The N2 strain and E. coli OP50 bacteria were obtained from the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The blmp-1(tm548) strain was obtained from the National Bioresource Project, Japan. The authors thank WormBase. This work was supported by NIH R01GM097591 to T.L.G., internal funding by Texas Woman&#39;s University to T.L.G, and TWU&#39;s Center for Student Research to M.F.L.

1. C. elegans maintenance
NOTE: N2 (wild type) and blmp-1(tm548) C. elegans strains were maintained on standard nematode growth media (NGM) plates at 20 &#176;C.
<ol>
	<li>Prepare NGM plates by dissolving 23.005 g of NGM powder in 973 mL of water in a 2 L flask. Cover the flask opening with aluminum foil (or autoclavable cap that allows venting) and secure the covering with autoclave tape. Autoclave to dissolve the powder and sterilize the contents with a sterilization cycle of at least 30 min.</li>
	<li>Cool the medium to 60 &#176;C in a water bath.</li>
	<li>To the cooled medium, add 25 mL of sterile 1 M phosphate (KH2PO4) buffer, pH 6.0; 1 mL of 1 M calcium chloride solution; and 1 mL of 1 M magnesium sulfate solution.</li>
	<li>Stir the medium on a magnetic stir plate to obtain a homogeneous mixture and to prevent uneven cooling and solidification (~5 min). Ensure that the stir bar spins fast enough to create a vortex but not so fast that bubbles are introduced (~250-300 rpm).</li>
	<li>Pour ~25 mL of the medium into each 10 cm Petri plate (~40 plates in total). Dry the plates at room temperature overnight (typically 16-25 &#176;C).</li>
	<li>Grow a colony of Escherichia coli OP50 in 30-50 mL of LB broth overnight at 37 &#176;C.</li>
	<li>Seed each plate with 500 &#181;L of E. coli OP50 culture and let them dry at room temperature before use (typically 16-25 &#176;C)8. Store the plates at 4 &#176;C for up to 3 weeks.</li>
	<li>Transfer C. elegans to seeded plates using a wire pick or other method and let them grow to L4 or adult stage at the temperature required for the strain (typically 16-25 &#176;C, 1-2 days if animals were plated starved as dauers, 3-4 days if animals were plated as embryos)8.</li>
</ol>
2. Single-worm DNA extraction
NOTE: This method is useful for extracting DNA from a single worm (one worm in 1.8 &#181;L of total volume). A master mix can be made if multiple worms will be lysed at one time.
<ol>
	<li>Program a thermocycler for one cycle at 55 &#176;C for 10 min followed by 95 &#176;C for 3 min (lysis program).</li>
	<li>Aliquot 0.8 &#181;L of the extraction solution from the kit onto the inside wall of a 0.2 mL PCR tube on ice. Add 0.2 &#181;L of the tissue preparation solution from the kit to the droplet of the extraction solution. Mix by pipetting.</li>
	<li>Identify an L4 or adult animal under a dissecting microscope9. To identify L4 hermaphrodites, look for a characteristic vulva that is visible as a pale half-circle in the middle of the animal. Identify adult hermaphrodites by looking for the largest animals on the plate that may have oval embryos visible in their uterus.</li>
	<li>Using a platinum wire pick, transfer the selected animal into the solution10.</li>
	<li>Centrifuge the tube briefly (2-3 s, &#8804;6,000 rpm/2,000 &#215; g) at room temperature to collect the contents at the bottom of the tube.</li>
	<li>Place the tube in the thermocycler and run the lysis program set at Step 2.1.</li>
	<li>When the program is complete, briefly centrifuge the tube and place it on ice. Add 0.8 &#181;L of the neutralization solution from the kit to the mixture. Mix by pipetting.</li>
	<li>Centrifuge the tube briefly at room temperature (2-3 s, &#8804;6,000 rpm/2,000 &#215; g).</li>
	<li>Directly use the lysate for PCR or store it at 4 &#176;C or &#8722;20 &#176;C for future use. 
	&#8203;NOTE: Extracted DNA is stable at 4 &#176;C or &#8722;20 &#176;C for at least 6 months7.</li>
</ol>
3. DNA extraction of a few individuals
NOTE: This method is useful for extracting DNA from a few worms. A master mix can be prepared if multiple strains will be lysed at one time.
<ol>
	<li>Program the thermocycler for one cycle at 55 &#176;C for 10 min followed by 95 &#176;C for 3 min (lysis program).</li>
	<li>Aliquot 2.0 &#181;L of the extraction solution from the kit onto the inside wall of a 0.2 mL PCR tube on ice. Add 0.5 &#181;L of the tissue preparation solution from the kit to the droplet of extraction solution. Mix by pipetting.</li>
	<li>Identify L4 or adult animals under a dissecting microscope9. L4 hermaphrodites have a characteristic vulva that is visible as a pale half-circle in the middle of the animal. Adult hermaphrodites are the largest animals on the plate and may have oval embryos visible in their uterus.</li>
	<li>Using a platinum wire pick, transfer a few animals into the solution: 9 animals yield 1 animal equivalent of genomic DNA per 0.5 &#181;L of lysate, and 16 animals yield ~1 animal equivalent of genomic DNA in 0.25 &#181;L (3.5 nematodes/&#181;L)10. 
	NOTE: It is difficult to transfer greater than 16 animals into this volume.</li>
	<li>Centrifuge the tube briefly at room temperature (2-3 s, &#8804;6,000 rpm/2,000 &#215; g).</li>
	<li>Place the tube in the thermocycler and run the lysis program set at Step 3.1.</li>
	<li>When the program is complete, briefly centrifuge the tube and place it on ice. Add 2 &#181;L of the neutralization solution from the kit to the mixture. Mix by pipetting.</li>
	<li>Centrifuge the tube briefly at room temperature (2-3 s, &#8804;6,000 rpm/2,000 &#215; g).</li>
	<li>Directly use the lysis for PCR or store it at 4 &#176;C or &#8722;20 &#176;C for future use. 
	&#8203;NOTE: Extracted DNA is stable at 4 &#176;C or &#8722;20 &#176;C for at least 6 months7.</li>
</ol>
4. PCR reaction
NOTE: One downstream application of this worm lysis technique, detecting a deletion mutation using a fast polymerase, is described. The effectiveness of the two worm lysis protocols in producing genomic template DNA for successful PCR at dilutions to 1/50th of a worm per reaction is also demonstrated.
<ol>
	<li>Extract DNA from a single worm and 16 worms using wild-type N2 and mutant strains, as described above in Step 2 and Step 3.</li>
	<li>Prepare 2-, 10-, 20-, and 50-fold dilutions of single-worm DNA from wild-type N2 animals.</li>
	<li>Set up PCR reactions following the manufacturer&#39;s protocol using primers specific to the sequence of interest and hot-start PCR master mix (Table 1 and Table 2). Use 1 &#181;L of undiluted DNA or 2 &#181;L of diluted DNA as the template in each reaction.</li>
	<li>Confirm the PCR products by gel electrophoresis and imaging11.</li>
</ol>

<ol><li>Corsi, A. K., Wightman, B., Chalfie, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+transparent+window+into+biology%3A+A+on+Caenorhabditis+elegans%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">A transparent window into biology: A on Caenorhabditis elegans.</a> WormBook. , ed. The C. elegans Community, WormBook 1-31 (2015).</li>
<li>Page, A. P., Johnstone, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+cuticle%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">The cuticle.</a> WormBook. , ed. The C. elegans Community, WormBook (2007).</li>
<li>Williams, B. D., Schrank, B., Huynh, C., Shownkeen, R., Waterston, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genetic+mapping+system+in+Caenorhabditis+elegans+based+on+polymorphic+sequence-tagged+sites%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites.</a> Genetics. 131, 609-624 (1992).</li>
<li>Lissemore, J. L., Lackner, L. L., Fedoriw, G. D., De Stasio, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+of+Caenorhabditis+elegans+genomic+DNA+and+detection+of+deletions+in+the+unc-93+gene+using+PCR%5BTitle%5D)+AND+%22Biochemistry+and+Molecular+Biology+Education%22%5BJournal%5D)">Isolation of Caenorhabditis elegans genomic DNA and detection of deletions in the unc-93 gene using PCR.</a> Biochemistry and Molecular Biology Education. 33, 219-226 (2005).</li>
<li>Fay, D., Bender, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SNPs%3A+introduction+and+two-point+mapping%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">SNPs: introduction and two-point mapping.</a> WormBook. , ed. The C. elegans Community, WormBook 1-10 (2008).</li>
<li>Biron, D. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aBiron%2C+D+%22C.+elegans%3A+Methods+and+Applications%22">C. elegans: Methods and Applications</a>. Haspel, G. , Humana Press. Totowa, NJ. (2015).</li>
<li>Sigma-Aldrich. Extract-N-Amp Tissue PCR Kit technical bulletin. , Available from: 
 <a target="_blank" href="https://www.sigmaaldrich.com/deepweb/assets/sigmaaldrich/product/documents/249/244/xnat2bul.pdf">https://www.sigmaaldrich.com/deepweb/assets/sigmaaldrich/product/documents/249/244/xnat2bul.pdf</a> (2013).</li>
<li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maintenance+of+C.+elegans%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">Maintenance of C. elegans.</a> WormBook. , ed. The C. Elegans Research Community, Wormbook (2006).</li>
<li>Sutphin, G. L., Kaeberlein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measuring+Caenorhabditis+elegans+life+span+on+solid+media%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">Measuring Caenorhabditis elegans life span on solid media.</a> Journal of Visualized Experiments: JoVE. (27), e1152(2009).</li>
<li>Chaudhuri, J., Parihar, M., Pires-daSilva, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+introduction+to+worm+lab%3A+from+culturing+worms+to+mutagenesis%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">An introduction to worm lab: from culturing worms to mutagenesis.</a> Journal of Visualized Experiments: JoVE. (47), e2293(2011).</li>
<li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">Agarose gel electrophoresis for the separation of DNA fragments.</a> Journal of Visualized Experiments: JoVE. (62), e3923(2012).</li>
<li>Gumienny, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Caenorhabditis+elegans+SMA-10%2FLRIG+is+a+conserved+transmembrane+protein+that+enhances+bone+morphogenetic+protein+signaling%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">Caenorhabditis elegans SMA-10/LRIG is a conserved transmembrane protein that enhances bone morphogenetic protein signaling.</a> PLoS Genetics. 6, 1000963(2010).</li>
<li>Nelson, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+bow-tie+genetic+architecture+for+morphogenesis+suggested+by+a+genome-wide+RNAi+screen+in+Caenorhabditis+elegans%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">A bow-tie genetic architecture for morphogenesis suggested by a genome-wide RNAi screen in Caenorhabditis elegans.</a> PLoS Genetics. 7, 1002010(2011).</li>
<li>Zhang, L., Zhou, D., Li, S., Jin, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BLMP-1+contributes+to+collagen-related+morphogenesis+in+C.+elegans%5BTitle%5D)+AND+%22Life+Science+Journal%22%5BJournal%5D)">BLMP-1 contributes to collagen-related morphogenesis in C. elegans.</a> Life Science Journal. 9, 1080-1088 (2012).</li>
<li>Horn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DRE-1%2FFBXO11-dependent+degradation+of+BLMP-1%2FBLIMP-1+governs+C.+elegans+developmental+timing+and+maturation%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">DRE-1/FBXO11-dependent degradation of BLMP-1/BLIMP-1 governs C. elegans developmental timing and maturation.</a> Developmental Cell. 28, 697-710 (2014).</li>
<li>Huang, T. -F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BLMP-1%2FBlimp-1+regulates+the+spatiotemporal+cell+migration+pattern+in+C.+elegans%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">BLMP-1/Blimp-1 regulates the spatiotemporal cell migration pattern in C. elegans.</a> PLoS Genetics. 10, 1004428(2014).</li>
<li>Lakdawala, M. F., Madhu, B., Faure, L., Vora, M., Padgett, R. W., Gumienny, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+interactions+between+the+DBL-1%2FBMP-like+pathway+and+dpy+body+size-associated+genes+in+Caenorhabditis+elegans%5BTitle%5D)+AND+%22Molecular+Biology+of+the+Cell%22%5BJournal%5D)">Genetic interactions between the DBL-1/BMP-like pathway and dpy body size-associated genes in Caenorhabditis elegans.</a> Molecular Biology of the Cell. 30, 3151-3160 (2019).</li>
<li>Madeira, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+EMBL-EBI+search+and+sequence+analysis+tools+APIs+in+2019%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">The EMBL-EBI search and sequence analysis tools APIs in 2019.</a> Nucleic Acids Research. 47, 636-641 (2019).</li>
</ol>

The authors have no conflicts of interest to disclose.

Determining the genotypes of C. elegans is an important step while performing genetic crosses to create new C. elegans strains. Genomic DNA extraction using a single or few C. elegans is a crucial step in genotyping C. elegans. This protocol describes genomic DNA extraction from C. elegans using a commercial kit. This method is fast and works robustly. The genomic DNA extracted using this method can be used for downstream applications, including genotyping, sequencing, and cloning. The described DNA extraction method has been optimized for genotyping C. elegans genetic crosses using single and a few L4 or adult animals as starting material for the DNA template. The equivalent of one-fiftieth of an animal (Figure 1C) to 3.5 animals (Figure 1D) provided a suitable template for amplifying target DNA sequences by PCR. This protocol (with dilution) yields enough template (at 2 &#181;L/reaction) for a maximum of 45 reactions from a single worm and for 100 reactions from 16 animals. Even using one worm per reaction, these protocols provide a cost-efficient way to extract DNA from C. elegans. Given the simplicity, robustness, and quickness of the protocol, it is well suited for both research and classroom applications.
As the protocol involves pipetting small volumes of reagents, the preparation of a master mix for multiple reactions, good pipetting technique, and using well-calibrated pipettes is recommended to ensure consistency. Using 0.5-1 &#181;L of undiluted DNA template from either single- or 9-16-animal lyses usually works for a 25 &#181;L PCR reaction using a hot-start PCR master mix, but optimization of the template concentration may be required. The reagents must be kept on ice for the duration of the experiment. To avoid repeated freeze-thawing of the DNA extraction solutions, which may reduce enzyme performance, it is recommended that the reagents be aliquoted and stored at &#8722;20 &#176;C.
For downstream applications requiring PCR, the use of a hot-start, high-speed PCR master mix further reduces the total time compared to the PCR reaction mix provided in the commercial tissue kit. High-speed polymerases can amplify products of less than 1 kb in 5-10 s (see the Table of Materials and Table 2 for polymerase descriptions), while the kit&#39;s PCR reaction mix uses a Taq DNA polymerase with an amplification rate of ~1 kb/min7. Products from some PCRs can be directly loaded into an agarose gel for electrophoresis, further reducing the steps and time. This reaction buffer is also compatible with restriction enzyme digestion. High-fidelity DNA polymerases also work robustly with DNA extracted using this protocol (Figure 1B). While the polymerases used consistently worked using kit-extracted template, the use of other polymerases may provide better results depending on the template, primer set properties, product size, and fidelity required. If problems are encountered following PCR, such as no target band amplified or additional bands amplified, further optimization of the primer working conditions or DNA template concentration may be required. It is strongly recommended that appropriate controls, including wild-type DNA template and the use of primers that have been proven to work, should be used.
This method will not be suitable for applications that require highly purified or a high yield of DNA template. While the number of animals prepared and the reaction volume may be scaled up, the DNA prepared using this method is not separated from organismal debris and may not be pure enough for highly sensitive applications such as whole-genome sequencing.
The major advantages of this method in comparison to the existing traditional genomic DNA extraction methods include the shorter time and simpler, easier steps. In the future, this method could be scaled up, adapted to extract C. elegans genomic DNA for other downstream applications, and used to extract DNA from other nematode species.

Here, two related protocols are presented for the lysis of Caenorhabditis elegans to make DNA accessible for PCR-based applications. PCR is a commonly used molecular technique used for many applications, including genotyping and amplifying DNA fragments for cloning and sequencing, among others. The small (1 mm), free-living roundworm C. elegans is a popular animal system for biological research. Obtaining suitable genomic DNA from a single animal or a few animals is sufficient to amplify the sequence by PCR. Late L4 larvae and adults contain only ~1,000 somatic cells (including some multi-nuclear, polyploid cells), germ cells, and (if the animal is a gravid hermaphrodite) offspring in utero1. However, these animals are protected by a cuticle that must be disrupted to extract the genomic DNA2. Standard methods to prepare nematode genomic DNA template for PCR involve multiple steps and take several hours. The animals are first frozen in worm lysis buffer containing proteinase K (&#8722;70 &#176;C or below) for at least 15-45 min (longer is recommended by some protocols)3,4,5,6. This step cracks open the animals.
After freezing, the animals are incubated for 1 h at 60-65 &#176;C for the proteinase K to work, then the enzyme is inactivated for 15-30 min at 95 &#176;C. The proteinase K destroys the nucleases that degrade DNA. The inactivation of proteinase K before PCR is important to prevent the proteinase K from degrading the DNA polymerase. The two kit-based protocols described here are quick, reliable, and cost-effective methods to extract genomic DNA from either a single animal or a few nematodes for everyday research and teaching laboratory applications. The kit used was originally optimized by the manufacturer to extract DNA from animal tissue, saliva, and hair7. It uses a proprietary tissue preparation solution and extraction solution to lyse cells and make genomic DNA accessible. A proprietary neutralization solution then neutralizes the components that may inhibit PCR (e.g., salts, ions, and Mg2+-binding molecules).
When genotyping, a single animal can be tested. When determining if a strain is homozygous, testing six or more offspring from a single animal gives high confidence that a line is homozygous or not (there is a 0.02% chance of randomly picking six homozygous mutant progeny from a heterozygous parent [(1/4)6 &#215; 100% = 0.02%]). This method 1) is straightforward, with fewer steps than the proteinase K method, and 2) decreases the template preparation time to 15 min. The results in this work demonstrate that the developed protocol works robustly in extracting genomic DNA from single or a few worms, which can be reliably used for downstream applications that do not require highly purified DNA, including PCR.

<table><tbody><tr><td>autoclave tape</td><td>Defend</td><td>43237-2</td><td></td></tr><tr><td>aluminium foil, heavy duty</td><td>Reynolds Wrap</td><td>2182934</td><td></td></tr><tr><td>calcium chloride</td><td>Millipore Sigma</td><td>102382 (CAS 10035-04-8)</td><td></td></tr><tr><td>Extract-N-Amp kit (includes Tissue Preparation Solution, Extraction Solution, and Neutralization Solution)</td><td>Sigma-Aldrich Co. LLC</td><td>XNAT2-1KT</td><td></td></tr><tr><td>Isotemp hotplate/stirrer</td><td>Fisher Scientific</td><td>11-100-495H</td><td></td></tr><tr><td>LB media, Lennox, capsules</td><td>MP Biomedicals, LLC</td><td>3002-131</td><td></td></tr><tr><td>magnesium sulfate, 97% pure, anhydrous</td><td>Thermo Scientific</td><td>AC413485000 (CAS 7487-88-9)</td><td></td></tr><tr><td>microcentrifuge</td><td>Labnet International, Inc.</td><td>PrismR, C2500-R</td><td></td></tr><tr><td>NEB Q5U Hot Start High-Fidelity DNA polymerase</td><td>New England Biolabs, Inc.</td><td>M0515S</td><td>&quot;Pol E&quot; used in Supplemental Figure S1, a high-speed, high-fidelity polymerase (20&amp;ndash;30 s/kb)</td></tr><tr><td>NGM media powder</td><td>US Biological Life Sciences</td><td>N1000</td><td></td></tr><tr><td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td><td>New England Biolabs, Inc.</td><td>M0531S</td><td>&quot;Pol D&quot; in Figure 1B, a high-speed, high-fidelity polymerase (15&amp;ndash;30 s/kb)</td></tr><tr><td>primers</td><td>Integrated DNA Technologies</td><td>custom DNA oligos</td><td></td></tr><tr><td>PrimeSTAR GXL polymerase</td><td>Takara Bio Inc.</td><td>R050B</td><td>&quot;Pol C&quot; in Figure 1B, a high-fidelity polymerase (1 min/kb) for GC-rich templates and templates up to 30 kb</td></tr><tr><td>Quick-Load Purple 2-log DNA Ladder (0.1&amp;ndash;10.0 kb)</td><td>New England Biolabs, Inc.</td><td>N0550S</td><td></td></tr><tr><td>SapphireAmp Fast PCR Master Mix</td><td>Takara Bio Inc.</td><td>RR350A</td><td>&quot;Pol A&quot; in Figure 1B, polymerase used in Figure 1A, C, D, a high-speed polymerase (10 s/kb) for targets up to 5 kb</td></tr><tr><td>Sigma ReadyMix Taq PCR reaction mix</td><td>Sigma-Aldrich Co. LLC</td><td>P4600</td><td>&quot;Pol B&quot; in Figure 1B, a polymerase (1 min/kb) for targets up to 7 kb</td></tr><tr><td>SimpliAmp thermal cycler</td><td>Applied Biosystems</td><td>A24812</td><td></td></tr><tr><td>stir bar</td><td>Fisher Scientific</td><td>14-512-126</td><td></td></tr><tr><td>vortex mixer</td><td>Fisher Scientific</td><td>2215365</td><td></td></tr><tr><td>worm pick</td><td>Genesee Scientific Corporation</td><td>59-AWP</td><td></td></tr></tbody></table>

small-scale extraction of caenorhabditis elegans genomic dna

Genomic DNA extraction from single or a few Caenorhabditis elegans has many downstream applications, including PCR for genotyping lines, cloning, and sequencing. The traditional proteinase K-based methods for genomic DNA extraction from C. elegans take several hours. Commercial extraction kits that effectively break open the C. elegans cuticle and extract genomic DNA are limited. An easy, faster (~15 min), and cost-efficient method of extracting C. elegans genomic DNA that works well for classroom and research applications is reported here. This DNA extraction method is optimized to use single or a few late-larval (L4) or adult nematodes as starting material for obtaining a reliable template to perform PCR. The results indicate that the DNA quality is suitable for amplifying gene targets of different sizes by PCR, permitting genotyping of single or a few animals even at dilutions to one-fiftieth of the genomic DNA from a single adult per reaction. The reported protocols can be reliably used to quickly produce DNA template from a single or a small sample of C. elegans for PCR-based applications.

Genomic DNA from a single or a few wild-type adults was extracted using the commercial kit or traditional lysis protocol to compare the efficacy of these two methods. These lysates were then used as templates for PCR to amplify either a larger target of ~2,100 bp (encoding blmp-1) or a smaller target of ~500 bp (encoding a part of sma-10). Both methods successfully yielded appropriate PCR products (Figure 1A).
Next, the ability of kit-extracted genomic DNA to serve as template for a variety of DNA polymerases was demonstrated. Extracted genomic DNA was used as template for amplifying a 0.5 kb product using four polymerases that possess different capabilities (including speed, fidelity, and product size). Products of expected sizes were generated by these polymerases using template from a single-adult lysis or a nine-adult lysis (Figure 1B). The template sequence and fidelity of the PCR polymerases to correctly amplify the template sequence can be confirmed by sequencing (Supplemental Figure S1). This result demonstrates that the genomic DNA extracted from the kit protocols provides a suitable template for a range of polymerases.
PCR efficacy was tested using different concentrations of the genomic DNA extracted from a single animal using the commercial kit. DNA was diluted by 2-, 10-, 20-, or 50-fold, and the equivalent to about one-half, one-tenth, one-twentieth, and one-fiftieth of a worm per reaction was used for PCRs. These DNA template concentrations supported the amplification of either a larger target of ~2.1 kb or a smaller target of ~0.5 kb (Figure 1C)12. While a DNA concentration-dependent yield of the 0.5 kb PCR product was observed, the 2.1 kb PCR product yield appeared equivalent in all reactions.
To demonstrate that these protocols produce genomic DNA from C. elegans that is suitable for PCR genotyping, genomic DNA was extracted from single and 16 wild-type and blmp-1 loss-of-function mutants (blmp-1(tm548)). The blmp-1 gene encodes a transcription factor with important roles in distal tip cell migration, body size, and development12,13,14,15,16. The blmp-1 mutant has an 810 bp deletion that removes parts of exon 3 and intron 315. Primers were designed that result in a 2,134 bp product when the wild-type DNA template is used and a 1,324 bp product if blmp-1(-) DNA is used. PCR products of the appropriate sizes were detected using 1 &#181;L of either single-worm (about 0.5 worms per reaction) or 16-worm lysis from L4 staged animals (3.5 worms per reaction) (Figure 1D). This result shows that kit-extracted genomic DNA using either protocol provides equally effective templates for PCR to genotype lines.
These results show that C. elegans genomic DNA preparations using a commercial tissue DNA extraction kit from single and multiple animals can be reliably used as templates for PCR.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63716/63716fig1v2.jpg" /> 
Figure 1: DNA preparations using a commercial kit from single nematodes and multiple nematodes allow robust amplification by PCR. PCR products were loaded on 1% agarose gel in 1x TAE buffer (5 &#181;L (A,B) or 10 &#181;L (C,D) and run at 90-100 V for 30 min to 2 h. A 2-log DNA ladder was used for all gels. (A) Comparison of DNA lysis by kit to traditional proteinase K methods to create template using two primer sets. Wild-type adults were lysed, and the equivalent of one animal was used as template for all reactions. Lanes 1-4, 2.1 kb product. Lane 1, PCR from single-worm lysis by proteinase K. Lane 2, PCR from single-worm lysis by the kit method. Lane 3, PCR from nine-worm worm lysis by proteinase K. Lane 4, PCR from nine-worm worm lysis by the kit method. Lanes 5-8, 0.5 kb product. Lane 5, PCR from single-worm lysis by proteinase K. Lane 6, PCR from single-worm lysis by the kit method. Lane 7, PCR from nine-worm worm lysis by proteinase K. Lane 8, PCR from nine-worm worm lysis by the kit method. (B) The kit method for DNA lysis provides a suitable template for PCR by multiple polymerases. Wild-type adults were lysed using the kit method, and the equivalent of one-half of an animal was used as PCR template for a 0.5 kb product. See the Table of Materials for polymerase details. Lane 1, PCR from a single-worm lysis with a high-speed polymerase. Lane 2, PCR from a nine-worm lysis with a high-speed polymerase. Lane 3, PCR from a single-worm lysis with a Taq polymerase. Lane 4, PCR from a nine-worm lysis with a Taq polymerase. Lane 5, PCR from a single-worm lysis with a high-fidelity polymerase. Lane 6, PCR from a nine-worm lysis with a high-fidelity polymerase. Lane 7, PCR from a single-worm lysis with a high-speed, high-fidelity polymerase. Lane 8, PCR from a nine-worm lysis with a high-speed, high-fidelity polymerase. (C) Dilutions of one wild-type L4 worm lysis provide template for PCR. Lanes 1-5, 2.1 kb product. Lanes 6-10, 0.5 kb target. Lane 1 and lane 6, undiluted DNA. Lane 2 and lane 7, 2-fold diluted DNA. Lane 3 and lane 8, 10-fold diluted DNA. Lane 4 and lane 9, 20-fold diluted DNA. Lane 5 and lane 10, 50-fold diluted DNA. (D) Genotyping the blmp-1 locus by PCR using 1 &#181;L of single- and 16-worm DNA preparations as template. Lane 1, PCR from wild-type single-worm lysis. Lane 2, PCR from blmp-1(-) single-worm lysis. Lane 3, PCR from wild-type 16-worm lysis. Lane 4, PCR from blmp-1(-) 16-worm lysis. Abbreviations: prep = method of preparation; kb = kilobase; st. = nematode stage; dil. = dilution of DNA. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63716/63716fig1v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target</td>
			<td>Primer name</td>
			<td colspan="3">Sequence</td>
		</tr>
		<tr>
			<td rowspan="2">blmp-1</td>
			<td>forward</td>
			<td colspan="3">GCGTCAGGTAAGTTGTGATA</td>
		</tr>
		<tr>
			<td>reverse</td>
			<td colspan="3">CAGTTATTGCGGCTGTTGTT</td>
		</tr>
		<tr>
			<td rowspan="2">sma-10</td>
			<td>forward</td>
			<td colspan="3">AATGTGTGGCAAGGAATCG</td>
		</tr>
		<tr>
			<td>reverse</td>
			<td colspan="3">TGTCTGTCCAACGAGAAGTG</td>
		</tr>
		<tr>
			<td rowspan="2">sequencing</td>
			<td>1</td>
			<td colspan="3">CACATCCCGGACGCCTTAAT</td>
		</tr>
		<tr>
			<td>2</td>
			<td colspan="3">CTAATTGTTTTCTACCTGGC</td>
		</tr>
	</tbody>
</table>
Table 1: List of primers.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>A.</td>
			<td>Pol A, Pol B, Pol D</td>
			<td>Pol E</td>
		</tr>
		<tr>
			<td>PCR Master Mix</td>
			<td>12.5 &#181;L</td>
			<td>12.5 &#181;L</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>0.2 &#181;M (final concentration)</td>
			<td>0.5 &#181;M (final concentration)</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>0.2 &#181;M (final concentration)</td>
			<td>0.5 &#181;M (final concentration)</td>
		</tr>
		<tr>
			<td>template DNA</td>
			<td>variable</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>to 25 &#181;L</td>
			<td>to 25 &#181;L</td>
		</tr>
	</tbody>
</table>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>B.</td>
			<td>Pol C</td>
		</tr>
		<tr>
			<td>PCR 5x buffer</td>
			<td>2.5 &#181;L</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>2.0 &#181;L</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>0.2 &#181;M (final concentration)</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>0.2 &#181;M (final concentration)</td>
		</tr>
		<tr>
			<td>template DNA</td>
			<td>variable</td>
		</tr>
		<tr>
			<td>polymerase</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>to 25 &#181;L</td>
		</tr>
	</tbody>
</table>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">C. PCR program used for Figure 1B</td>
		</tr>
		<tr>
			<td>temperature</td>
			<td>time</td>
			<td>cycles</td>
		</tr>
		<tr>
			<td>98 &#176;C</td>
			<td>2 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>98 &#176;C</td>
			<td>1 min</td>
			<td rowspan="3">30</td>
		</tr>
		<tr>
			<td>55 &#176;C</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>1 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>4 &#176;C</td>
			<td>hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">D. PCR program used for Supplemental Figure S1</td>
		</tr>
		<tr>
			<td>temperature</td>
			<td>time</td>
			<td>cycles</td>
		</tr>
		<tr>
			<td>98 &#176;C</td>
			<td>30 s</td>
			<td>1</td>
		</tr>
		<tr>
			<td>98 &#176;C</td>
			<td>10 s</td>
			<td rowspan="3">30</td>
		</tr>
		<tr>
			<td>57 &#176;C</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>50 s</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>2 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>4 &#176;C</td>
			<td>hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: PCR reaction components.
Supplemental Figure S1: Sequencing for confirmation of the quality of genomic DNA prepared with a commercial kit. The results from two sequencing reactions completely match the expected sequence of over 1,600 nucleotides of DNA amplified by a high-speed, high-fidelity polymerase (Pol E) from a 16-worm lysis (Table 1, Table 2A,&#160;and Table 2D). Sequencing read ends were trimmed to remove low-quality base reads. Alignment was performed using the EMBL-EBI multiple sequence alignment tool MUSCLE (MUltiple Sequence Comparison by Log-Expectation)17. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63716/63716figS1.zip" target="_blank">Please click here to download this File.</a>

Watch this Scientific Journal Video about Small-Scale Extraction of Caenorhabditis elegans Genomic DNA at JoVE.com

Small-Scale Extraction of Caenorhabditis elegans Genomic DNA

Presented here is a description of the straightforward and relatively rapid isolation of Caenorhabditis elegans genomic DNA from one or a few animals using a commercially available tissue kit. The resulting gDNA preparation is a suitable template for PCR.

Small-Scale Extraction of Caenorhabditis elegans Genomic DNA

Genomic DNA extraction from single or a few Caenorhabditis elegans has many downstream applications, including PCR for genotyping lines, cloning, and ...

small-scale-extraction-of-caenorhabditis-elegans-genomic-dna

Nanyang Technological University

Research

JoVE Journal

Biology

5.1K Views.  Texas Woman’s University. Presented here is a description of the straightforward and relatively rapid isolation of Caenorhabditis elegans genomic DNA from one or a few animals using a commercially available tissue kit. The resulting gDNA preparation is a suitable template for PCR.

Video: Small-Scale Extraction of Caenorhabditis elegans Genomic DNA

Isolation of Active Caenorhabditis elegans Nuclear Extract and Reconstitution for In Vitro Transcription

Caenorhabditis elegans has been an important model system for biological research since it was introduced in 1963. However, C. elegans has not been fully utilized in the biochemical study of biological reactions using its nuclear extracts such as in vitro transcription and DNA replication. A significant hurdle for using C. elegans in biochemical studies is disrupting the nematode&#39;s thick outer cuticle without sacrificing the activity of the nuclear extract. While several methods are used to break the cuticle, such as Dounce homogenization or sonication, they often lead to protein instability. There are no established protocols for isolating active nuclear proteins from larva or adult C. elegans for in vitro reactions. Here, the protocol describes in detail the homogenization of larval stage 4 C. elegans using a Balch homogenizer. The Balch homogenizer uses pressure to slowly force the animals through a narrow gap breaking the cuticle in the process. The uniform design and precise machining of the Balch homogenizer allow for consistent grinding of animals between experiments. Fractionating the homogenate obtained from the Balch homogenizer yields functionally active nuclear extract that can be used in an in vitro method for assaying transcription activity of C. elegans.

Isolation of Active Caenorhabditis elegans Nuclear Extract and Reconstitution for In Vitro Transcription

Here, we describe a detailed protocol for isolating active nuclear extract from larval stage 4 C. elegans and visualizing transcription activity in an in vitro system.

Caenorhabditis elegans has been an important model system for biological research since it was introduced in 1963. However, C. elegans has not been fully ...

Biochemistry

Protein Extract Preparation and Co-immunoprecipitation from Caenorhabditis elegans

Co-immunoprecipitation methods are frequently used to study protein-protein interactions. Confirmation of hypothesized protein-protein interactions or identification of new ones can provide invaluable information about the function of a protein of interest. Some of the traditional methods for extract preparation frequently require labor-intensive and time-consuming techniques. Here, a modified extract preparation protocol using a bead mill homogenizer and metal beads is described as a rapid alternative to traditional protein preparation methods. This extract preparation method is compatible with downstream co-immunoprecipitation studies. As an example, the method was used to successfully co-immunoprecipitate&#160;C. elegans microRNA Argonaute ALG-1 and two known ALG-1 interactors: AIN-1, and HRPK-1. This protocol includes descriptions of animal sample collection, extract preparation, extract clarification, and protein immunoprecipitation. The described protocol can be adapted to test for interactions between any two or more endogenous, endogenously tagged, or overexpressed C. elegans proteins in a variety of genetic backgrounds.

Protein Extract Preparation and Co-immunoprecipitation from Caenorhabditis elegans

This method describes a protocol for high-throughput protein extract preparation from Caenorhabditis elegans samples and subsequent co-immunoprecipitation.

Co-immunoprecipitation methods are frequently used to study protein-protein interactions. Confirmation of hypothesized protein-protein interactions or ...

Developmental Biology

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples1,2. Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage3, thus providing an ideal experiment model for studying questions in cell biology4,5and development6-9. C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis10,11) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis12-15). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters16,17. These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo18-21. In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

The C. elegans embryo is a powerful system for studying cell biology and development. We present a protocol for live imaging of C. elegans embryos utilizing DIC optics or fluorescence using readily available epifluorescent microscopes and open-source software.

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using ...

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

A single biological sample holds a plethora of information, and it is now common practice to simultaneously investigate several macromolecules to capture a full picture of the multiple levels of molecular processing and changes between different conditions. This protocol presents the method of isolating DNA, RNA, and protein from the same sample of the nematode Caenorhabditis elegans to remove the variation introduced when these biomolecules are isolated from replicates of similarly treated but ultimately different samples. Nucleic acids and protein are extracted from the nematode using the acid guanidinium thiocyanate-phenol-chloroform extraction method, with subsequent precipitation, washing, and solubilization of each. We show the successful isolation of RNA, DNA, and protein from a single sample from three strains of nematode and HeLa cells, with better protein isolation results in adult animals. Additionally, guanidinium thiocyanate-phenol-chloroform-extracted protein from nematodes improves the resolution of larger proteins, with enhanced detectable levels as observed by immunoblotting, compared to the traditional RIPA extraction of protein.
The method presented here is useful when investigating samples using a multiomic approach, specifically for the exploration of the proteome and transcriptome. Techniques that simultaneously assess multiomics are appealing because molecular signaling underlying complex biological phenomena is thought to occur at complementary levels; however, it has become increasingly common to see that changes in mRNA levels do not always reflect the same change in protein levels and that the time of collection is relevant in the context of circadian regulations. This method removes any intersample variation when assaying different contents within the same sample (intrasample.)

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

Here, we present a protocol for the isolation of RNA, DNA, and protein from the same sample, in an effort to reduce variation, improve reproducibility, and facilitate interpretations.

A single biological sample holds a plethora of information, and it is now common practice to simultaneously investigate several macromolecules to capture ...

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Caenorhabditis elegans is one of the major model organisms in biology, but only recently have researchers focused on its natural ecology. The relative sparsity of information about C. elegans in its natural context comes from the challenges involved in the identification of the small nematode in nature. Despite these challenges, an increasing focus on the ecology of C. elegans has caused a wealth of new information regarding its life outside of the laboratory. The intensified search for C. elegans in nature has contributed to the discovery of many new Caenorhabditis species and revealed that congeneric nematodes frequently cohabitate in the wild, where they feed on microbial blooms associated with rotting plant material. The identification of new species has also revealed that the androdioecious mating system of males and self-fertilizing hermaphrodites has evolved three times independently within Caenorhabditis. The other two selfing species, C. briggsae and C. tropicalis, share the experimental advantages of C. elegans and have enabled comparative studies into the mechanistic basis of important traits, including self-fertilization. Despite these advances, much remains to be learned about the ecology and natural diversity of these important species. For example, we still lack functional information for many of their genes, which might only be attained through an understanding of their natural ecology. To facilitate ecological research of selfing Caenorhabditis nematodes, we developed a highly scalable method to collect nematodes from the wild. Our method makes use of mobile data collection platforms, cloud-based databases, and the R software environment to enhance researchers&#39; ability to collect nematodes from the wild, record associated ecological data, and identify wild nematodes using molecular barcodes.

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

This protocol can be used to perform large-scale ecological surveys of selfing Caenorhabditis nematodes. The primary advantage of this method is the efficient organization and analysis of ecological and molecular data associated with the nematodes collected from nature.

Caenorhabditis elegans is one of the major model organisms in biology, but only recently have researchers focused on its natural ecology. The relative ...

Laser Microdissection for Species-Agnostic Single-Tissue Applications

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic &#34;toolkits,&#34; such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.
LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.
Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific ...

Hand Dissection of Caenorhabditis elegans Intestines

Comprised of only 20 cells, the Caenorhabditis elegans intestine&#160;is the nexus of many life-supporting functions, including digestion, metabolism, aging, immunity, and environmental response. Critical interactions between the C. elegans host and its environment converge within the intestine, where gut microbiota concentrate. Therefore, the ability to isolate intestine tissue away from the rest of the worm is necessary to assess intestine-specific processes. This protocol describes a method for hand dissecting adult C. elegans intestines. The procedure can be performed in fluorescently labeled strains for ease or training purposes. Once the technique is perfected, intestines can be collected from unlabeled worms of any genotype. This microdissection approach allows for the simultaneous capture of host intestinal tissue and gut microbiota, a benefit to many microbiome studies. As such, downstream applications for the intestinal preparations generated by this protocol can include but are not limited to RNA isolation from intestinal cells and DNA isolation from captured microbiota. Overall, hand dissection of C. elegans intestines affords a simple and robust method to investigate critical aspects of intestine biology.

Hand Dissection of Caenorhabditis elegans Intestines

The present protocol describes a procedure for isolating intestines from adult Caenorhabditis elegans nematode worms by hand for input in genomics, proteomics, microbiome, or other assays.

Comprised of only 20 cells, the Caenorhabditis elegans intestine&#160;is the nexus of many life-supporting functions, including digestion, metabolism, ...

Isolation and Characterization of the Natural Microbiota of the Model Nematode Caenorhabditis elegans

The nematode Caenorhabditis elegans interacts with a large diversity of microorganisms in nature. In general, C. elegans is commonly found in rotten plant matter, especially rotten fruits like apples or on compost heaps. It is also associated with certain invertebrate hosts such as slugs and woodlice. These habitats are rich in microbes, which serve as food for C. elegans and which can also persistently colonize the nematode gut. To date, the exact diversity and consistency of the native C. elegans microbiota across habitats and geographic locations is not fully understood. Here, we describe a suitable approach for isolating C. elegans from nature and characterizing the microbiota of worms. Nematodes can be easily isolated from compost material, rotting apples, slugs, or attracted by placing apples on compost heaps. The prime time for finding C. elegans in the Northern Hemisphere is from September until November. Worms can be washed out of collected substrate material by immersing the substrate in buffer solution, followed by the collection of nematodes and their transfer onto nematode growth medium or PCR buffer for subsequent analysis. We further illustrate how the samples can be used to isolate and purify the worm-associated microorganisms and to process worms for 16S ribosomal RNA analysis of microbiota community composition. Overall, the described methods may stimulate new research on the characterization of the C. elegans microbiota across habitats and geographic locations, thereby helping to obtain a comprehensive understanding of the diversity and stability of the nematode's microbiota as a basis for future functional research.

Isolation and Characterization of the Natural Microbiota of the Model Nematode Caenorhabditis elegans

Caenorhabditis elegans is one of the main model species in biology, yet almost all research is performed in the absence of its naturally associated microbes. The methods described here will help to improve our understanding of the diversity of associated microbes as a basis for future functional C. elegans research.

The nematode Caenorhabditis elegans interacts with a large diversity of microorganisms in nature. In general, C. elegans is commonly found in rotten plant ...

Compost Microcosms as Microbially Diverse, Natural-like Environments for Microbiome Research in Caenorhabditis elegans

The nematode Caenorhabditis elegans is emerging as a useful model for studying the molecular mechanisms underlying interactions between hosts and their gut microbiomes. While experiments with well-characterized bacteria or defined bacterial communities can facilitate the analysis of molecular mechanisms, studying nematodes in their natural microbial context is essential for exploring the diversity of such mechanisms. At the same time, the isolation of worms from the wild is not always feasible, and, even when possible, sampling from the wild restricts the use of the genetic toolkit otherwise available for C. elegans research. The following protocol describes a method for microbiome studies utilizing compost microcosms for the in-lab&#160;growth in microbially diverse and natural-like environments.
Locally sourced soil can be enriched with produce to diversify the microbial communities in which worms are raised and from which they are harvested, washed, and surface-sterilized for subsequent analyses. Representative experiments demonstrate the ability to modulate the microbial community in a common soil by enriching it with different produce and further demonstrate that worms raised in these distinct environments assemble similar gut microbiomes distinct from their respective environments, supporting the notion of a species-specific core gut microbiome. Overall, compost microcosms provide natural-like in-lab environments for microbiome research as an alternative to synthetic microbial communities or to the isolation of wild nematodes.

Compost Microcosms as Microbially Diverse, Natural-like Environments for Microbiome Research in Caenorhabditis elegans

Compost microcosms bring the microbial diversity found in nature into the laboratory to facilitate microbiome research in Caenorhabditis elegans. Provided here are protocols for setting up microcosm experiments, with the experiments demonstrating the ability to modulate environmental microbial diversity to explore the relationships between environmental microbial diversity and worm gut microbiome composition.

The nematode Caenorhabditis elegans is emerging as a useful model for studying the molecular mechanisms underlying interactions between hosts and their ...

Single Cell Dissociation of Caenorhabditis elegans: A Method to Isolate Live Cells

Source: Germany, E. M., et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/60145/isolation-specific-neuron-populations-from-roundworm-caenorhabditis">Isolation of Specific Neuron Populations from Roundworm Caenorhabditis elegans</a>. J. Vis. Exp. (2019).
This video describes a method to dissociate whole worms into a single-cell suspension suitable for FACS or immunoprecipitation of intact cells.

Dysocjacja pojedynczych komórek Caenorhabditis elegans: metoda izolowania żywych komórek

Source: Germany, E. M., et al. Isolation of Specific Neuron Populations from Roundworm Caenorhabditis elegans. J. Vis. Exp. (2019).
This video describes a ...

Small-Scale Extraction of Caenorhabditis elegans Genomic DNA

Podsumowanie

Przeglądaj więcej filmów

Isolation of Active Caenorhabditis elegans Nuclear Extract and Reconstitution for In Vitro Transcription

Protein Extract Preparation and Co-immunoprecipitation from Caenorhabditis elegans

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Laser Microdissection for Species-Agnostic Single-Tissue Applications

Hand Dissection of Caenorhabditis elegans Intestines

Isolation and Characterization of the Natural Microbiota of the Model Nematode Caenorhabditis elegans

Compost Microcosms as Microbially Diverse, Natural-like Environments for Microbiome Research in Caenorhabditis elegans

Dysocjacja pojedynczych komórek Caenorhabditis elegans: metoda izolowania żywych komórek