This work was financially supported by the National Key R &#38; D Program of China (2021YFD1400805), the Major Science and Technology R &#38; D Program of Jiangxi Province (20194ABC28007), Projects of Jiangxi Education Department (GJJ201449), and the Collaborative Innovation of Modern Agricultural Scientific Research in Jiangxi Province (JXXTCX2015002(3+2)-003).

1. Construction of the CLas-DETECTR
NOTE: The construction of CLas-DETECTR is a four-step process: solution preparation, citrus total DNA isolation, isothermal DNA amplification, and result visualization. The schematic of the CLas-DETECTR assay is illustrated in Figure 1A.
<ol>
	<li>Solution preparation
	<ol>
		<li>Prepare buffer A: 20 mM NaOH in 6% PEG 200. For 100 mL, add 113 mg of NaOH and 6 g of PEG 200 into 80 mL of H2O in a bottle. Incubate the bottle in a water bath at 60 &#176;C until all the PEG 200 is dissolved. Then, add H2O to a volume of 100 mL.</li>
		<li>Prepare solution B: For each reaction, add 10 &#956;L of RPA buffer, 0.8 &#956;L of F-RPA-RNRf, 0.8 &#956;L of R-RPA-RNRr, and 3.9 &#956;L of ddH2O to a final volume of 15.5 &#956;L. 
		NOTE: F-RPA-RNRf and R-RPA-RNRr are the primers used in the assay against the nrdB gene. See Table 1 for the sequence.</li>
		<li>Prepare solution C: For each reaction, add 1 &#956;L of ssDNA reporter, 3 &#956;L of NEB buffer 3.1, 1 &#956;L of crRNA, 4 &#956;L of Cas12a, and 11 &#956;L of ddH2O to a final volume of 20 &#956;L. 
		NOTE: If there are many samples to detect, make a large volume of solution B and solution C, and aliquot later.</li>
	</ol>
	</li>
	<li>Citrus total DNA isolation 
	NOTE: To save time and make this method suitable for field CLas detection, the alkaline polyethylene glycol (PEG)-based approach was used to obtain crude plant extracts for DNA amplification22,23
	<ol>
		<li>Citrus leaves were used in this protocol. First, punch five leaf discs from a leaf. Next, put the leaf discs into a 1.5 mL microcentrifuge tube, and add 200 &#956;L of buffer A. 
		NOTE: In the field, clean the leaves first if there is dust covering them. The leaf discs can be clipped using the lid of the 1.5 mL tube to avoid cross-contamination. Other citrus tissues, such as roots, stems, fruits, and flowers, can also be used in this protocol.</li>
		<li>Grind the leaf disks manually until smooth with a plastic rod.</li>
		<li>Leave the tube undisturbed for 10 min. Then, use the supernatant for DNA amplification. 
		NOTE: The assay can be paused here, and the crude plant extracts that were extracted by the alkaline-PEG method can be stored at &#8722;20 &#176;C for at least 1 year. The Newhall sweet orange (Citrus sinensis Osbeck var. Newhall) trees shown in the video were grown in a pot filled with a mix of 9/3/1 (v/v/v) peat soil/vermiculite/perlite and maintained in a glasshouse located in the campus of Gannan Normal University, Jiangxi, China. The HLB-infected trees were inoculated by grafting with CLas-positive Newhall buds. The HLB-infected and HLB-uninfected trees were confirmed by PCR. CLas was detected using the primer pair (F-RPA-RNRf/R-RPA-RNRr) targeting the CLas-specific marker gene nrdB. On the other side, characteristic HLB symptoms, blotchy mottle, and yellowing leaves can be found on CLas-positive but not on CLas-negative trees.</li>
	</ol>
	</li>
	<li>Isothermal DNA amplification
	<ol>
		<li>Add 1 &#956;L of the supernatant from step 1.2.3 and 1 &#956;L of MgOAc (14 mM final concentration) into solution B and mix well.</li>
		<li>In the lab, incubate them in a simple incubator at 37 &#176;C for 15 min. 
		NOTE: In the field, hold the tubes in hand for 15 min. It is also suggested to incubate tubes in a simple incubator at 37 &#176;C for 15 min if the conditions allow.</li>
	</ol>
	</li>
	<li>Results visualization
	<ol>
		<li>Add 10 &#956;L of the mixture from step 1.3.2 into solution C and mix well.</li>
		<li>Incubate them in a 37 &#176;C incubator for 60 min.</li>
		<li>Wear goggles and observe the green fluorescence signal released from the ssDNA reporter labeled with 5&#8217; 6-Fluorescein at 5&#8217; and the fluorescence quencher at 3&#8217; through&#160;a handheld fluorescent detection device (excitation wavelength: 440 nm, emission wavelength: 500 nm). 
		NOTE:green fluorescence signal can last several days, it is better to 
		CAUTION: The light emitted by the fluorescence detection device is harmful to the eyes. Make sure to wear goggles before observing the results.</li>
	</ol>
	</li>
</ol>
2. Specificity test
NOTE: To test the specificity of CLas-DETECTR, the rhizosphere bacterium Agrobacterium tumefaciens GV3101, Xanthomonas citri subsp. citri (Xcc), and Burkholderia stabilis strain 1440 isolated in the lab24 were subjected to the CLas-DETECTR test.&#160;
NOTE: Candidatus Liberibacter (CLas) cannot be cultured. One can only obtain CLas DNA from the extraction of genomic DNA from citrus tissues infected with CLas. Xcc is the causal agent of another important citrus disease, citrus canker. Burkholderia stabilis strain 1440 is an anti-Xcc bacterium isolated in the lab. Therefore, pure strains for all these three bacteria were used
<ol>
	<li>Extract the bacterial genomic DNA (gDNA) using a bacterial genomic DNA extraction kit following the manufacturer&#8217;s protocol. Use water as a negative control.</li>
	<li>Perform PCR using 0.2 mL PCR tube strips with optical caps&#160;in a 25 &#956;L reaction mixture containing 1 &#956;L of F-RPA-RNRf, 1 &#956;L of R-RPA-RNRr, 12.5 &#956;L of Ex Taq Version 2.0 plus dye, 1 &#956;L of DNA template, and 9.5 &#956;L of H2O.
	<ol>
		<li>Use the following thermal cycling reaction conditions: 1 min at 98 &#176;C; followed by 35 cycles of 10 s at 98 &#176;C, 30 s at 55 &#176;C, 15 s at 72 &#176;C; then 10 min at 72 &#176;C; and hold at 16 &#176;C.</li>
		<li>Run the PCR products on 1% agarose gel at 120 V for 15 min.</li>
	</ol>
	</li>
	<li>Perform qPCR in a 20 &#956;L reaction mixture containing 0.8 &#956;L of F-RPA-RNRf, 0.8 &#956;L of R-RPA-RNRr, 10 &#956;L of 2x TB Green Premix Ex Taq II (Tli RNaseH Plus), 1 &#956;L of the DNA template, and 7.4 &#956;L of H2O.
	<ol>
		<li>Use the following thermal cycling reaction conditions: 30 s at 95 &#176;C; followed by 45 cycles of 5 s at 95 &#176;C and 32 s at 60 &#176;C; and then a melt curve stage of 15 s at 95 &#176;C, 1 min at 60 &#176;C, and 15 s at 95 &#176;C.</li>
		<li>Include three technical repeats in each repeat.</li>
	</ol>
	</li>
	<li>Perform the CLas-DETECTR method following steps 1.1&#8211;1.4.</li>
</ol>
3. Sensitivity comparison
<ol>
	<li>To test the sensitivity of CLas DETECTR, detect a series of CLas DNA fragment dilutions using PCR, CLas-DETECTR, and qPCR, as described above.</li>
	<li>Amplify a DNA segment with a length of 1,060 bp from nrdB using the primer set F-RNR and R-RNR in a 100 &#956;L reaction mixture containing 4 &#956;L of F-RNR, 4 &#956;L of R-RNR, 50 &#956;L of PrimeSTAR Max Premix, 2 &#956;L of DNA template, and 40 &#956;L of H2O, following the thermal cycling reaction conditions (30 s at 98 &#176;C; followed by 35 cycles of 10 s at 98 &#176;C, 15 s at 55 &#176;C, 30 s at 72 &#176;C; then 10 min at 72 &#176;C; and hold at 16 &#176;C). 
	NOTE: The nrdB (ribonucleotide reductase &#946;- subunit) gene is specific to CLas21. One can easily obtain the nrdB amplicon from CLas-positive citrus gDNA using the primer set F-RNR and R-RNR. The primer set F-RNR and R-RNR amplifies a 1,060 bp nrdB fragment, while the primer set F-RPA-RNR and R-RPA-RNR amplifies a 104 bp fragment of the nrdB gene, which is the part of the 1,060 bp nrdB fragment.</li>
	<li>Purify the PCR products with a DNA gel extraction kit following the manufacturer&#8217;s manual.</li>
	<li>Dilute the PCR products containing the nrdB amplicons with sterilized ddH2O.</li>
	<li>Calculate the copy number of the nrdB gene using commercially available online DNA copy number and dilution calculator.</li>
	<li>Prepare DNA dilutions containing 2.01 &#215; 106 copies/&#956;L, 2.01 &#215; 105 copies/&#956;L, 2.01 &#215; 104 copies/&#956;L, 2.01 &#215; 103 copies/&#956;L, 2.01 &#215; 102 copies/&#956;L, 2.01 &#215; 101 copies/&#956;L, 2.01 &#215; 100 copies/&#956;L, and 2.01 &#215; 10&#8722;1 copies/&#956;L of CLas DNA fragment.</li>
</ol>
4. Sample detection
NOTE: After the specificity and sensitivity test, the CLas-DETECTR method was used to detect the presence of CLas in the field leaf samples collected from Newhall sweet orange trees grown in the germplasm resource nursery on the campus of Gannan Normal University, Jiangxi, China. A qPCR was performed to verify the results.
<ol>
	<li>Test a total of 15 trees. Use water as a negative control.</li>
	<li>Perform the CLas-DETECTR and qPCR methods as described above. 
	NOTE: Due to the uneven distribution characteristics of CLas in citrus, leaves showing HLB symptoms were collected as a priority. If a tree looked healthy, the leaves were collected randomlyCLas-DETECTR system works correctly.</li>
</ol>

<ol>
	<li>Ma, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Citrus+Huanglongbing+is+a+pathogen-triggered+immune+disease+that+can+be+mitigated+with+antioxidants+and+gibberellin.">Citrus Huanglongbing is a pathogen-triggered immune disease that can be mitigated with antioxidants and gibberellin.</a> Nature Communications. 13 (1), 529 (2022).</li><li>Bov&#233;, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Huanglongbing:+A+destructive,+newly-emerging,+century-old+disease+of+citrus.">Huanglongbing: A destructive, newly-emerging, century-old disease of citrus.</a> Journal of Plant Pathology. 88 (1), 7-37 (2006).</li><li>Wang, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Candidatus+Liberibacter-host+interface:+Insights+into+pathogenesis+mechanisms+and+disease+control.">The Candidatus Liberibacter-host interface: Insights into pathogenesis mechanisms and disease control.</a> Annual Review of Phytopathology. 55, 451-482 (2017).</li><li>Kim, J. S., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+copy+numbers+of+16S+rDNA+and+16S+rRNA+of+Candidatus+Liberibacter+asiaticus+and+the+implication+in+detection+in+planta+using+quantitative+PCR.">Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR.</a> BMC Research Notes. 2, 37 (2009).</li><li>Maheshwari, Y., Selvaraj, V., Godfrey, K., Hajeri, S., Yokomi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+detection+of+&amp;#34;Candidatus+Liberibacter+asiaticus&amp;#34;+and+Spiroplasma+citri+by+qPCR+and+droplet+digital+PCR.">Multiplex detection of &amp;#34;Candidatus Liberibacter asiaticus&amp;#34; and Spiroplasma citri by qPCR and droplet digital PCR.</a> PLoS One. 16 (3), e0242392 (2021).</li><li>Deng, X., Zhou, G., Li, H., Chen, J., Civerolo, E. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nested-PCR+detection+and+sequence+confirmation+of+'Candidatus+Liberibacter+asiaticus'+from+Murraya+paniculata+in+Guandong,+China.">Nested-PCR detection and sequence confirmation of 'Candidatus Liberibacter asiaticus' from Murraya paniculata in Guandong, China.</a> Plant Disease. 91 (8), 1051 (2007).</li><li>Ding, F., Duan, Y., Yuan, Q., Shao, J., Hartung, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+detection+of+'Candidatus+Liberibacter+asiaticus'+in+citrus,+and+identification+by+GeLC-MS/MS+of+a+chaperone+protein+responding+to+cellular+pathogens.">Serological detection of 'Candidatus Liberibacter asiaticus' in citrus, and identification by GeLC-MS/MS of a chaperone protein responding to cellular pathogens.</a> Scientific Reports. 6, 29272 (2016).</li><li>Choi, C. W., Hyun, J. W., Hwang, R. Y., Powell, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+assay+for+detection+of+Candidatus+Liberibacter+asiaticus,+a+causal+agent+of+citrus+Huanglongbing.">Loop-mediated isothermal amplification assay for detection of Candidatus Liberibacter asiaticus, a causal agent of citrus Huanglongbing.</a> The Plant Pathology Journal. 34 (6), 499-505 (2018).</li><li>Ghosh, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+recombinase+polymerase+based+isothermal+amplification+combined+with+lateral+flow+assay+(HLB-RPA-LFA)+for+rapid+detection+of+&amp;#34;Candidatus+Liberibacter+asiaticus&amp;#34;.">Development of a recombinase polymerase based isothermal amplification combined with lateral flow assay (HLB-RPA-LFA) for rapid detection of &amp;#34;Candidatus Liberibacter asiaticus&amp;#34;.</a> PLoS One. 13 (12), e0208530 (2018).</li><li>Ravindran, A., Levy, J., Pierson, E., Gross, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+loop-mediated+isothermal+amplification+procedure+as+a+sensitive+and+rapid+method+for+detection+of+'Candidatus+Liberibacter+solanacearum'+in+potatoes+and+psyllids.">Development of a loop-mediated isothermal amplification procedure as a sensitive and rapid method for detection of 'Candidatus Liberibacter solanacearum' in potatoes and psyllids.</a> Phytopathology. 102 (9), 899-907 (2012).</li><li>Chertow, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+diagnostics+with+CRISPR.">Next-generation diagnostics with CRISPR.</a> Science. 360 (6387), 381-382 (2018).</li><li>Chen, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12a+target+binding+unleashes+indiscriminate+single-stranded+DNase+activity.">CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.</a> Science. 360 (6387), 436-439 (2018).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+and+portable+nucleic+acid+detection+platform+with+Cas13,+Cas12a,+and+Csm6.">Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6.</a> Science. 360 (6387), 439-444 (2018).</li><li>Ding, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+and+visual+detection+of+SARS-CoV-2+using+all-in-one+dual+CRISPR-Cas12a+assay.">Ultrasensitive and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay.</a> Nature Communications. 11 (1), 4711 (2020).</li><li>Qian, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visual+detection+of+human+metapneumovirus+using+CRISPR-Cas12a+diagnostics.">Visual detection of human metapneumovirus using CRISPR-Cas12a diagnostics.</a> Virus Research. 305, 198568 (2021).</li><li>Marques, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostics+of+infections+produced+by+the+plant+viruses+TMV,+TEV,+and+PVX+with+CRISPR-Cas12+and+CRISPR-Cas13.">Diagnostics of infections produced by the plant viruses TMV, TEV, and PVX with CRISPR-Cas12 and CRISPR-Cas13.</a> ACS Synthetic Biology. 11 (7), 2384-2393 (2022).</li><li>Lu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid,+equipment-free+method+for+detecting+Phytophthora+infestans+in+the+field+using+a+lateral+flow+strip-based+recombinase+polymerase+amplification+assay.">A rapid, equipment-free method for detecting Phytophthora infestans in the field using a lateral flow strip-based recombinase polymerase amplification assay.</a> Plant Disease. 104 (11), 2774-2778 (2020).</li><li>Lobato, I. M., O'Sullivan, C. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinase+polymerase+amplification:+Basics,+applications+and+recent+advances.">Recombinase polymerase amplification: Basics, applications and recent advances.</a> Trends in Analytical Chemistry. 98, 19-35 (2018).</li><li>Liang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas12a-derived+biosensing+platform+for+the+highly+sensitive+detection+of+diverse+small+molecules.">A CRISPR-Cas12a-derived biosensing platform for the highly sensitive detection of diverse small molecules.</a> Nature Communications. 10 (1), 3672 (2019).</li><li>Zheng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+five+copies+and+dual+forms+of+nrdB+in+&amp;#34;Candidatus+Liberibacter+asiaticus&amp;#34;:+Biological+implications+and+PCR+detection+application.">Unusual five copies and dual forms of nrdB in &amp;#34;Candidatus Liberibacter asiaticus&amp;#34;: Biological implications and PCR detection application.</a> Scientific Reports. 6, 39020 (2016).</li><li>Chomczynski, P., Rymaszewski, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alkaline+polyethylene+glycol-based+method+for+direct+PCR+from+bacteria,+eukaryotic+tissue+samples,+and+whole+blood.">Alkaline polyethylene glycol-based method for direct PCR from bacteria, eukaryotic tissue samples, and whole blood.</a> BioTechniques. 40 (4), 454-458 (2006).</li><li>Yang, Y. G., Kim, J. Y., Soh, M. S., Kim, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+and+rapid+gene+amplification+from+Arabidopsis+leaves+using+Any+Direct+system.">A simple and rapid gene amplification from Arabidopsis leaves using Any Direct system.</a> Journal of Biochemistry and Molecular Biology. 40 (3), 444-447 (2007).</li><li>Long, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescent+reporter-based+evaluation+assay+for+antibacterial+components+against+Xanthomonas+citri+subsp.+citri.">A fluorescent reporter-based evaluation assay for antibacterial components against Xanthomonas citri subsp. citri.</a> Frontiers in Microbiology. 13, 864963 (2022).</li><li>Wheatley, M. S., Duan, Y. P., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+sensitive+and+rapid+detection+of+citrus+Huanglongbing+pathogen+('Candidatus+Liberibacter+asiaticus')+using+Cas12a-based+methods.">Highly sensitive and rapid detection of citrus Huanglongbing pathogen ('Candidatus Liberibacter asiaticus') using Cas12a-based methods.</a> Phytopathology. 111 (12), 2375-2382 (2021).</li></ol>

The authors declare that they have no competing interests.

This study presents a rapid and portable method to detect CLas named CLas-DETECTR, which combines the RPA and CRISPR-Cas12a systems. The workflow is illustrated in Figure 1. CLas-DETECTR detects CLas with specificity and sensitivity (Figure 2 and Figure 3). Furthermore, using Newhall leaf samples, CLas-DETECTR detects CLas with the same sensitivity as qPCR (Figure 4). Notably, the detection results can be directly visualized through a handheld portable device independent of laboratory-based instruments, which is critical for real-time HLB diagnosis.
There are several important considerations to the protocol. First, cross-contamination should be strictly avoided in the sampling process, as CLas-DETECTR is as sensitive as qPCR. The reaction reagents must not be exposed to intense sunlight. All the steps must be followed precisely to achieve optimum results. A positive control, a plasmid containing CLas-specific gene fragments, should be included to ensure that the CLas-DETECTR system works correctly in the field. Finally, all the CLas-related experimental waste should be treated as a biohazard and autoclaved before disposal.
If no fluorescence signals are detected for the positive control, inhibitors may exist in the reaction mixture, and the reagents need to be changed. Otherwise, if the fluorescence is too weak to distinguish, incubation time can be extended longer incubation time may lead to false positives.
The existing CLas detection methods require expensive PCR machines, fixed operation sites, and trained personnel. However, the method presented here allows HLB to be diagnosed accurately and sensitively in the field by a wide range of people, including citrus growers.
However, CLas-DETECTR has some limitations. First, citrus samples cannot be directly used in the protocol, and the citrus gDNA needs to be extracted. Second, a simple incubator is required for the RPA and the activation of the nuclease activity of Cas12a for consistent results. Third, the results need to be visualized through a handheld fluorescent detection device. Although lateral flow strips could be employed to show the results directly, this would increase
Leaf samples were tested in this protocol. In the future, CLas-DETECTR could be applied to detect the presence of CLas in periwinkles and psyllid samples. In addition, by changing the crRNA and primers, this molecular diagnostic technology could also be used for other citrus diseases, such as citrus canker, citrus decay virus, and citrus leaf fragmentation virus. While we are working on CLas-DETECTR, this approach has also been used to detect CLas in parallel by others25.

Huanglongbing (HLB) is one of the most problematic citrus diseases worldwide1. HLB is caused by the phloem-colonizing and fastidious bacteria Candidatus Liberibacter spp., including Candidatus Liberibacter asiaticus (CLas), Ca. L. africanus, and Ca. L. americanus2. The most prevalent HLB-associated species in China and the USA is CLas, which is transmitted by Asian citrus psyllids (Diaphorina citri) or through grafting3. After being infected by CLas, citrus trees demonstrate growth decline until death2. The common symptoms of citrus leaves infected with CLas are blotchy mottle, green islands (small circular dark green dots), raised corky veins on thicker and leathery leaves, and nonuniform yellowing shoots2. In addition, fruits infected with CLas appear small and lopsided2.
Since no citrus variety is resistant to HLB and there is no therapeutic cure for HLB, the prevention of HLB requires the quarantine and isolation of CLas-positive citrus trees2,3. Therefore, early detection is critical for monitoring and quarantine to prevent the spread of CLas and minimize economic losses3. In addition, sensitive CLas detection is needed due to the low titer of CLas in plants during the early stage of infection3. In China, CLas detection is usually conducted by certain certified test centers. However, the detection process usually takes at least 1 week, and the detection fee is expensive.&#160;Therefore, to help monitor the HLB incidence
Various technologies have been applied to diagnose HLB4,5,6,7,8,9. Polymerase chain reaction (PCR) and quantitative PCR (qPCR) are the most used tools for CLas detection due to their high sensitivity and specificity4,5. However, those technologies rely heavily on expensive instruments and highly skilled personnel. In addition, several isothermal amplification methods, such as loop-mediated isothermal amplification (LAMP), have been developed as attractive alternatives to conventional PCR methods due to their simplicity, rapidity, and low cost8,9,10. However, it is challenging to apply them to accurately detect CLas due to the non-specific amplification signals, which may cause false-positive results.
RNA-guided CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated) endonuclease-based nucleic acid detection has been developed as a next-generation molecular diagnostics technology owing to its high sensitivity, specificity, and reliability11,12,13,14. These CRISPR/Cas diagnostics technologies rely on the collateral nuclease activity of Cas proteins to cleave single-stranded DNA (ssDNA) modified with a fluorescent reporter and a fluorescence quencher at each end of the oligonucleotides, as well as a fluorescence detection device to capture the released fluorescent reporter11,12. The nuclease activity of several Cas effectors activated by the CRISPR RNA (crRNA) target duplex can indiscriminately cleave the surrounding non-target ssDNA11. CRISPR-Cas12a (also called Cpf 1), a class 2 type V-A CRISPR/Cas system, demonstrates several advantages compared with Cas9, such as a lower mismatch tolerance and greater specificity13.&#160;The Cas12a/crRNA system has been applied for the sensitive and specific detection of the nucleic acids of human pathogens and phytopathogens14,15,16,17,18. Therefore, utilizing the Cas12a/crRNA system should enable the accurate and sensitive detection of the nucleic acid of CLas.
Cas12a alone is not theoretically sensitive enough to detect low levels of nucleic acids. Therefore, to improve its detection sensitivity, CRISPR-Cas12a detection is typically combined with an isothermal amplification step14,15. Recombinase polymerase amplification (RPA) enables sensitive and rapid isothermal DNA amplification in a temperature range from 37 &#176;C to 42 &#176;C19.
A detection platform called DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter) that combines the DNase activity of Cas12a with RPA and a fluorescence readout has been recently devised12 and has been shown to detect nucleic acid with higher sensitivity20. Furthermore, the fluorescence signal emitted from the positive samples can be observed through a handheld fluorescence detection device in the field.
Since we amplified DNA with RPA, designed crRNA targeting the five-copy nrdB (ribonucleotide reductase &#946;- subunit) gene specific to CLas21, and employed the DNase activity of the Cas12a protein, we called this CLas detection method CLas-DETECTR. Compared with existing CLas detection methods, CLas-DETECTR is fast, accurate, sensitive, and deployable.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>AxyPrep DNA Gel Extraction Kit</td>
			<td>Corning</td>
			<td>09319KE1</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacterial Genomic DNA Extraction Kit</td>
			<td>Solarbio</td>
			<td>D1600</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>EnGen LbCas12a&#160;</td>
			<td>TOLOBIO</td>
			<td>32104-01</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>Ex Taq Version 2.0 plus dye</td>
			<td>TaKaRa</td>
			<td>RR902A</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>Handheld fluorescent detection device&#160;</td>
			<td>LUYOR</td>
			<td>3415RG</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>Hole puncher&#160;</td>
			<td>Deli</td>
			<td>114</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium acetate, MgOAc</td>
			<td>TwistDx</td>
			<td>TABAS03KIT</td>
			<td>UK</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>SCR</td>
			<td>10019718</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB buffer 3.1&#160;</td>
			<td>NEB</td>
			<td>B7203</td>
			<td>USA</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR strip tubes</td>
			<td>LABSELECT</td>
			<td>PST-0208-FT-C</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 200&#160;</td>
			<td>Sigma</td>
			<td>P3015</td>
			<td>USA</td>
			<td></td>
		</tr>
		<tr>
			<td>PrimeSTAR Max DNA Polymeras</td>
			<td>TaKaRa</td>
			<td>R045A</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-Load Purple 1 kb Plus DNA Ladder&#160;</td>
			<td>New England Biolabs</td>
			<td>N0550S</td>
			<td>USA</td>
			<td></td>
		</tr>
		<tr>
			<td>TB Green Premix Ex Taq II (Tli RNaseH Plus)</td>
			<td>TaKaRa</td>
			<td>RR820B</td>
			<td>China</td>
			<td></td>
		</tr>
		<tr>
			<td>TwistAmp Basic</td>
			<td>TwistDx</td>
			<td>TABAS03KIT</td>
			<td>UK</td>
			<td></td>
		</tr>
	</tbody>
</table>

field-deployable candidatus liberibacter asiaticus detection using recombinase polymerase amplification combined with crispr-cas12a

The early detection of Candidatus Liberibacter asiaticus (CLas) by citrus growers facilitates early intervention and prevents the spread of disease. A simple method for rapid and portable Huanglongbing (HLB) diagnosis is presented here that combines recombinase polymerase amplification and a fluorescent reporter utilizing the nuclease activity of the clustered regularly interspaced short palindromic repeats/CRISPR-associated 12a (CRISPR-Cas12a) system. The sensitivity of this technique is much higher than PCR. Furthermore, this method showed similar results to qPCR when leaf samples were used. Compared with conventional CLas detection methods, the detection method presented here can be completed in 90 min and works in an isothermal condition that does not require the use of PCR machines. In addition, the results can be visualized through a handheld fluorescent detection device in the field.

Here, we have described a portable platform, CLas-DETECTR, combing the RPA and CRISPR-Cas12a systems to diagnose HLB in the field. The schema of CLas-DETECTR is illustrated in Figure 1A.
When leaf samples from the HLB-infected and HLB-uninfected Newhall trees (Figure 1B), for which the presence of CLas was confirmed by PCR (Figure 1C), were subjected to the CLas-DETECTR test, a green fluorescence signal was seen in the HLB-infected sample but not in the HLB-uninfected sample and negative control (Figure 1D).
We determined the specificity of CLas-DETECTR using nucleic acids extracted from other bacteria. The primer set of F-RPA-RNRf and R-RPA-RNRr used in the CLas-DETECTR assay was also used in PCR and qPCR. A band could be seen in the agarose gel electrophoresis when amplified using CLas-positive citrus leaf gDNA but not other bacterial gDNA in the PCR assays (Figure 2A). In the qPCR assays, the average threshold cycle (Ct) value of CLas was 24 &#177; 0.7, while the average Ct values of A. tumefaciens GV3101, Xcc, and B. stabilis strain 1440 were 38 &#177; 0.7, 39 &#177; 1.4, and 39 &#177; 0.7, respectively (Figure 2B). Usually, the result is considered negative when the Ct value is higher than 38. These results demonstrate that the F-RPA-RNRf and R-RPA-RNRr primer pair are specific to CLas. In the CLas-DETECTR assay, only CLas gDNA demonstrated green fluorescence signals; the gDNA extracted from A. tumefaciens GV3101, Xcc, and B. stabilis strain 1440 did not (Figure 2C), which means CLas-DETECTR can detect CLas specifically.
We also tested the sensitivity of CLas-DETECTR using a series of CLas DNA dilutions. PCR could detect 2.01 &#215; 102 copies/&#956;L (Figure 3A). On the other hand, CLas-DETECTR could detect 2.01 &#215; 100 copies/&#956;L, which suggests that this is viable as a sensitive field diagnostic (Figure 3B). The qPCR could detect 2.01 &#215; 10&#8722;1 copies/&#956;L, but the Ct value was higher than 36 (Figure 3C). Therefore, CLas-DETECTR is two orders of magnitude more sensitive than traditional PCR and one order of magnitude less sensitive than qPCR when diluted amplicons are used (Figure 3).
Finally, we examined the feasibility of CLas-DETECTR for field samples and compared its sensitivity with qPCR, an established, sensitive nucleic acid detection approach21. Usually, a Ct value of CLas detection by qPCR higher than 36 means the CLas concentration is less than 2.01 &#215; 10&#8722;1 copies/&#956;L, which is a very low concentration (Figure 3C). Among the 15 samples, the Ct value of samples 1, 2, 3, 4, 8, 10, 13, and 14 detected by qPCR were less than 36, and apparent green fluorescence signals were observed (Figure 4). On the other hand, when the Ct values of samples 6, 7, 9, 12, and 15 detected by qPCR were undetermined, no green fluorescence signals were observed (Figure 4). Furthermore, weak green fluorescence signals were observed when the Ct values of sample 5 and sample 11 detected by qPCR were higher than 36 (Figure 4). The results suggest that our platform is a rapid, robust, and sensitive tool for HLB diagnosis in the field.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>No</td>
			<td colspan="2">Name</td>
			<td colspan="12">Sequence (5&#39; to 3&#39;)</td>
		</tr>
		<tr>
			<td>1</td>
			<td colspan="2">crRNA1-nrdB</td>
			<td colspan="12">rUrArArUrUrUrCrUrArCrUrArArGrUrGrUrArGrArUrUrGrCrArUrArGrGrCrGrArUrUrUrCrGrArGrGrArG</td>
		</tr>
		<tr>
			<td>2</td>
			<td colspan="2">ssDNA-FQ</td>
			<td colspan="12">FAM-TTTATTT-BHQ1</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="2">F-RPA-RNRf</td>
			<td colspan="12">AAAAGTCGCACCATGCTCCATGAAGCTACC</td>
		</tr>
		<tr>
			<td>4</td>
			<td colspan="2">R-RPA-RNRr</td>
			<td colspan="12">TGTTCACATGAGGGAGCATTTAACCCCACGAA</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="2">F-RNR</td>
			<td colspan="12">ATGGCAAATAACACAGGATTAAGCCC</td>
		</tr>
		<tr>
			<td>6</td>
			<td colspan="2">R-RNR</td>
			<td colspan="12">TTAATCCCATTTCAACCCTGCTCC</td>
		</tr>
	</tbody>
</table>
Table 1: Nucleic acid used in this study. The ssDNA-FQ is single-stranded DNA labeled with 5&#8217; 6-FAM (Fluorescein) at 5&#8217; and the fluorescence quencher Black Hole Quencher 1 (BHQ1) at 3&#8217;. Abbreviations: F = fluorescent reporter; Q = fluorescence quencher.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64070/64070fig1.jpg" /> 
Figure 1: Design and validation of the CLas-DETECTR. (A) Schematic of the CLas-DETECTR assay. Step 1: Prepare buffer A containing 20 mM NaOH in 6% PEG 200 for quick gDNA extraction; solution B containing 10 &#956;L of RPA buffer, 0.8 &#956;L of F-RPA-RNRf, 0.8 &#956;L of F-RPA-RNRr, and 3.9 &#956;L of ddH2O in each reaction for isothermal DNA amplification; solution C containing 1 &#956;L of ssDNA reporter, 3 &#956;L of NEB buffer 3.1, 1 &#956;L of crRNA targeting nrdB, 4 &#956;L of Cas12a, and 11 &#956;L of ddH2O in each reaction for fluorescent reporter release. Step 2: Five leaf discs punched from leaves were used to extract the citrus total DNA with 200 &#956;L of buffer A. Step 3: The CLas-specific nucleic acids were amplified using the primers F-RPA-RNRf and R-RPA-RNRr targeting the CLas-specific marker gene nrdB in solution B with 1 &#956;L of supernatant from step 2 and 1 &#956;L of MgOAc at 37 &#176;C for 15 min. Step 4: Solution C with 10 &#956;L of the mixture from step 3 was incubated at 37 &#176;C for 60 min, and the green fluorescence signal was observed through a handheld fluorescent detection device. The ssDNA-FQ &#160;was labeled with 5&#8217; 6-FAM (Fluorescein) at 5&#8217; and a fluorescence quencher Black Hole Quencher 1 (BHQ1) at 3&#8217;. Abbreviations: F = fluorescent reporter; Q = fluorescence quencher.&#160;(B) The HLB-infected tree (left) shows blotchy mottle and yellow leaves, but the HLB-uninfected tree (right) looks green. (C) The presence of CLas was confirmed using the primer pair F-RPA-RNRf and R-RPA-RNRr. (D) The HLB-infected sample demonstrates green fluorescence signals, while the HLB-uninfected and H2O do not in the CLas-DETECTR assay. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64070/64070fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64070/64070fig2.jpg" /> 
Figure 2: Testing the specificity of the CLas-DETECTR. (A) Agarose gel electrophoresis of the PCR results, (B) the Ct value of the qPCR results, and (C) the CLas-DETECTR results amplified with the primer pair of F-RPA-RNRf and R-RPA-RNRr using gDNA extracted from CLas-positive Newhall leaves and three other bacteria. Again, H2O served as a negative control. M: DNA ladder; gDNA extracted from CLas-positive Newhall leaves (1), Agrobacterium tumefaciens GV3101 (2), Xanthomonas citri subsp. citri (Xcc, 3), and Burkholderia stabilis strain 1440 isolated in our lab (4). The Ct value represents the average Ct value of three technical repeats &#177; standard error. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64070/64070fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64070/64070fig3.jpg" /> 
Figure 3: Sensitivity comparison of CLas-DETECTR with PCR and qPCR. Detection analysis of a series of specific CLas DNA amplicon dilutions using (A) PCR, (B) CLas-DETECTR, and (C) qPCR. (A) From 25 &#956;L of the PCR products, 5 &#956;L were loaded into the gel. (B) The pictures were captured with a smartphone camera through protective goggles under the light emitted by a handheld fluorescent detection device (excitation wavelength: 440 nm, emission wavelength: 500 nm). The same primers were used in all the assays. The purified PCR products with a length of 1,060 bp amplified with the primer set F-RNR and R-RNR targeting the CLas-specific nrdB gene were diluted using H2O into concentrations of 2.01 &#215; 106 copies/&#956;L (1), 2.01 &#215; 105 copies/&#956;L (2), 2.01 &#215; 104 copies/&#956;L (3), 2.01 &#215; 103 copies/&#956;L (4), 2.01 &#215; 102 copies/&#956;L (5), 2.01 &#215; 101 copies/&#956;L (6), 2.01 &#215; 100 copies/&#956;L (7), and 2.01 &#215; 10&#8722;1 copies/&#956;L (8). H2O&#160;served as a negative control. M: DNA ladder. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64070/64070fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/64070/64070fig4.jpg" /> 
Figure 4: CLas detection using field samples. CLas in 15 leaf samples collected from Newhall sweet orange trees was tested by CLas-DETECTR and qPCR assays described above. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64070/64070fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a at JoVE.com

Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a

In this work, a rapid, sensitive, and portable detection method for Candidatus Liberibacter asiaticus based on recombinase polymerase amplification combined with CRISPR-Cas12a was developed.

Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a

The early detection of Candidatus Liberibacter asiaticus (CLas) by citrus growers facilitates early intervention and prevents the spread of disease. A ...

field-deployable-candidatus-liberibacter-asiaticus-detection-using

Nanyang Technological University

Research

JoVE Journal

Biology

2.5K Views.  Gannan Normal University. In this work, a rapid, sensitive, and portable detection method for Candidatus Liberibacter asiaticus based on recombinase polymerase amplification combined with CRISPR-Cas12a was developed.

Video: Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Principles of Site-Specific Recombinase (SSR) Technology

Site-specific recombinase (SSR) technology allows the manipulation of gene structure to explore gene function and has become an integral tool of molecular biology. Site-specific recombinases are proteins that bind to distinct DNA target sequences. The Cre/lox system was first described in bacteriophages during the 1980's. Cre recombinase is a Type I topoisomerase that catalyzes site-specific recombination of DNA between two loxP (locus of X-over P1) sites. The Cre/lox system does not require any cofactors. LoxP sequences contain distinct binding sites for Cre recombinases that surround a directional core sequence where recombination and rearrangement takes place. When cells contain loxP sites and express the Cre recombinase, a recombination event occurs. Double-stranded DNA is cut at both loxP sites by the Cre recombinase, rearranged, and ligated ("scissors and glue"). Products of the recombination event depend on the relative orientation of the asymmetric sequences.
SSR technology is frequently used as a tool to explore gene function. Here the gene of interest is flanked with Cre target sites loxP ("floxed"). Animals are then crossed with animals expressing the Cre recombinase under the control of a tissue-specific promoter. In tissues that express the Cre recombinase it binds to target sequences and excises the floxed gene. Controlled gene deletion allows the investigation of gene function in specific tissues and at distinct time points. Analysis of gene function employing SSR technology --- conditional mutagenesis -- has significant advantages over traditional knock-outs where gene deletion is frequently lethal.

Principles of Site-Specific Recombinase SSR Technology

The advent of site-specific recombinase (SSR) technology and the Cre/lox system has led to numerous advances in molecular biology, and has proven itself as a valuable tool for assessing gene function in transgenic animals. This interview discusses the mechanism of site specific recombination by Cyclization recombinase (Cre) and how the use of this enzyme has led to the development of conditional mutagenesis, which has significant advantages over traditional knock out strategies.

Site-specific recombinase (SSR) technology allows the manipulation of gene structure to explore gene function and has become an integral tool of molecular ...

Molecular Evolution of the Tre Recombinase

Here we report the generation of Tre recombinase through directed, molecular evolution. Tre recombinase recognizes a pre-defined target sequence within the LTR sequences of the HIV-1 provirus, resulting in the excision and eradication of the provirus from infected human cells. 
We started with Cre, a 38-kDa recombinase, that recognizes a 34-bp double-stranded DNA sequence known as loxP. Because Cre can effectively eliminate genomic sequences, we set out to tailor a recombinase that could remove the sequence between the 5'-LTR and 3'-LTR of an integrated HIV-1 provirus. As a first step we identified sequences within the LTR sites that were similar to loxP and tested for recombination activity. Initially Cre and mutagenized Cre libraries failed to recombine the chosen loxLTR sites of the HIV-1 provirus. As the start of any directed molecular evolution process requires at least residual activity, the original asymmetric loxLTR sequences were split into subsets and tested again for recombination activity. Acting as intermediates, recombination activity was shown with the subsets. Next, recombinase libraries were enriched through reiterative evolution cycles. Subsequently, enriched libraries were shuffled and recombined. The combination of different mutations proved synergistic and recombinases were created that were able to recombine loxLTR1 and loxLTR2. This was evidence that an evolutionary strategy through intermediates can be successful. After a total of 126 evolution cycles individual recombinases were functionally and structurally analyzed. The most active recombinase -- Tre -- had 19 amino acid changes as compared to Cre. Tre recombinase was able to excise the HIV-1 provirus from the genome HIV-1 infected HeLa cells (see "HIV-1 Proviral DNA Excision Using an Evolved Recombinase", Hauber J., Heinrich-Pette-Institute for Experimental Virology and Immunology, Hamburg, Germany). While still in its infancy, directed molecular evolution will allow the creation of custom enzymes that will serve as tools of "molecular surgery" and molecular medicine.

Here we report the generation of Tre recombinase through directed, molecular evolution. Tre recombinase recognizes a pre-defined target sequence within the LTR sequences of the HIV-1 provirus, resulting in the excision and eradication of the provirus from infected human cells. While still in its infancy, directed molecular evolution will allow the creation of custom enzymes that will serve as tools of molecular surgery and molecular medicine.

Here we report the generation of Tre recombinase through directed, molecular evolution. Tre recombinase recognizes a pre-defined target sequence within ...

Interview: HIV-1 Proviral DNA Excision Using an Evolved Recombinase

HIV-1 integrates into the host chromosome of infected cells and persists as a provirus flanked by long terminal repeats. Current treatment strategies primarily target virus enzymes or virus-cell fusion, suppressing the viral life cycle without eradicating the infection. Since the integrated provirus is not targeted by these approaches, new resistant strains of HIV-1 may emerge. Here, we report that the engineered recombinase Tre (see Molecular evolution of the Tre recombinase , Buchholz, F., Max Planck Institute for Cell Biology and Genetics, Dresden) efficiently excises integrated HIV-1 proviral DNA from the genome of infected cells. We produced loxLTR containing viral pseudotypes and infected HeLa cells to examine whether Tre recombinase can excise the provirus from the genome of HIV-1 infected human cells. A virus particle-releasing cell line was cloned and transfected with a plasmid expressing Tre or with a parental control vector. Recombinase activity and virus production were monitored. All assays demonstrated the efficient deletion of the provirus from infected cells without visible cytotoxic effects. These results serve as proof of principle that it is possible to evolve a recombinase to specifically target an HIV-1 LTR and that this recombinase is capable of excising the HIV-1 provirus from the genome of HIV-1-infected human cells.
Before an engineered recombinase could enter the therapeutic arena, however, significant obstacles need to be overcome. Among the most critical issues, that we face, are an efficient and safe delivery to targeted cells and the absence of side effects.

Current HIV-1 strategies act to suppress the viral life cycle but do not effectively eradicate infection. Here, we demonstrate that an engineered recombinase can efficiently excise integrated HIV-1 proviral DNA from the genome of infected cells.

HIV-1 integrates into the host chromosome of infected cells and persists as a provirus flanked by long terminal repeats. Current treatment strategies ...

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The specification of replication timing is thought to be a dynamic process regulated by tissue-specific and developmental cues that are responsive to epigenetic modifications. However, the mechanisms regulating where and when DNA replication initiates along chromosomes remains poorly understood. Homologous chromosomes usually replicate synchronously, however there are notable exceptions to this rule. For example, in female mammalian cells one of the two X chromosomes becomes late replicating through a process known as X inactivation1. Along with this delay in replication timing, estimated to be 2-3 hr, the majority of genes become transcriptionally silenced on one X chromosome. In addition, a discrete cis-acting locus, known as the X inactivation center, regulates this X inactivation process, including the induction of delayed replication timing on the entire inactive X chromosome. In addition, certain chromosome rearrangements found in cancer cells and in cells exposed to ionizing radiation display a significant delay in replication timing of &gt;3 hours that affects the entire chromosome2,3. Recent work from our lab indicates that disruption of discrete cis-acting autosomal loci result in an extremely late replicating phenotype that affects the entire chromosome4. Additional 'chromosome engineering' studies indicate that certain chromosome rearrangements affecting many different chromosomes result in this abnormal replication-timing phenotype, suggesting that all mammalian chromosomes contain discrete cis-acting loci that control proper replication timing of individual chromosomes5.
Here, we present a method for the quantitative analysis of chromosome replication timing combined with fluorescent in situ hybridization. This method allows for a direct comparison of replication timing between homologous chromosomes within the same cell, and was adapted from6. In addition, this method allows for the unambiguous identification of chromosomal rearrangements that correlate with changes in replication timing that affect the entire chromosome. This method has advantages over recently developed high throughput micro-array or sequencing protocols that cannot distinguish between homologous alleles present on rearranged and un-rearranged chromosomes. In addition, because the method described here evaluates single cells, it can detect changes in chromosome replication timing on chromosomal rearrangements that are present in only a fraction of the cells in a population.

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

A quantitative method for the analysis of chromosome replication timing is described. The method utilizes BrdU incorporation in combination with fluorescent in situ hybridization (FISH) to assess replication timing of mammalian chromosomes. This technique allows for the direct comparison of rearranged and un-rearranged chromosomes within the same cell.

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

RNA Isolation from Cell Specific Subpopulations Using Laser-capture Microdissection Combined with Rapid Immunolabeling

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires precise identification of cells subpopulations from a heterogeneous tissue. Identification of cells of interest for LCM is usually based on morphological criteria or on fluorescent protein reporters. The combination of LCM and rapid immunolabeling offers an alternative and efficient means to visualize specific cell types and to isolate them from surrounding tissue. High-quality RNA can then be extracted from a pure cell population and further processed for downstream applications, including RNA-sequencing, microarray or qRT-PCR. This approach has been previously performed and briefly described in few publications. The goal of this article is to illustrate how to perform rapid immunolabeling of a cell population while keeping RNA integrity, and how to isolate these specific cells using LCM. Herein, we illustrated this multi-step procedure by immunolabeling and capturing dopaminergic cells in brain tissue from one-day-old mice. We highlight key critical steps that deserve special consideration. This protocol can be adapted to a variety of tissues and cells of interest. Researchers from different fields will likely benefit from the demonstration of this approach.

Gene expression analysis of a subset of cells in a specific tissue represents a major challenge. This article describes how to isolate high-quality total RNA from a specific cell population by combining a rapid immunolabeling method with laser capture microdissection.

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires ...

Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.

Provided is a protocol for developing a real-time recombinase polymerase amplification assay to quantify initial concentration of DNA samples using either a thermal cycler or a microscope and stage heater. Also described is the development of an internal positive control. Scripts are provided for processing raw real-time fluorescence data.

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Colorimetric Detection of Bacteria Using Litmus Test

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. Such methods need to be user-friendly and produce reliable results that can be easily interpreted by both specialists and non-professionals. The litmus test for pH is simple, quick, and effective as it reports the pH of a test sample via a simple color change. We have developed an approach to take advantage of the litmus test for bacterial detection. The method exploits a bacterium-specific RNA-cleaving DNAzyme to achieve two functions: recognizing a bacterium of interest and providing a mechanism to control the activity of urease. Through the use of magnetic beads immobilized with a DNAzyme-urease conjugate, the presence of bacteria in a test sample is relayed to the release of urease from beads to solution. The released urease is transferred to a test solution to hydrolyze urea into ammonia, resulting in an increase of pH that can be visualized using the classic litmus test.

We describe a protocol for colorimetric detection of E. coli using a modified litmus test that takes advantage of an RNA-cleaving DNAzyme, urease, and magnetic beads.

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. ...

Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Principles of Site-Specific Recombinase (SSR) Technology

Molecular Evolution of the Tre Recombinase

Interview: HIV-1 Proviral DNA Excision Using an Evolved Recombinase

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

RNA Isolation from Cell Specific Subpopulations Using Laser-capture Microdissection Combined with Rapid Immunolabeling

Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

Colorimetric Detection of Bacteria Using Litmus Test