones mas também no tecido circundante, não clonal. Executando célula fluorescente activate (FACS) em EAD mosaico dissociado mediante a adaptação de protocolos disponíveis 43,44 podia ser aplicado para determinar a assinatura de transcrição específicos de populações celulares, por exemplo, clonal (GFP +) e não clonal (GFP -) células. O protocolo de fixação e imunocoloração aqui descrito é adequado para simulvisualização simultânea de proteínas de interesse com anticorpos e atividade dos repórteres transgênicos específicos. Tanto o sinal de GFP marcação células clonais e DsRed fluorescência produzida por qualquer um dos dois repórteres transgénicos utilizados neste estudo são conservados em toda a fixação e imunocoloração e pode ser directamente visualizadas por microscopia confocal. No entanto, os anticorpos contra as proteínas fluorescentes pode amplificar a intensidade do sinal. Similarmente, o uso de um anticorpo anti-β-galactosidase irá facilitar a detecção de repórteres transgénicos com base no gene lacZ bacteriana. Repórter actividades relativas podem ser avaliadas medindo as intensidades de pixel relativas dos clones contra o tecido usando software de análise de imagem não clonal (por exemplo, ilhas Fiji, ImageJ). Ao comparar a actividade repórter entre os diferentes genótipos clonais, as configurações de aquisição de imagem deve ser mantida constante (secção Protocolo 5 e referências 21,22). Embora o protocolo funciona bem com muitos um diferententibodies, pode ser necessário optimizar as concentrações de anticorpos recomendadas. Alterações pode também ser necessária em vez de fixação, tipo e concentração de detergente (Triton X-100, Tween-20, saponina) e o fixador (8% PFA, 4% de formaldeído, EtOH). Ao contrário dos protocolos acima discutidas, a quantificação de invasividade tumoral é limitada à fase de larva de terceiro instar e o complexo EAD / cérebro. No entanto, a sua fundamentação global pode ser aplicado a todos os estudos quantitativos, onde viés cognitivo precisa ser evitado. O método requer rigor. Com o aumento da malignidade do tumor em tempo, é essencial para comparar as larvas da mesma idade (por exemplo, 7 ou 8 dias após a postura de ovos). Com o tempo um tumor clonal podem crescer demais maciçamente, mas as células tumorais podem permanecer dentro do EAD. O passo no qual cérebros são separados da DAE (Protocolo secção 4.4.1) é, por conseguinte, crítica para evitar contagens invasividade falso-positivos. Montagem de cérebros com o EAD anexado vai Flattpt os tecidos, fazendo com que a EAD coberto para cobrir as estruturas cerebrais e, assim, evitar qualquer quantificação. Idealmente, gostaria de capturar o processo invasivo diretamente na larva viva. repórteres transgénicos para visualizar as populações de células e tecidos envolvidos estão disponíveis e podem ser combinadas com o sistema de eyFLP-marcm. Infelizmente, o processo invasivo leva várias horas a dias, um período de tempo que é incompatível com a manutenção das larvas vivas enquanto ainda.

Cancer representa um dos grupo mais geneticamente heterogêneo de doenças, cuja incidência e mortalidade está aumentando dramaticamente, especialmente entre os idosos em todo o mundo. Cancer origem clonal de uma célula de iniciação tumor que escapa mecanismos supressores tumorais inerente e divide fora de controle. A acumulação gradual de lesões genéticas que cooperativamente promover o crescimento, a proliferação e a motilidade, enquanto inibir a morte e a diferenciação transforma o crescimento excessivo benigno inicial em um tumor altamente maligno metastático e mortal. Tornou-se evidente que, além de alterações genéticas, a progressão do tumor requer alterações no estroma circundante e diafonia entre os tipos de células tumorais e múltiplos (por exemplo, fibroblastos, células endoteliais, imunes e) no seu microambiente. Compreender os princípios moleculares subjacentes transformação maligna incluindo interações tumor-estroma é de grande importância para o desenvolvimento de prevenestratégias de e rastreio precoce, bem como tratamentos novos e eficazes para lutar contra a metástase do câncer e resistência aos medicamentos. A mosca da fruta Drosophila melanogaster tornou-se um sistema atraente para a investigação do cancro 1-4 devido ao seu tempo de geração rápido, notável conservação da sinalização nós entre moscas e seres humanos, redundância genética limitada e riqueza de ferramentas genéticas avançadas que facilitam a manipulação de quase qualquer gene em de maneira temporária e espacialmente restritos. Tumores geneticamente definidas de diferentes malignidade pode ser reprodutivelmente engenharia em Drosophila através da introdução de gain- e mutações de perda de função em um subconjunto de células progenitoras num tecido de outra forma tipo selvagem utilizando a técnica marcm 5. A ferramenta combina marcm FLP / FRT (FLP recombinase / FLP Reconhecimento Target) mediada por recombinação mitótica 6 com FLP-out 7 e Gal4 / UAS (Upstream Activation Sequence) gene alvo 8sistemas de expressão de 9. Com esta expressão método de qualquer transgene UAS-base, incluindo oncogene ou ADNc de proteína fluorescente ou repetições de ADN invertidos para silenciamento de genes induzido por ARNcd, será restrita a um clone de células que perderam um locus genético específico e um repressor Gal4 devido à recombinação (Figura 1A). Remendos clonais marcados com fluorescente verde (GFP) ou proteínas fluorescentes vermelho (por exemplo, RFP, DsRed, mCherry) pode ser facilmente rastreada ao longo do desenvolvimento, isolados e analisados. Importantemente, o seu comportamento pode ser directamente comparada com o tecido adjacente de tipo selvagem. Assim, questões pertinentes à célula efeitos autónomos e não autónomos de lesões genéticas podem ser convenientemente estudado. Semelhante a mamíferos, apenas clones em que múltiplas lesões oncogênicos são combinados se tornem malignas em Drosophila e recapitular características principais de câncer de mamíferos. Eles overproliferate, fugir apoptose, induzir a inflamação, tornar-se imortal e invasiva, em última análise, matando o hospedeiro 10-17. Aqui, descrevemos um protocolo para gerar tumores clonais geneticamente definidas no tecido ocular / antenas e do cérebro de larvas de Drosophila usando a técnica marcm. O método baseia-se um testador de estoque marcm que expressa a recombinase FLP de levedura sob o controlo do intensificador sem olhos (eyFLP) 18,19. Desta forma, os clones marcado com GFP são geradas em ambos epitélio colunar e peripodial do EAD e o neuroepitélio do cérebro ao longo estágios embrionários e larval (Figura 1a, b e de referência 20). Clones podem ser facilmente seguido até a idade adulta como a EAD desenvolve no olho adulto, antena e cabeça cápsula enquanto o neuroepitélio dá origem a neuroblastos que produzem neurônios do lóbulo óptica diferenciadas. Para facilitar a extensa caracterização molecular, funcional e fenotípica do tecido mosaico, que deescriba um protocolo para dissecção da EAD e do cérebro a partir do terceiro larvas e delinear a forma de processá-los por três aplicações diferentes: (i) a detecção de repórteres fluorescentes transgênicas e imunocoloração, (ii) quantificação de invasão tumoral e (iii) a análise dos altera a expressão do gene utilizando uma quantitativa PCR em tempo real (qRT-PCR), ou um ARNm de alto rendimento de sequenciação (ARNm-SEQ) (Figura 1C). O protocolo de imunocoloração pode ser usado para visualizar qualquer proteína de interesse com um anticorpo específico. Transgenic repórteres fluorescentes transcricionais fornecer informações espaço-temporal conveniente e precisa sobre a actividade de uma via de sinalização particular. repórteres celular específicos de linhagem, por outro lado, reflectem alterações qualitativas e quantitativas em populações de células no interior do tecido do mosaico e entre os tumores de diferentes genótipos. A quantificação do comportamento invasivo facilita a comparação de malignidade do tumor entre o genótipos. Finalmente, o protocolo descrevendo recolha e tratamento de EAD mosaico para o isolamento de RNA é adequado tanto para aplicações a jusante-pequena e grande escala, tais como a transcrição reversa seguida de qRT-PCR e mRNA-seq genome-wide, respectivamente. Os dados qualitativos e quantitativos obtidos a partir destes ensaios de fornecer novos insights sobre o comportamento social dos tumores clonais. Além disso, eles produzem uma base sólida para estudos funcionais sobre o papel dos genes individuais, redes genéticas e microambiente do tumor em diferentes fases e aspectos da tumorigénese.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Agar</td>
			<td style="width:177px;">Gew&#252;rzm&#252;hle Brecht, Eggenstein, Germany</td>
			<td style="width:151px;">00262-0500</td>
			<td style="width:476px;">Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85&#176;C.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Corn syrup</td>
			<td style="width:177px;">Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany</td>
			<td style="width:151px;">01939</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Propionic acid</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6026.1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cornmeal</td>
			<td style="width:177px;">ReformKontor GmbH, Zarrentin, Germany</td>
			<td style="width:151px;">4010155063948</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Malt extract</td>
			<td style="width:177px;">CSM Deutschland GmbH, Bremen, Germany</td>
			<td style="width:151px;">728985</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Soy flour</td>
			<td style="width:177px;">Stockmeier Food GmbH, Herford, Germany</td>
			<td style="width:151px;">1000246441010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Yeast</td>
			<td style="width:177px;">Werner Ramspeck GmbH, Schwabach, Germany</td>
			<td style="width:151px;">210099K</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Methyl-4-benzoate/ Nipagin</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">H5501</td>
			<td style="width:476px;">Prepare a 15% stock solution with 70% EtOH</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food vials</td>
			<td style="width:177px;">Kisker Biotech, Steinfurt, Germany</td>
			<td style="width:151px;">789008</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vial plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food bottles</td>
			<td style="width:177px;">Greiner Bio-One, Frickenhausen, Germany</td>
			<td style="width:151px;">960177</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bottle plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002 S</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">81381</td>
			<td style="width:476px;">Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50&#176;C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20&#176;C.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">1,4-Diazabicyclo[2.2.2]octane/ DABCO&#160;</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D2522</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">9002-93-1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate-buffered saline/ PBS</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBST</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">0.1% Triton X-100 in PBS</td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde/ PFA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">158127</td>
			<td style="width:476px;">4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 &#176;C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 &#181;l Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20&#176;C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bovine Serum Albumin/ BSA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">A3059</td>
			<td style="width:476px;">Blocking solution recipe: Dissolve 0.3% BSA in PBST</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">4&#8217;,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6335</td>
			<td style="width:476px;">DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4&#176;C. Used in dilution 1:1000 in PBST.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Alexa Flour 546 Phalloidin</td>
			<td style="width:177px;">Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">A22283</td>
			<td style="width:476px;">Used in dilution 1:500 in PBST.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Mouse anti-H2 antibody</td>
			<td style="width:177px;">Kurucz et al., 2003</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L)</td>
			<td style="width:177px;">Jackson ImmunoResearch, Suffolk, UK</td>
			<td style="width:151px;">715-175-151</td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dumont #5 forceps</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">11295-10</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Glass embryo dish (30 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">E90</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tungsten needles</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">10130-20</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nickel Plated Pin Holder</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">26018-17</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Microscope slides</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 22 x 22 mm (#1 Menzel-Gl&#228;ser)</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1336</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 24 x 50 mm (0.13-0.16 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">1076371</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kimtech Science Precision Wipes</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">06-677-70</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dissecting stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX7 (DF PLAPO 1X-4 Japan)</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Fluorescent stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera</td>
			<td style="width:476px;">Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Confocal microscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">FV1000</td>
			<td style="width:476px;">Equipped with inverted IX81 microscope. Objectives: 20&#215; UPlan S-Apo (NA 0.85), 40&#215; UPlanFL (NA 1.30) and 60&#215; UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Drosophila cooled incubator</td>
			<td style="width:177px;">Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany</td>
			<td style="width:151px;">&#160;Sanyo MIR553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Squirt bottle</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">215-8105</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">BD Clay Adams Nutator Mixer</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">15172-203</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ELMI Digital Rocking Shaker</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">DRS-12</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 PRIME Isol-RNA Lysis Reagent</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">2302700</td>
			<td style="width:476px;">The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Diethyl pyrocarbonate/ DEPC</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D5758</td>
			<td style="width:476px;">Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1)</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">15593-031</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Chloroform</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">102445</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">TURBO DNase (2 U/&#181;l)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">AM2238</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Invitrogen UltraPure Glycogen</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td>10-814-010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Sodium acetate trihydrate</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">27652.232</td>
			<td style="width:476px;">Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">2-Propanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">109634</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">100983</td>
			<td style="width:476px;">Prepare a 75% EtOH dilution with DEPC-H2O.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UV/Vis-Spectrophotometre NanoDrop ND-8000</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">ND-8000</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Eppendorf Microcentrifuge (Refrigerated)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">5417R</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion RNA StdSens Analysis Kit</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007103</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion Automated Electrophoresis Station</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SuperScript III Reverse Transcriptase</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">18080044</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Oligo d(T) Primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Prepare 100 &#181;M stock solutions in DEPC-H20 and store at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">dNTP Mixture</td>
			<td style="width:177px;">Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France</td>
			<td style="width:151px;">4030</td>
			<td style="width:476px;">Store aliquots of 25 &#181;l at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">1855195</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">iQ SYBR Green Supermix</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">170-8882</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Hard-Shell PCR Plates 96-well, thin wall</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">HSP9601</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Microseal &#39;B&#39; Film</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">MSB1001</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; TCCTACCAGCTTCAAGATGAC 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; CACGTTGTGCACCAGGAACT 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; AGGGCGACAAGTACTACAAGCTGA 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; ACGTCTTGCCGTTCTTGTAGGTGA 3&#39;</td>
		</tr>
	</tbody>
</table>

the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

Para demonstrar o potencial da técnica eyFLP-marcm para gerar manchas marcadas com GFP de genótipos definidos em Drosophila EAD, foram induzidos três tipos de clones: (1) controle somente expressando GFP, (2) tumores malignos expressar uma forma oncogénica do pequeno Ras (Ras V12) da proteína G em um fundo de perda homozigótica de um scribble gene supressor de tumor (Scrib 1), e (3) sobrecrescimento mas não invasivo ras V12 Scrib 1 JNK clones Dn, onde cinase da Jun-N- terminal (JNK) foi inactivado por expressão da sua forma dominante negativa (Figura 4, Tabela 1 para os genótipos). Tem sido demonstrado que a capacidade de invasão de tumores clonais Scrib 1 ras V12 requer a activação aberrante de sinalização JNK e a sua transcrição a jusante factores 10,12,23,24. Além disso, o RAS V12 Scrib 1 </saté&gt; tumores promover uma resposta inflamatória forte na larva de Drosophila, que resulta em infiltração de células imunitárias (chamados hemócitos) na EAD 14,25. Para monitorar os níveis e a distribuição espacial da actividade JNK dentro do tecido mosaico e entre os tumores de genótipos distintos, o transgênico estabelecida, repórter TRE-DsRed JNK-responsive foi empregado 26. A microscopia confocal da DAE dissecados, fixados e EAD / complexos cerebrais revelou regulação positiva acentuada da actividade repórter TRE-DsRed nos tecidos malignos rolamento ras V12 Scrib 1 tumores (Figura 4B). O sinal DsRed marcado ras V12 Scrib 1 clones em EAD (Figura 4B), bem como células de tumor que espalham ao longo dos lobos cerebrais e que invadem o VNC (Figura 4E, 4F). Em contraste, a activi repórter TRE-DsRedty permaneceu restrito a uma série de células que se estendem do antenas para a parte do olho dos discos de controlo (Figura 4A). Bloqueio de sinalização JNK, resultou numa diminuição dramática de sinal TRE-DsRed em Ras V12 clonal Scrib 1 tumores JNK DN (Figura 4C, 4D). Estes dados fornecem, assim, provas funcionais para uma exigência de JNK sinalização para ativar a resposta transcricional TRE-dependente em Ras maligna V12 Scrib 1 tumores. Um repórter hmlΔ-DsRed de linhagem específica, concebida para rastrear Drosophila Hemócitos 27,28 mostrou uma acumulação de células imunes em tecidos que ostentam maligna ras V12 Scrib 1 tumores (Figura 5B). Em contraste, apenas hemócitos individuais ou poucas manchas localizadas de hemócitos foram detectados no controle e V12 ras Scrib 1 JNK DN mosaico EAD e tecidos cerebrais(Figura 5A, 5C). A imunocoloração com um anticorpo pan-hemócitos anti-Hemese (H2) 29 confirmou a identidade da célula imunitária de células positivas hmlΔ-DsRed (Figura 5D, 5E). Consistente com relatórios publicados 12,23,24, quantificação imparcial de invasividade tumoral corroborada um papel central de sinalização JNK, em promover a invasão do tumor para dentro dos lobos cerebrais adjacentes e VNC (Figura 3C). Finalmente, o ARN total foi isolado a partir do mosaico EAD. As amostras foram sujeitas tanto a qRT-PCR ou analisados em um sistema de electroforese automatizada para a qualidade e quantidade. A Figura 6A mostra a regulação positiva dependente da JNK significativa de metaloproteinase de matriz 1 (MMP1) transcrito em EAD rolamento ras V12 Scrib 1 tumores clonais malignos, confirmando o anteriormente resultados publicados 12,24,30,31. Avaliação de ARN total utilizando um sistema de electroforese automatizada mostrou tchapéu três amostras EAD independentes tinha um rácio 28S / 18S acima de 1,8 (Figura 6B). No entanto, a EAD 2 de ARN foi parcialmente degradado, reflectida por uma mancha no gel (Figura 6C). Em contraste, a amostra de EAD 3 tinha uma concentração baixa. Várias bandas de peso molecular mais elevado de imagem em gel (Figura 6B) e pequenos picos no electroferograma (Figura 6C) em, sugeriu também a contaminação de ADN. Assim, apenas uma amostra de EAD seria adequado para uma preparação da biblioteca de ARNm-SEQ. <img alt="figura 1" src="/files/ftp_upload/54585/54585fig1.jpg" /> Figura 1: Esquema do sistema marcm para a geração de mosaicos genéticos na Drosophila EAD e aplicações a jusante (A) O sistema marcm permite a geração de remendos clonais com lesões genéticas definidos em um tipo de outra forma selvagem (heterozigotos).contexto. A expressão de FLP sob o controlo de um promotor específico de tecidos (por exemplo, sem olhos) catalisa a recombinação entre os dois elementos FRT flanqueiam a cassete de PARAGEM marcado com um gene de cor amarela (Y) (ato&gt; y +&gt; Gal4). Após a remoção da cassete de STOP, o ubiquamente expressa Gal4 activador transcricional (ACT-Gal4) pode conduzir a expressão de qualquer transgene UAS-base, tal como UAS-GFP (V12 também UAS-ras). Numa célula parental, no entanto, a actividade de GAL4 é bloqueado por um repressor Gal80 cuja expressão é controlada por um promotor da tubulina (banheira-Gal80). Na fase G2 do ciclo celular, FLP medeia a troca dos cromatídeos irmãos não entre os cromossomas homólogos distais para os locais DRF. A segregação dos cromossomas durante a mitose recombinantes darão origem a duas células filhas, sendo um mutante homozigótico para um locus de genoma em particular (por exemplo, Scrib <s<html> -se&gt; 1), enquanto o outro vai levar dois alelos de tipo selvagem. Perda de Gal80 nas células mutantes homozigóticos vai permitir a expressão de GFP. Em contraste, um tipo selvagem permanece irmã GFP-negativo. (B) um desenho esquemático de uma terceira larvas instar descreve o par EAD ligado anteriormente para os ganchos na boca e posteriormente para o cérebro através de hastes óptica. O sistema eyFLP-marcm induz clones marcadas com GFP dentro do EAD eo neuroepithelium dos lóbulos cerebrais. (C) dissecado EAD e cérebros pode ser submetido a diversas aplicações a jusante, incluindo imunoquímica e a detecção da actividade repórter transgénico (I), a quantificação de invasividade tumoral (II) e perfis transcriptoma usando um candidato (qRT-PCR) ou uma abordagem imparcial (ARNm -seq) (iii). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54585/54585fig1large.jpg" target="_blank">por favor clique aqui para ver uma versão maior desta figura.</a> <html> &quot;Fo: manter-together.within-page =&quot; 1 &quot;&gt; <img alt="Figura 2" src="/files/ftp_upload/54585/54585fig2.jpg" /> Figura 2: Triagem de larvas de terceiro estádio e exemplos representativos de EAD e EAD / complexos do cérebro usadas para diferentes aplicações a jusante (AB) micrografias fluorescentes de terceiro instar de controlo do rolamento larvas clones marcado com GFP induzidas com o testador eyFLP-marcm 82B Green.. (A) larva controle Representante com clones restritos ao DAE e cerebrais lobos. (B) um exemplo de um &quot;larva leopardo&quot; transportando os clones GFP-positiva em diversos tecidos em todo o corpo. Imagens (C) de campo claro de EAD dissecados e complexos (D) EAD / cérebro associadas aos ganchos da boca, e (E) EAD limpos de todos os tecidos estranhos, incluindo ganchos boca. Barras de escala = 2 mm (AB) e 500 uM (CE).fig2large.jpg &quot;target =&quot; _ blank &quot;&gt; Clique aqui para ver uma versão maior desta figura. <img alt="Figura 3" src="/files/ftp_upload/54585/54585fig3.jpg" /> Figura 3:. Quantificação da invasividade do tumor (A) imagens confocais fluorescentes de cérebros dissecados de Ras V12 Scrib 1 larvas (7 dias ul) representam os exemplos reais dos quatro graus diferentes de invasividade tumoral variando de não-invasiva (Pontuação 0), um lobo cerebral invadido (escore 1), ambos os lóbulos cerebrais invadidas (escore 2) para uma invasão tumoral forte com o tecido clonal cobrindo ambos os lóbulos cerebrais e entrar no VNC (escore 3). As imagens são projeções de várias seções confocal e exemplos para Score 2 e 3 são costuradas a partir de 2 x 2 imagens confocal. Barras de escala = 100 mm. (B) Um exemplo de uma lâmina de microscópio anónimos com cérebros fixos utilizados para imparcialmarcando sob estereomicroscópio fluorescente. cérebros marcados são marcados com uma caneta para evitar o registo duplicado. Barra de escala = 500 mm (C) Comparado com alto poder invasivo ras V12 Scrib 1 tumores, a inibição da JNK sinalização (ras V12 Scrib 1 jnk DN) de invasão eliminado de células clonais. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54585/54585fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/54585/54585fig4.jpg" /> Figura 4: A activação da transcrição do repórter TRE-DsRed em &#39;V12&#39; ras 1 malignas tumores clonais &#39;Scrib é dependente da JNK (A. </strong&gt;) No EAD controlo (6 dias AEL), o repórter TRE-DsRed sensível ao JNK marcado uma faixa estreita de células que funcionam a partir da antena a uma parte do olho (setas). (B) A actividade do repórter TRE-DsRed foi marcadamente melhorado em Ras V12 Scrib 1 clones GFP-positiva em comparação com o epitélio circundante EAD não clonal. (C) Inibição de actividade de JNK resultou numa redução clara da intensidade do sinal DsRed em Ras V12 Scrib 1 JNK clones DN. (D) o reforço do sinal DsRed revelou ativação não-autónoma de JNK sinalização em células que cercam as ras V12 Scrib 1 JNK clones DN. (E) No dia 8 AEL, ras V12 Scrib 1 células overgrew todo o EAD e espalhar sobre os lóbulos cerebrais para o VNC (seta). (F) As células clonais invadindo o VNC (close-up da região marked pela seta em E), foram enriquecidas para o sinal de DsRed. (AC) Mostrar projeções de várias seções confocal, (E) é costurada a partir de imagens confocal 3x3 e (D, F) representam única seção. Barras de escala = 50 uM. EAD, olho / disco da antena; BL, lóbulo cerebral; VNC, cordão nervoso ventral. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54585/54585fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/54585/54585fig5.jpg" /> Figura 5:. De linhagem específica HML Δ -DsRed repórter transgénico revela o enriquecimento de Ras V12 Scrib 1 hemócitos associado a um tumor (A) Em EAD controlo, hmlΔ-DsRed Clu hemócitos repórter marcado<html> sters estão presas nas cavidades do olho e do epitélio das antenas. Tecido EAD e do cérebro composto de Scrib ras V12 (B) 1 tumores marcadas com GFP mostrou um aumento do número de hemócitos espalhados por todo o tecido clonal. (C) O número de hemócitos associado diminuiu drasticamente após a inibição da sinalização JNK em Ras V12 Scrib 1 jnk DN tecido mosaico. Hemócitos positivos (DE) HmlΔ-DsRed também foram marcados com um anticorpo que detecta o H2 Hemese marcador pan-hemócitos. (AC) Mostrar projeções de seções múltiplas confocal, (A) é costurada a partir de 2 x 2 e (BC) são costuradas a partir de 3 x 3 imagens confocal. (DE) Representar seções individuais. Barras de escala = 100 mm (AC) e 10 mm (DE). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54585/54585fig5large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> e_content &quot;fo: manter-together.within-page =&quot; 1 &quot;&gt; <img alt="Figura 6" src="/files/ftp_upload/54585/54585fig6.jpg" /> Figura 6:.. A avaliação da qualidade e quantidade de ARN total isolado a partir de EAD dissecados (A) Um exemplo representativo dos resultados de qRT-PCR utilizando quatro réplicas biológicas para cada genótipo níveis de transcritos foram normalizados para MMP1 rp49. Dobram mudanças na expressão gênica foram calculados utilizando o padrão relativo método da curva 32. Os dados são valores médios ± SEM; *** P &lt;0,001 pelo teste t bicaudal não pareado de Student com variância desigual. (B, C) Avaliação da qualidade do RNA total e quantidade usando um sistema de eletroforese automatizada. A imagem do gel virtual (B) mostra as duas bandas proeminentes das 18S e 28S ARNr que correspondem aos picos bem definidos no electroferogramas (C). contaminação de ADN e da degradação de ARN são reflectidas pelas quantoMear (setas) e bandas supranumerários e picos (setas). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54585/54585fig6large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> linhagens de moscas </td><td> Fonte / Comentários </td></tr><tr><td> eyFLP1; act&gt; y +&gt; Gal4, UAS-GFP; FRT82B, banheira-Gal80 </td><td> eyFLP-marcm 82B Verde Tester 11 </td></tr><tr><td> W; UAS-Ras V12; FRT82B Scrib 1 / TM6B </td><td> 12 </td></tr><tr><td> W; UAS-Ras V12; UAS-jnk DN FRT82B Scrib 1 / TM6B </td><td> 12 </td></tr><tr><td> W; hmlΔ-DsRed; FRT82B </td><td> Neste estudo, W; hmlΔ-DsRed de Katja Brückner 28 </td></tr><tr><td> W; UAS-Ras V12 hmlΔ-DsRed; FRT82B Scrib 1 / TM6B </td><td> este estudo </td></tr><tr><td> W; UAS-Ras V12 hmlΔ-DsRed; UAS-jnk DN FRT82B Scrib 1 / TM6B </td><td> este estudo </td></tr><tr><td> W; TRE-DsRed; FRT82B </td><td> Neste estudo, W; TRE-DsRed de Dirk Bohmann 26 </td></tr><tr><td> W; UAS-Ras V12 TRE-DsRed; FRT82B Scrib 1 / TM6B </td><td> este estudo </td></tr><tr><td> W; UAS-Ras V12 TRE-DsRed; UAS-jnk DN FRT82B Scrib 1 / TM6B </td><td> este estudo </td></tr></tbody></table> Tabela 1: Resumo das linhas de Drosophila utilizadas neste estudo.

Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Este protocolo demonstra como gerar tumores clonais fluorescente marcada, geneticamente definidas no Drosophila olho / discos imaginais antenares (DAE). Ele descreve como dissecar o EAD e do cérebro a partir do terceiro larvas e como processá-los para visualizar e quantificar as mudanças de expressão gênica e invasão tumoral.

o<em&gt; Drosophila</em&gt; Imaginal Modelo Disc Tumor: visualização e quantificação da expressão gênica e invasão tumoral Usando Mosaicos Genéticos

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

the-drosophila-imaginal-disc-tumor-model-visualization-quantification

Nanyang Technological University

Research

JoVE Journal

Cancer Research

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

11.0K visualizações.  University of Cologne.  Este protocolo demonstra como gerar tumores clonais fluorescente marcada, geneticamente definidas no Drosophila olho / discos imaginais antenares (DAE). Ele descreve como dissecar o EAD e do cérebro a partir do terceiro larvas e como processá-los para visualizar e quantificar as mudanças de expressão gênica e invasão tumoral. 

Vídeo: The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified to secrete human Prostate Specific Antigen (PSA), and the procedure for the confirmation of tumor implantation. In brief, mice are anesthetized using injectable drugs and are made to lay in the dorsal position. Urine is vacated from the bladder and 50 &#181;L of poly-L-lysine (PLL) is slowly instilled at a rate of 10 &#181;L/20 s using a 24 G IV catheter. It is left in the bladder for 20 min by stoppering the catheter. The catheter is removed and PLL is vacated by gentle pressure on the bladder. This is followed by instillation of the murine bladder cancer cell line (1 x 105 cells/50 &#181;L) at a rate of 10 &#181;L/20 s. The catheter is stoppered to prevent premature evacuation. After 1 h, the mice are revived with a reversal drug, and the bladder is vacated. The slow instillation rate is important, as it reduces vesico-ureteral reflux, which can cause tumors to occur in the upper urinary tract and in the kidneys. The cell line should be well re-suspended to reduce clumping of cells, as this can lead to uneven tumor sizes after implantation.
This technique induces tumors with high efficiency. Tumor growth is monitored by urinary PSA secretion. PSA marker monitoring is more reliable than ultrasound or fluorescence imaging for the detection of the presence of tumors in the bladder. Tumors in mice generally reach a maximum size that negatively impacts health by about 3 - 4 weeks if left untreated. By monitoring tumor growth, it is possible to differentiate mice that were cured from those that were not successfully implanted with tumors. With only end-point analysis, the latter may be mistakenly assumed to have been cured by therapy.

This protocol describes the generation of murine orthotopic bladder tumors in female C57BL/6J mice and the monitoring of tumor growth.

Um modelo de tumor de murino de bexiga ortotópico e Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Pesquisa do câncer

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue organization. Drosophila melanogaster has emerged as a popular experimental model system in cancer biology to study the genetic and cellular mechanisms of tumorigenesis. In particular, genetic tools for Drosophila imaginal discs (developing epithelia in larvae) enable the creation of transformed pro-tumor cells within a normal epithelial tissue, a situation similar to the initial stages of human cancer. A recent study of tumorigenesis in Drosophila wing imaginal discs, however, showed that tumor initiation depends on the tissue-intrinsic cytoarchitecture and the local microenvironment, suggesting that it is important to consider the region-specific susceptibility to tumorigenic stimuli in evaluating tumor phenotypes in imaginal discs. To facilitate phenotypic analysis of tumor progression in imaginal discs, here we describe a protocol for genetic experiments using the GAL4-UAS system to induce neoplastic tumors in wing imaginal discs. We further introduce a diagnosis method to classify the phenotypes of clonal lesions induced in imaginal epithelia, as a clear classification method to discriminate various stages of tumor progression (such as hyperplasia, dysplasia, or neoplasia) had not been described before. These methods might be broadly applicable to the clonal analysis of tumor phenotypes in various organs in Drosophila.

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Mosaic clone analysis in Drosophila imaginal disc epithelia is a powerful model system to study the genetic and cellular mechanisms of tumorigenesis. Here we describe a protocol to induce tumors in Drosophila wing imaginal discs using the GAL4-UAS system, and introduce a diagnosis method to classify the tumor phenotypes.

Indução e diagnóstico de tumores em<em&gt; Drosophila</em&gt; Epitelio do disco imaginal

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue ...

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, in the case that the KD of the protein of interest has a lethal effect on cells or the anticipated effect of the KD is time-dependent, unconditional KD methods are not appropriate. Conditional systems are more suitable in these cases and have been the subject of much interest. These include Ecdysone-inducible overexpression systems, Cytochrome P-450 induction system1, and the tetracycline regulated gene expression systems. 
The tetracycline regulated gene expression system enables reversible control over protein expression by induction of shRNA expression in the presence of tetracycline. In this protocol, we present an experimental design using functional Tet-ON system in human cancer cell lines for conditional regulation of gene expression. We then demonstrate the use of this system in the study of tumor cell-monocyte interaction.

This protocol serves as a scheme for setting up a functional Tet-ON system in cancer cell lines and its subsequent use, in particular for studying the role of tumor cell-derived proteins in recruitment of monocytes/macrophages to the tumor microenvironment.

Knockdown condicional de expressão gênica em linhas de células de câncer para estudar o recrutamento de monócitos/macrófagos para o microambiente do Tumor

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by CTCs critically contributes to early lung metastatic processes, has been vigorously investigated. As such, animal models are the only approach that captures the full systemic process of metastasis. Given that problems occur in previous experimental designs for examining the contributions of CTCs to blood vessel extravasation, we established an in vivo lung colonization assay in which a long-term-fluorescence cell-tracer, carboxyfluorescein succinimidyl ester (CFSE), was used to label suspended tumor cells and lung perfusion was performed to clear non-specifically trapped CTCs prior to lung removal, confocal imaging, and quantification. Polymeric fibronectin (polyFN) assembled on CTC surfaces has been found to mediate lung colonization in the final establishment of metastatic tumor tissues. Here, to specifically test the requirement of polyFN assembly on CTCs for lung colonization and extravasation, we performed short term lung colonization assays in which suspended Lewis lung carcinoma cells (LLCs) stably expressing FN-shRNA (shFN) or scramble-shRNA (shScr) and pre-labeled with 20 &#956;M of CFSE were intravenously inoculated into C57BL/6 mice. We successfully demonstrated that the abilities of shFN LLC cells to colonize the mouse lungs were significantly diminished in comparison to shScr LLC cells. Therefore, this short-term methodology may be widely applied to specifically demonstrate the ability of CTCs within the circulation to colonize the lungs.

An animal model is needed to decipher the role of circulating tumor cells (CTCs) in promoting lung colonization during cancer metastasis. Here, we established and successfully performed an in vivo assay to specifically test the requirement of polymeric fibronectin (polyFN) assembly on CTCs for lung colonization.

O estabelecimento de um ensaio de colonização de pulmão para visualização de células de Tumor nos tecidos do pulmão de circulação

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis remains incomplete. In vivo models are paramount for metastasis research, but require refinement. Tracking spontaneous metastasis by non-invasive in vivo imaging is now possible, but remains challenging as it requires long-time observation and high sensitivity. We describe a longitudinal combined radionuclide and fluorescence whole-body in vivo imaging approach for tracking tumor progression and spontaneous metastasis. This reporter gene methodology employs the sodium iodide symporter (NIS) fused to a fluorescent protein (FP). Cancer cells are engineered to stably express NIS-FP followed by selection based on fluorescence-activated cell sorting. Corresponding tumor models are established in mice. NIS-FP expressing cancer cells are tracked non-invasively in vivo at the whole-body level by positron emission tomography (PET) using the NIS radiotracer [18F]BF4-. PET is currently the most sensitive in vivo imaging technology available at this scale and enables reliable and absolute quantification. Current methods either rely on large cohorts of animals that are euthanized for metastasis assessment at varying time points, or rely on barely quantifiable 2D imaging. The advantages of the described method are: (i) highly sensitive non-invasive in vivo 3D PET imaging and quantification, (ii) automated PET tracer production, (iii) a significant reduction in required animal numbers due to repeat imaging options, (iv) the acquisition of paired data from subsequent imaging sessions providing better statistical data, and (v) the intrinsic option for ex vivo confirmation of cancer cells in tissues by fluorescence microscopy or cytometry. In this protocol, we describe all steps required for routine NIS-FP-afforded non-invasive in vivo cancer cell tracking using PET/CT and ex vivo confirmation of in vivo results. This protocol has applications beyond cancer research whenever in vivo localization, expansion and long-time monitoring of a cell population is of interest.

We describe a protocol for preclinical in vivo tracking of cancer metastasis. It is based on a radionuclide-fluorescence reporter combining the sodium iodide symporter, detected by non-invasive [18F]tetrafluoroborate-PET, and a fluorescent protein for streamlined ex vivo confirmation. The method is applicable for preclinical in vivo cell tracking beyond tumor biology.

Radionuclídeo-fluorescência Gene do repórter de imagem para controlar a progressão do Tumor em modelos de roedores Tumor

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Acellular and Cellular Lung Model to Study Tumor Metastasis

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor cells with a natural matrix and continual flow of nutrients, as well as a model that shows the interaction of tumor cells with normal cellular components and a natural matrix. The acellular ex vivo lung model is created by isolating a rat heart-lung block and removing all the cells using the decellularization process. The right main bronchus is tied off and tumor cells are placed in the trachea by a syringe. The cells move and populate the left lung. The lung is then placed in a bioreactor where the pulmonary artery receives a continual flow of media in a closed circuit. The tumor grown on the left lung is the primary tumor. The tumor cells that are isolated in the circulating media are circulating tumor cells and the tumor cells in the right lung are metastatic lesions. The cellular ex vivo lung model is created by skipping the decellularization process. Each model can be used to answer different research questions.

Here, we present a protocol for an ex vivo lung cancer model that mimics the steps of tumor progression and helps to isolate a primary tumor, circulating tumor cells, and metastatic lesions.

Modelo de pulmão acelular e celular para estudar o Tumor metástase

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

Ensaio de reação em cadeia de polimerase digital para a variação genética em paciente esporádicos polipose adenomatosa familiar usando o formato de microplaqueta-em-um-tubo

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene disruption, many of these studies have made use of complex gene knockout models. While these studies with knockout mice offer an elegant and time-tested system for investigating genotype-to-phenotype relationships, a rapid and scalable method for assessing candidate genes that play a role in AML cell proliferation or survival in AML models will help accelerate the parallel interrogation of multiple candidate genes. Recent advances in genome-editing technologies have dramatically enhanced our ability to perform genetic perturbations at an unprecedented scale. One such system of genome editing is the CRISPR-Cas9-based method that can be used to make rapid and efficacious alterations in the target cell genome. The ease and scalability of CRISPR/Cas9-mediated gene-deletion makes it one of the most attractive techniques for the interrogation of a large number of genes in phenotypic assays. Here, we present a simple assay using CRISPR/Cas9 mediated gene-disruption combined with high-throughput flow-cytometry-based competition assays to investigate the role of genes that may play an important role in the proliferation or survival of human and murine AML cell lines.

This manuscript describes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR-Cas9-based method for simple and expeditious investigation of the role of multiple candidate genes in Acute Myeloid Leukemia (AML) cell proliferation in parallel. This technique is scalable and can be applied in other cancer cell lines as well.

Investigação de dependências genéticas utilizando ensaios de competição baseados em CRISPR-Cas9

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

The Clinical Application of Tumor Treating Fields Therapy in Glioblastoma

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% with current standard of care. Tumors often recur within 9 months following initial surgery, radiation and chemotherapy, at which point treatment options become limited. This highlights the pressing need for the development of better therapeutics to prolong survival and increase the quality of life for these patients.
Tumor Treating Fields (TTFields) therapy was developed to take advantage of the effect of low frequency alternating electrical fields on cells for cancer therapy. TTFields have been demonstrated to disrupt cells during mitosis and slow tumor growth. There is also growing evidence that they act through stimulating immune responses within exposed tumors. The advantages of TTFields therapy include its noninvasive approach and increased quality of life compared to other treatment modalities such as cytotoxic chemotherapies. The Food and Drug Administration approved TTFields therapy for the treatment of recurrent glioblastoma in 2011 and for newly diagnosed glioblastoma in 2015. We report on the effects of TTFields during mitosis, the results of electric fields modeling, and proper transducer array placement. Our protocol outlines the clinical application of TTFields on a patient post-surgery, using the second-generation device.

Glioblastoma is the most common and aggressive primary brain malignancy in adults, with most tumors recurring after initial treatment. Tumor Treating Fields (TTFields) therapy is the newest treatment modality for glioblastoma. Here, we describe the proper application of TTFields-transducer arrays on patients and discuss theory and aspects of treatment.

A aplicação clínica do Tumor, tratamento de terapia de campos em Glioblastoma

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% ...

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.