The authors have no acknowledgements.

1. Ensaio da preparação da mistura <ol><li> Faça concentrações 100 mmol / L de ações para todos os iniciadores em água de grau molecular e sondas em tampão TE pH 8 [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Nota: Sondas para os dois alvos são fluorescente etiquetado com diferentes fluoróforos 7 como indicados na Lista de materiais / equipamentos. </li><li> Prepare mistura principal misturando, por reacção planejado, 12 ul digital de mistura de PCR (2x de ações, ver Lista de materiais / equipamentos), 0,216 mL cada um para a frente e primer, 0,06 mL cada sonda fluorescente reversa e 5.016 mL de água livre de nuclease (concentração final : 900 nm cada iniciador, 250 nM cada sonda). Pipeta cima e para baixo pelo menos 10 vezes para misturar ao tomar cuidado para não introduzir bolhas de ar na solução. </li><li> Pipeta de 18 mL mix master (a partir do passo 1.2) para um tubo de PCR regular ou placa, misturando no modelo de DNA 6 ul (extraído como descrito Previously 13) para fazer mistura de ensaio para a geração de gotículas. Se a execução de amostras em duplicado, pipeta 36 ul de mistura principal e 12 molde de ADN em cada poço. Deixe os poços em duplicado correspondentes vazio sobre o prato. Incluir controlos positivos (ver lista de materiais / equipamentos) e não há controles de modelo (NTC) (ou seja, com água de grau molecular usado como modelo). Nota: O controlo positivo é necessário para assegurar que o ensaio é executado correctamente e o CNT é necessário para assegurar que não há contaminação dentro do prato e para definir a linha de base fluorescente mais tarde na análise de dados. usuários de primeira vez são recomendados para usar ambas as amostras de DNA não diluídas e diluídas. </li></ol> 2. Geração Gota e configuração da placa PCR <ol><li> Misture as misturas de ensaio pipetando cima para baixo aproximadamente 15 vezes usando uma pipeta multicanal. Certifique-se de que a ponta da pipeta permanece dentro líquido para evitar que bolhas em excesso dentro da mistura. </li><li> inscartucho de ert 1 (contendo 8 poços) em um suporte de cartucho branco e clique no suporte do cartucho fechada. Cartucho 1 é agora firmemente no lugar e não pode ser desalojado do suporte enquanto que a geração de gotículas. Usando uma pipeta multicanal, gentilmente transferir 20 l de mistura de ensaio para a posição do meio do cartucho marcado &quot;amostra&quot; sem a introdução de bolhas de ar. </li><li> Pipetar em 70 ul de óleo de geração de gotículas para o lado esquerdo do cartucho (marcado &quot;Óleo&quot;). </li><li> cartucho de tampa com uma junta de vedação para garantir que a junta de vedação é realizada de forma uniforme e plana por a quatro carraças na direcção da extremidade do cartucho. Pressione o botão de luz verde sobre o gerador de gotículas de abrir e coloque o cartucho. Pressione o botão verde iluminado novamente para fechar o gerador. Nota: Uma vez que a porta se fecha, o botão fica esmaecido, a porta não pode ser reaberto e geração de gota começa imediatamente continuando por cerca de 1 min. </li><li> Se fazendo mais de 8 reações, lugar de cartuchos 2 em um segundoo suporte do cartucho e branco preparar da mesma maneira como um cartucho enquanto a geração de gotículas está em andamento para economizar tempo total de instalação. </li><li> Abra a porta do gerador de gotículas quando o botão dim iluminada fica verde, indicando a conclusão da geração de gotículas. Retire o suporte do branco cartucho contendo cartucho 1, posta de lado, eo cartucho de lugar 2 para o gerador de gota. </li><li> Remova a junta de cartucho 1 e descarte. Suavemente transferir o volume total (aproximadamente 40 ul) de gotículas geradas a partir da terceira coluna do cartucho (marcado &#39;Gotas&#39;) para uma placa de PCR final (mantido à temperatura ambiente) durante o ciclo térmico. Nota: Não desmarque suporte do cartucho de branco como a ação pode quebrar as gotículas recém-gerados; abrir apenas o suporte do cartucho após as gotículas de ter sido transferido para a placa de final. </li><li> Repita os passos de 2,1-2,7 para amostras adicionais. </li><li> Quando todas as gotículas são na placa de PCR final, colocar uma perfurávelcobertura de alumínio em cima do prato e coloque-o sobre o selador de placa. Definir o cimento a 180 ° C, prima &#39;Play&#39; no selador e deixe selo para 10 seg. </li></ol> 3. ciclos térmicos e Leitura Gota <ol><li> Colocar a placa selada no termociclador, um compatível com a placa de PCR final utilizada no passo 2.7, e uma velocidade de rampa de temperatura de 2,0 ° C / seg. </li><li> Executar programa térmico como se segue: 10 min a 95 ° C, seguido de 40 ciclos de 30 seg a 94 ° C e 60 segundos a 60 ° C, seguido de 10 minutos de espera em 98 ° C (opcional: preensão final em 4 ou 15 ° C). </li><li> Após a conclusão dos ciclos, transferir a placa para um leitor de gota para a medição automática da fluorescência em cada gota em cada poço. Alternativamente, armazenar a placa a 4 ° C durante até 3 dias antes da leitura das gotículas. Certifique-se as gotas são à temperatura ambiente antes de prosseguir com a leitura. <ol><li> Abra o software que acompanha a configuração da leitura gota. Dentroo menu padrão &#39;Setup&#39; contendo um esquema de uma placa de 96 poços vazios, clique duas vezes no poço A1 para abrir o menu que contém três seções: &quot;amostra&quot;, &quot;Ensaio 1 &#39;e&#39; Ensaio 2. &#39; </li><li> Na seção &#39;Sample&#39; digite o ID da amostra na caixa chamada &quot;Nome&quot; e pressione enter ou marque a caixa à direita marcado &quot;Aplicar&quot;. Em seguida, clique no menu drop-down rotulados &#39;Experiment&#39; e escolha &#39;RED&#39; (detecção evento raro) e clique em entrar. </li><li> Mover para a seção indicada &quot;Ensaio 1. &#39; Na seção &#39;Nome&#39; preencher o ensaio (por exemplo, Enterococcus) e clique em entrar. Na caixa abaixo &#39;Tipo&#39; rotulado clique no menu drop-down e escolha &quot;Canal 1 Desconhecido&quot; e clique em entrar. </li><li> Mover para a seção indicada &quot;Ensaio 2. &#39; Na seção &#39;Nome&#39; preencher o ensaio (por exemplo, HF183) e clique em entrar. Na caixa abaixo rotulados &#39;Tipo&#39;, clique no menu suspenso um menud Escolha &#39;Canal 2 Desconhecido &quot;e clique em entrar. Toda a informação de Passos 3.3.2 a 3.3.4 está presente em bem A1. </li><li> Nome todos os poços subsequentes contendo gotículas. Para economizar tempo total de instalação, clique em &quot;Shift&quot; ou &quot;Ctrl&quot;, para escolher vários poços simultaneamente. </li><li> Quando a representação digital do prato espelha a placa física, pressione &quot;OK&quot; na parte inferior direita do menu. No novo menu que aparece no topo do esquema placa, na seção &#39;Modelo&#39; escolha &#39;Salvar como&#39; e o nome e salvar o prato. </li><li> À esquerda da tela, clique em &quot;Executar&quot; e escolha apropriada Set Dye em pop-out janela &quot;Opções de Execução&quot; o. A recolha de dados inicia e é exibida em tempo real no software. </li></ol></li></ol> 4. Análise de Dados e Relatórios <ol><li> Quando o leitor está terminada e uma caixa será exibida informando &#39;Run Complete&#39;, clique em &#39;OK&#39;. Nota: O softWare exibe o arquivo de dados final na seção &quot;Analisar&quot; do software. Neste ponto de vista, o software tem todos os poços na placa selecionados e padrões para trama de dados do &#39;2D Amplitude&#39;. </li><li> Verifique a separação entre as gotículas positivos e negativos. Assegure-se que a fluorescência em todas as gotículas nos poços NTC estão perto da linha de base. </li><li> Clique no botão &#39;Eventos&#39;. À direita do histograma apresentado clique na caixa chamada &quot;Total&quot; ea caixa com o nome &quot;único&quot; na parte inferior para exibir o número total de gotículas aceites por poço. Excluir quaisquer poços contendo &lt;10.000 gotículas 7, mantendo a tecla Ctrl e clicando sobre o bem (s) a ser excluído. </li><li> Clique no botão indicado como &#39;1D Amplitude&#39; para definir o limiar de fluorescência a cerca de um desvio padrão (500-700 unidades de fluorescência) acima das gotas negativos em poços NTC para ambas as metas. No lado esquerdo do ecrã under &quot;Analisar Auto &#39;o que mostra dois botões de limite, escolha o ícone à direita que tem uma linha horizontal rosa contínuo que passa por ele. </li><li> Clique na caixa à esquerda de &quot;Threshold Definir &#39;no âmbito de cada um dos gráficos de amplitude e digite os valores de limite de fluorescência apropriados. As concentrações de alvo em cópia por reacção uL são então calculados automaticamente. Nota: Os limiares não precisam ser idênticas para os diferentes alvos. </li><li> Exportar os resultados em um arquivo .csv, clicando no botão &quot;Exportar&quot; no canto superior esquerdo na tela do 1D Amplitude. No arquivo .csv, multiplicar a concentração alvo exportados por 4 a convertê-lo de cópia do alvo (23S gene de Enterococcus spp., Ou o marcador HF183) por reacção ul para copiar da meta per l modelo de DNA. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

Existem algumas etapas críticas do protocolo. Em primeiro lugar, a mistura das misturas de ensaio pode ser difícil, porque a mistura principal é mais viscoso do que misturas principais qPCR convencionais. vórtex simples pode levar a uma mistura insuficiente, o que conduz por sua vez à distribuição não uniforme de moldes de ADN nas misturas de ensaio e posteriormente nas gotículas. A técnica de mistura-por-pipetagem descrito no protocolo deve ser seguido para garantir a quantificação precisa dPCR. Em segundo lugar, é importante garantir que as gotas são gerados a uma forma e tamanho uniforme. Ser consciente de ocasiões em que o tempo, o gerador gota leva para completar a geração de gota em um cartucho é mais curto do que o habitual. Isso pode indicar geração de gotículas abaixo do ideal. Se necessário, o tempo de geração gota em cada cartucho pode ser gravado para solução de problemas. Em terceiro lugar, é importante para transferir toda a 40 ul de gotículas geradas a partir do cartucho para a placa de PCR final sem cisalhamento dagotículas e evitar para não ter gotículas suficientes para quantificação. As técnicas seguintes podem ser utilizados para a transferência: 1) Coloque a pipeta multicanal para 40 uL e inserir as pontas para a secção direita do cartucho (marcado &#39;Gotas&#39;) a um ângulo de 45 °; 2) Pipetar as gotas lentamente e garantir que todas as gotículas são pipetados para cima (tomar nota, se as gotas são deixados para trás e precisam ser pipetados-se para uma segunda rodada); 3) Uma vez que as gotículas são removidos, transferi-los para a placa final pelo colocando a ponta da pipeta contra a parede do poço, aproximadamente, a meio caminho para baixo e expelir as gotículas lentamente. O ensaio EntHF183 duplex dPCR tem grandes vantagens sobre os ensaios de qPCR individuais existentes para os mesmos analitos. Em primeiro lugar, o ensaio dPCR duplex não precisa de curvas padrão para quantificar incógnitas, eliminando preconceitos quantificação qPCR associados à variabilidade nos padrões 7. Em segundo lugar, o ensaio dPCR duplex pode tolerar inibemou concentrações que são uma a duas ordens de grandeza maior do que a tolerada pelos ensaios qPCR 7 correspondentes. Esta característica faz com que o ensaio dPCR duplex muito atraente para a análise de amostras ambientais (por exemplo, amostras de águas pluviais) que muitas vezes contêm substâncias inibidoras de PCR. Em terceiro lugar, a capacidade de quantificar simultaneamente Enterococcus spp. E o marcador HF183 em um ensaio dPCR duplex (comparada com a quantificar os separadamente em dois ensaios qPCR) é mais rentável 7 e melhora a quantidade de dados, evitando a variabilidade associada com pipetagem acumulativo realização de dois ensaios separados (vs. um duplex ensaio dPCR). Em quarto lugar, o ensaio dPCR duplex também demonstraram uma maior precisão e repetibilidade em comparação com os ensaios de qPCR correspondentes, fazendo com que o primeiro uma boa alternativa em estudos comparativos 7. No entanto, existem limitações para este método (vantagens e limitações descritos em detalheoutras posições 7). Em primeiro lugar, o número de gotículas aceites por reacção determina o limite de quantificação superior (UQL) de dPCR. O instrumento dPCR usado neste trabalho (consulte a lista de materiais / equipamentos) foi relatado para ter um UQL de 10 5 cópias por reacção. Isto corresponde a 5 x 10 5 células de Enterococcus e 2 x 10 6 HF183 cópias por 100 ml de água, assumindo a anteriormente 7 descritos protocolo de extracção de DNA é seguido e 100 ADN ul é obtida (isto é, por o passo de eluição durante a extracção de ADN) a partir de 100 ml de água sem qualquer perda durante o processamento da amostra antes da dPCR 7. Águas ambientais geralmente não ultrapassam essas concentrações de Enterococcus e HF183. No entanto, a diluição da amostra deve ser considerada para amostras de concentração elevada, como fezes de animais, esgoto e amostras de água coletadas imediatamente após um vazamento de esgoto. Em segundo lugar, as altas concentrações de ADN total (includitanto ng de ADN alvo e não-alvo) pode interferir com o processo de particionamento gota. Não é aconselhável usar mais do que 66 ng DNA total sem pré-tratamento por enzimas de restrição 7. Em terceiro lugar, embora o ensaio EntHF183 duplex dPCR é significativamente mais robusta contra a inibição de qPCR, este ensaio pode ainda produzir resultados falsos negativos se a inibição grave impede que a amplificação por PCR ocorra. medidas de controle de inibição, portanto, ainda devem ser implementadas. Métodos de adição ou de diluições do padrão, tal como descrito anteriormente podem ser utilizados para avaliar a inibição 7. Última, o ensaio duplex só foi validado em uma plataforma dPCR e validação do método deve ser realizada em outras plataformas digitais de PCR antes do uso. Este é o primeiro ensaio digitais duplex publicada PCR que quantifica simultaneamente um indicador de qualidade da água amplamente aceito e um marcador associado-host popular para a contaminação fecal 7. As vantagens demonstradasdo EntHF183 duplex dPCR ensaio promessa outras aplicações úteis da tecnologia PCR digitais em rastreamento de origem microbiana, a detecção de patógenos e genes de resistência a antibióticos. Por exemplo, um indicador geral de fezes (Enterococcus spp., E. coli, Bacteroidales geral) e um marcador fecal associada-hospedeiro (HF183, HumM2, CowM2, LeeSeagull) 2 pode ser emparelhado semelhante (como no ensaio EntHF183 duplex dPCR) em um ensaio dPCR duplex por mais rentável e quantificação precisa de contaminação fecal geral e associada ao host. Microbianas marcadores de rastreamento de fonte de segmentação da mesma fonte (ou fontes diferentes) também pode ser emparelhado no ensaio dPCR duplex para aumentar a confiança na detecção da origem fecal (ou obter informações sobre várias fontes fecais simultaneamente). O maior tolerância contra inibidores da PCR também pode permitir a análise do volume de amostra mais alta para aumentar a probabilidade de detecção de patógenos que têm doses infectantes baixos, mas só estão presentes em environmental água em concentrações baixas. vantagens metodológicas semelhantes de PCR digital sobre qPCR poderia também se aplicam para o desenvolvimento de ensaios de PCR digitais para quantificação de genes de resistência a antibióticos.

Os métodos quantitativos de PCR (qPCR) têm sido amplamente utilizados para a monitorização da qualidade da água de recreio e aplicações de monitorização de origem microbiana, porque eles são mais rápidos, mais flexível e específica em comparação com os métodos baseados em cultura tradicionais. Consequentemente, qPCR é recomendado para a obtenção de resultados de monitorização das águas rápidas para os indicadores fecais gerais, tais como Enterococcus spp. Nos critérios de qualidade revistos USEPA águas de recreio 1. Muitos ensaios qPCR também têm sido desenvolvidos e validados para a identificação de fontes de contaminação fecal em águas ambientais 2. Entre estes, os ensaios HF183 marcadores estão entre os mais utilizados para identificar a contaminação fecal associada a 3 humano. No entanto, os resultados qPCR muitas vezes pode ser tendenciosa, porque dependem de curvas padrão para a quantificação. qPCR quantifica concentrações desconhecidas do alvo em amostras por interpolação seu ciclo de quantificação (CQ) de um standard curva que descreve uma relação linear entre a quantidade Cq e logarítmica de um conjunto de padrões diluído seriadamente. Falta de material de referência confiável e consistente pode, portanto, viés bastante resultados qPCR. Estudos mostraram que os resultados qPCR diferiram em aproximadamente metade de um log usando padrões de diferentes fornecedores 4 e por 2 vezes utilizando diferentes lotes de padrões do mesmo fornecedor 5. A tecnologia digital PCR (dPCR) quantifica uma amostra desconhecida, contando a frequência de positivos em grande número de PCRs em miniatura que são gerados pelo particionamento de um qPCR em massa para milhares ou milhões de nanoliter uniforme ou reações picolitros 6. É referido como PCR gota digitais (isto é, neste artigo) ou PCR câmara digital de, respectivamente, se as divisórias são água-em-óleo de gotículas (isto é, neste artigo) ou pequenas câmaras sobre um chip. A concentração da amostra mais elevada resultará na presença de ADN alvo(PCR daí positiva), numa proporção superior das divisórias, uma relação aproximada pela distribuição de Poisson. Como tal, os resultados binários (PCR positiva ou negativa) são registados e a frequência de gotículas de positivos é usado para calcular as concentrações das amostras desconhecidas directamente através de Poisson aproximação, eliminando a necessidade de uma curva padrão como no qPCR. Esta natureza binária de quantificação PCR digital proporciona vantagens adicionais sobre qPCR 7. Uma vez que a amplificação atrasada pode ainda produzir um PCR positivo, dPCR quantificação seja mais robusto contra inibição que reduz a eficiência de amplificação. Da mesma forma, dPCR quantificação não é afectado pela variabilidade em valores Cq como é qPCR, levando a uma maior precisão da dPCR em comparação com 8-10 qPCR. Além disso, o processo de particionamento garante uma muito pequena quantidade de ADN presente alvo em cada gotícula, minimizando eficazmente competição pelo substrato (durante amplification de alvos diferentes de DNA) que são obstáculos comuns para alcançar duplex (ou seja, um ensaio mede simultaneamente dois alvos de ADN) em qPCR. Como tal, se executado em duplex ou simplex (ou seja, um alvo é medido em um único ensaio) dPCR produz quantificação quase indistinguível de ambos os alvos 7,11. O objetivo do ensaio de PCR digitais (EntHF183 dPCR) descrito neste artigo é a obtenção de quantificação direta simultânea do indicador fecal geral Enterococcus spp. E o marcador HF183 humano-fecal associada a uma melhor precisão, reprodutibilidade e robustez contra a inibição em comparação com seu qPCR homólogos. Este ensaio tem sido usado com sucesso para quantificar a contaminação fecal no ambiente de água doce, água do mar, e vários material fecal 7, mas também pode ser aplicado a quaisquer outros tipos de águas e águas residuais. Este ensaio é uma grande promessa para a análise de sedimentos ou solos devido a eles elevada tolerância à inibição, mas mais testes é necessária devido às complexidades de inibidor mistura nestes tipos de amostras.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Este manuscrito descreve um ensaio de PCR digitais duplex (EntHF183 dPCR) para a quantificação simultânea de Enterococcus spp. E o marcador HF183 fecal-associado humana. O EntHF183 duplex dPCR (referido como EntHF183 dPCR hereon) ensaio utiliza as mesmas sequências de Iniciador e Sonda como as suas congéneres PCR quantitativo (qPCR) individuais publicados. Da mesma forma, os mesmos procedimentos de filtragem de água e extração de DNA como realizados antes da qPCR são seguidos antes de executar dPCR. No entanto, o ensaio dPCR duplex tem várias vantagens sobre os ensaios de qPCR. Mais importante, o ensaio dPCR elimina a necessidade de execução de uma curva padrão e, por conseguinte, a polarização e variabilidade associada, por quantificação directa dos seus alvos. Além disso, embora a impressão duplex (isto é quantificação simultânea) Enterococcus e HF183 em qPCR muitas vezes leva a subestimação grave do alvo menos abundantes em uma amostra, dPCR fornece quantificação consistente de ambos os alvos, aguçarela quantificada individualmente ou simultaneamente na mesma reacção. O ensaio dPCR também é capaz de tolerar concentrações de inibidor de PCR que são uma a duas ordens de magnitude maior do que as toleradas por qPCR. Estas vantagens tornam o ensaio EntHF183 dPCR particularmente atraente porque fornece simultaneamente informações precisas e repetíveis em ambos contaminação geral e associada humano-fecal em águas ambientais, sem a necessidade de executar dois ensaios qPCR separadas. Apesar das suas vantagens sobre qPCR, o limite de quantificação do ensaio superior dPCR com instrumentação actualmente disponível é aproximadamente quatro ordens de grandeza menor do que a alcançável por qPCR. Por conseguinte, a diluição é necessário para a medição de concentrações elevadas de organismos alvo, tais como aqueles tipicamente observado após a derrames de esgoto.

Um bom EntHF183 duplex dPCR execução deve resultar em número relativamente elevado de gotículas aceites (cerca de 10,000-17,000) e diferença relativamente grande (cerca de 5,000) entre os valores de fluorescência para gotas negativos e positivos 7. Invulgarmente baixo número de gotículas provavelmente indica problemas no processo de geração de gotículas, e um limite de exclusão de 10.000 gotículas é sugerida com base em dados empíricos do sistema dPCR gotícula usado neste artigo. Uma separação mais fraco (ou seja, menor diferença de fluorescência) entre gotículas positivas e negativas pode indicar inibição ou sondas degradadas 7. Em geral, o ensaio EntHF183 duplex dPCR produz resultados altamente comparável ao que a partir de qPCR simplex quando qPCR é corrigido para desvios associados com as normas e não há nenhuma inibição 7. Os resultados do ensaio EntHF183 duplex dPCR e do CRrespondem ensaios simplex dPCR são altamente consistente e frequentemente indistinguíveis entre os dois formatos de 7 (Figura 1). Além disso, o ensaio de dPCR também podem tolerar concentrações de inibidor de uma a duas ordens de grandeza maior do que a tolerada pelos seus homólogos qPCR 7 (Figura 2). <img alt="figura 1" src="/files/ftp_upload/53611/53611fig1.jpg" /> Figura 1:. Quantificação de amostras de fezes e água, o ensaio EntHF183 duplex dPCR e ensaios dPCR simplex correspondente esquerda e painéis da direita exibir Enterococcus e quantificação HF183, respectivamente, com os coeficientes de correlação correspondentes (p &lt;0,001) entre duplex e os resultados simplex. As linhas contínuas indicam as linhas de regressão e o sombreado cinza indica os correspondentes erros padrão. Os símbolos indicam diferentes tipos de amostras (círculos, triângulo<html> s e cruzes denotam fecal, de água doce, e as amostras de água marinha, respectivamente). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53611/53611fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/53611/53611fig2.jpg" /> Figura 2: Simplex qPCR e duplex dPCR quantificação do marcador no DNA HF183 esgoto limpo cravado com concentrações crescentes de inibidores de PCR (ácido húmico) Triângulos e X-cruzes indicam dPCR qPCR e quantificação, respectivamente.. A quantificação HF183 esperado na ausência de inibidores é definido como um intervalo de confiança de 95% (isto é, entre as duas linhas tracejadas horizontais). Um &quot;1&quot; indica resultado não-detecção. Enterococcus quantificação mostra de forma semelhante, maior tolerância a inibidores de pelo ensaio EntHF183 duplex dPCR de pelo ensaio qPCR correspondente 7.= &quot;Https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53611/53611fig2large.jpg&quot; target = &quot;_ blank&quot;&gt; Clique aqui para ver uma versão maior desta figura.

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Este manuscrito descreve um ensaio de PCR digital duplex que pode ser utilizado para quantificar simultaneamente Enterococcus spp. E os marcadores genéticos HF183 como indicadores de contaminação fecal humana em geral e associada-em águas de recreio.

Um ensaio de PCR Duplex Digital para a simultânea Quantificação da<em&gt; Enterococcus spp.</em&gt; Ea Human Fecal-associado HF183 marcador no Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Nanyang Technological University

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K visualizações.  Southern California Costal Water Research Project Authority.  Este manuscrito descreve um ensaio de PCR digital duplex que pode ser utilizado para quantificar simultaneamente Enterococcus spp. E os marcadores genéticos HF183 como indicadores de contaminação fecal humana em geral e associada-em águas de recreio. 

Vídeo: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Much of the nutrient cycling and carbon processing in natural environments occurs through the activity of extracellular enzymes released by microorganisms. Thus, measurement of the activity of these extracellular enzymes can give insights into the rates of ecosystem level processes, such as organic matter decomposition or nitrogen and phosphorus mineralization. Assays of extracellular enzyme activity in environmental samples typically involve exposing the samples to artificial colorimetric or fluorometric substrates and tracking the rate of substrate hydrolysis. Here we describe microplate based methods for these procedures that allow the analysis of large numbers of samples within a short time frame. Samples are allowed to react with artificial substrates within 96-well microplates or deep well microplate blocks, and enzyme activity is subsequently determined by absorption or fluorescence of the resulting end product using a typical microplate reader or fluorometer. Such high throughput procedures not only facilitate comparisons between spatially separate sites or ecosystems, but also substantially reduce the cost of such assays by reducing overall reagent volumes needed per sample.

Microplate based procedures are described for the colorimetric or fluorometric analysis of extracellular enzyme activity. These procedures allow for the rapid assay of such activity in large numbers of environmental samples within a manageable time frame.

Determinação da Microbial Extracelular Enzyme actividade nas águas, solos e sedimentos, utilizando alta taxa de transferência de microplaca Ensaios

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Ambiente

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist&#160;of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (&#181;PADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the &#181;PAD. Alternatively, digital images of the reacted &#181;PADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24&#160;hr), justifying its use as an initial screening method for the microbiological quality of agricultural water.

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

A protocol involving integrated concentration, enrichment, and end-point colorimetric detection of foodborne pathogens in large volumes of agricultural water is presented here. Water is filtered through Modified Moore Swabs (MMS), enriched with selective or non-selective media, and detection is performed using paper-based analytical devices (&#181;PAD) imbedded with bacterial-indicative colorimetric substrates.

Papel colorimétrico à base de Detecção de<em&gt; Escherichia coli</em&gt;,<em&gt; Salmonella</em&gt; Spp. E<em&gt; Listeria monocytogenes</em&gt; A partir de grandes volumes de água Agrícola

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with &#39;end-point&#39; PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. The methodology includes the co-extraction of DNA and RNA; preparation of DNA-free RNA; and 16S rRNA gene and transcript quantification via RT-q-PCR, including standard curve construction.

DNA-RNA simultânea de extração de sedimentos costeiros e quantificação de 16S rRNA genes e transcritos por PCR em tempo real

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination control. Developments of some techniques aiming to reduce trace metal contamination in the last couple of decades have resulted in concentrations reported now being orders of magnitude lower than those in the past. These low concentrations often necessitate preconcentration of water samples prior to instrumental analysis of samples. Since contamination can appear in all phases of trace metal analyses, including sample collection (and during preparation of sampling containers), storage and handling, pretreatments, and instrumental analysis, specific care needs to be taken in order to reduce contamination levels at all steps. The effort to develop and utilize "clean techniques" in trace metal studies allows scientists to investigate trace metal distributions and chemical and biological behavior in greater details. This advancement also provides the required accuracy and precision of trace metal data allowing for environmental conditions to be related to trace metal concentrations in aquatic environments.
This protocol that is presented here details needed materials for sample preparation, sample collection, sample pretreatment including preconcentration, and instrumental analysis. By reducing contamination throughout all phases mentioned above for trace metal analysis, much lower detection limits and thus accuracy can be achieved. The effectiveness of "clean techniques" is further demonstrated using low field blanks and good recoveries for standard reference material. The data quality that can be obtained thus enables the assessment of trace metal distributions and their relationships to environmental parameters.

Special care using "clean techniques" is required to properly collect and process water samples for trace metal studies in aquatic environments. A protocol for sampling, processing, and analytical procedures with the aim of obtaining reliable environmental monitoring data and results with high sensitivity for detailed trace metal studies is presented.

Limpo Amostragem e Análise do Rio e Estuarina Waters de Estudos de metal de rastreamento

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of scientific publications address microplastic pollution of the sea surface. The protocol below describes the methodology for sampling, sample preparation, separation and chemical identification of microplastic particles. A manta net fixed on an &#187;A frame&#171; attached to the side of the vessel was used for sampling. Microplastic particles caught in the cod end of the net were separated from samples by visual identification and use of stereomicroscopes. Particles were analyzed for their size using an image analysis program and for their chemical structure using ATR-FTIR and micro FTIR spectroscopy. The described protocol is in line with recommendations for microplastics monitoring published by the Marine Strategy Framework Directive (MSFD) Technical Subgroup on Marine Litter. This written protocol with video guide will support the work of researchers that deal with microplastics monitoring all over the world.

The protocol below describes the methodology for: microplastics sampling on the sea surface, separation of microplastic and chemical identification of particles. This protocol is in line with the recommendations for microplastics monitoring published by the MSFD Technical Subgroup on Marine Litter.

Protocolo para Microplásticos Amostragem na superfície do mar e análise de amostras

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment during manufacturing and transport. Because of their environmental persistence, they are widely distributed in the oceans and on beaches all over the world. They can act as a vector of potentially toxic organic compounds (e.g., polychlorinated biphenyls) and might consequently negatively affect marine organisms. Their possible impacts along the food chain are not yet well understood. In order to assess the hazards associated with the occurrence of plastic pellets in the marine environment, it is necessary to develop methodologies that allow for rapid determination of associated organic contaminant levels. The present protocol describes the different steps required for sampling resin pellets, analyzing adsorbed organochlorine pesticides (OCPs) and identifying the plastic type. The focus is on the extraction of OCPs from plastic pellets by means of a pressurized fluid extractor (PFE) and on the polymer chemical analysis applying Fourier Transform-InfraRed (FT-IR) spectroscopy. The developed methodology focuses on 11 OCPs and related compounds, including dichlorodiphenyltrichloroethane (DDT) and its two main metabolites, lindane and two production isomers, as well as the two biologically active isomers of technical endosulfan. This protocol constitutes a simple and rapid alternative to existing methodology for evaluating the concentration of organic contaminants adsorbed on plastic pieces.

Microplastics act as vector of potentially toxic organic contaminants with unpredictable effects. This protocol describes an alternative methodology for assessing the levels of organochlorine pesticides adsorbed on plastic pellets and identifying the polymer chemical structure. The focus is on pressurized fluid extraction and attenuated total reflectance Fourier transform infrared spectroscopy.

Extração de Pesticidas Organoclorados de Pelotização de Plástico e Análise de Tipo de Plástico

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf mottling, vein yellowing, defoliation, root decay, and ultimately, the death of the citrus plant. When infected, the citrus plants have stunted growth and produce flowers out of season. These flowers rarely yield fruit, and those that do yield small, bitter, irregularly shaped citrus fruit that are not desirable. This disease is spread by the Asian citrus psyllid, Diaphorina citri, and by the grafting of infected citrus tissue. The pathogen has a long and variable incubation period within the citrus plant&#8212;sometimes years, before symptoms appear. Attempts to culture this pathogen in vitro have been unsuccessful, possibly due to the low and uneven concentration of the pathogen within infected citrus tissue, or because it is difficult to replicate the environmental conditions conducive to growth of the pathogen. It is very difficult to identify the disease before it has spread, due to its long incubation period and researchers&#39; inability to culture the pathogen. As a result, the disease only becomes apparent after suddenly destroying a citrus farmer&#39;s entire yield. Presented here is a method for the accurate and specific detection of the citrus greening pathogen, Candidatus liberibacter spp. using a genomic DNA extraction kit and PCR. This method is simple, efficient, cost effective, and adaptable for quantitative analysis. This method can be adapted for use on any citrus tissue; however, it is potentially limited by the amount of pathogen present in the tissue. Nevertheless, this method will allow citrus farmers to identify infected citrus plants earlier, and curb the spread of this destructive disease before it can further spread.

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus Greening is a particularly destructive disease affecting citrus crops globally. Presented here is a simple method using PCR and genomic DNA extraction of citrus leaf tissue for the accurate and precise identification of the citrus greening pathogen, Candidatus liberibacter spp.

Específicos e detecção precisa do Using PCR convencional em amostras de tecido de folhas cítricas cítricas Greening patógeno Candidatus liberibacter spp.

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). Therefore, knowing the dispersal capacity may help inform trapping/tree removal efforts to prevent this disease more effectively. In this study, we measured the flight velocity and duration and estimated the flight distance of the beetle using a newly developed flight mill. The flight mill is low cost, small, and constructed using commonly available items. Both the flight mill arm and its vertical axis comprise a thin needle. A beetle specimen is glued to one tip of the arm using instant glue. The other tip is thick due to being covered with plastic, thus it facilitates the detection of rotations of the arm. The revolution of the arm is detected by a photo sensor mounted on an infrared LED, and is indicated by a change in the output voltage when the arm passed above the LED. The photo sensor is connected to a personal computer and the output voltage data are stored at a sampling rate of 1 kHz. By conducting experiments using this flight mill, we found that P. quercivorus can fly at least 27 km. Because our flight mill comprises cheap and small ordinary items, many flight mills can be prepared and used simultaneously in a small laboratory space. This enables experimenters to obtain a sufficient amount of data within a short period.

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

We developed a low cost and small flight mill, constructed with commonly available items and easily used in experimentation. Using this apparatus, we measured the flight ability of an ambrosia beetle, Platypus quercivorus.

Medir a capacidade de voo do besouro Ambrosia, ornitorrinco Quercivorus (Murayama), usando um baixo custo, pequeno e voo facilmente construído moinho

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, and the majority of extant heteropterans retain this trophic strategy. Some heteropterans have transitioned to feeding on vertebrate blood (such as the kissing bugs, Triatominae; and bed bugs, Cimicidae) while others have reverted to feeding on plants (most Pentatomomorpha). However, with the exception of saliva used by kissing bugs to facilitate blood-feeding, little is known about heteropteran venoms compared to the venoms of spiders, scorpions and snakes.
One obstacle to the characterization of heteropteran venom toxins is the structure and function of the venom/labial glands, which are both morphologically complex and perform multiple biological roles (defense, prey capture, and extra-oral digestion). In this article, we describe three methods we have successfully used to collect heteropteran venoms. First, we present electrostimulation as a convenient way to collect venom that is often lethal when injected into prey animals, and which obviates contamination by glandular tissue. Second, we show that gentle harassment of animals is sufficient to produce venom extrusion from the proboscis and/or venom spitting in some groups of heteropterans. Third, we describe methods to harvest venom toxins by dissection of anaesthetized animals to obtain the venom glands. This method is complementary to other methods, as it may allow harvesting of toxins from taxa in which electrostimulation and harassment are ineffective. These protocols will enable researchers to harvest toxins from heteropteran insects for structure-function characterization and possible applications in medicine and agriculture.

Although many insects in the suborder Heteroptera (Insecta: Hemiptera) are venomous, their venom composition and the functions of their venom toxins are mostly unknown. This protocol describes methods to harvest heteropteran venoms for further characterization, using electrostimulation, harassment, and gland dissection.

Colheita de toxinas de veneno de barbeiros e outros insetos Heteropteran

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and maintenance issues. On the contrary, the nematode Caenorhabditis elegans (C. elegans) has advantages to make it an ideal choice for toxicity testing: a short lifespan, easy cultivation, and efficient reproduction. Here, we describe a protocol for the automatic phenotypic profiling of C. elegans in a 384-well plate. The nematode worms are cultured in a 384-well plate with liquid medium and chemical treatment, and videos are taken of each well to quantify the chemical influence on 33 worm features. Experimental results demonstrate that the quantified phenotype features can classify and predict the acute toxicity for different chemical compounds and establish a priority list for further traditional chemical toxicity assessment tests in a rodent model.

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

A quantitative method has been developed to identify and predict the acute toxicity of chemicals by automatically analyzing the phenotypic profiling of Caenorhabditis elegans. This protocol describes how to treat worms with chemicals in a 384-well plate, capture videos, and quantify toxicological related phenotypes.

Um ensaio de alta produtividade para a predição da toxicidade química por Automated Caracterização fenotípica de Caenorhabditis elegans

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and ...