We thank the 502 team for all the help. This work is partly supported by the Beijing Municipal Natural Science Foundation (Z200014) and National Key R&#38;D Program of China (2017YFA0105300).

This study is approved by the institutional Ethics Committee of Beijing Tongren Hospital, Capital Medical University. H9 hESCs are obtained from the WiCell Research Institute.
1. Generation of RB1 mutated hESC
<ol>
	<li>CRISPR/Cas9 targeting vector for the knockout (KO) of RB1.
	<ol>
		<li>Design a pair of sgRNA. For the ablation of RB1, target the first exon of this gene. The forward primer sequence is CACCGCGGTGGCGGCCGTTTTTCGG, and the reverse primer sequence is AAACCCGAAAAACGGCCGCCACCGC. 
		NOTE: For the specific RB1 mutation, a repaired template is also required. In this protocol, RB1-KO cell line is used as an example.</li>
		<li>Digest 1 &#181;g of pX330-U6-Chimeric BB-CBh-hSpCas9-2A-Puro with BbsI restriction enzymes (see Table of Materials) for 30 min at 37 &#176;C by following the manufacturer&#39;s instructions.</li>
		<li>Purify the digested plasmids using a purification kit according to the manufacturers&#39; instructions. 
		NOTE: Enzymatic reactions could be directly cleaned up without agarose gel using the purification kit (see Table of Materials).</li>
		<li>Phosphorylate and anneal each pair of oligos using the T4 polynucleotide kinase (PNK) (Table of Materials) with the reaction comprising 1 &#181;L of oligo1 (100 &#181;M), 1 &#181;L of oligo2 (100 &#181;M), 1 &#181;L of 10x T4 Ligation Buffer, 6.5 &#181;L of ddH2O, and 0.5 &#181;L of T4 PNK. 
		NOTE: The forward and reverse primers in step 1.1.1 are a pair of oligos. Phosphorylate and anneal the oligos in a thermocycler using the following parameters: 37 &#176;C for 30 min; 95 &#176;C for 5 min; ramp down to 25 &#176;C at 5 &#176;C per minute.</li>
		<li>Dilute the phosphorylated and annealed oligos 200 times by adding 1 &#181;L of oligo reagent to 199 &#181;L of nuclease-free water at room temperature (RT).</li>
		<li>Set up the ligation reaction and incubate at RT for 10 min by mixing the following: 50 ng of Bbs1 digested plasmid from step 1.1.3, 1 &#181;L of oligo duplex from step 1.1.5, 5 &#181;L of 2x ligation buffer, 1 &#181;L of ligase, and top up to 10 &#181;L using nuclease-free water.</li>
		<li>Transform the ligation mixture and sequence the positive colonies for the next step. 
		NOTE: Use U6 forward or reverse primer for sequencing.
		<ol>
			<li>Thaw the competent cells on ice.</li>
			<li>Take 50 &#181;L of the competent cells in a 1.5 mL microcentrifuge tube.</li>
			<li>Add 1 &#181;L of the ligation mixture from step 1.1.6 into the competent cells.</li>
			<li>Mix gently by pipetting up and down the tube three times. 
			NOTE: Do not vortex.</li>
			<li>Place the mixture on ice for 30 min.</li>
			<li>Heat shock the mixture at 42 &#176;C for 90 s.</li>
			<li>Add 950 &#181;L of room temperature Luria-Bertani (LB) broth without antibiotic to the tube.</li>
			<li>Place the tube in a shaker at 300 rpm at 37 &#176;C for 60 min.</li>
			<li>Warm the LB plates (peptone, peptone from casein, sodium chloride, agar-agar, and ampicillin) to 37 &#176;C in advance.</li>
			<li>Spread 50-100 &#181;L of the cells and ligation mixture onto the plates at RT.</li>
			<li>Incubate the plates overnight at 37 &#176;C.</li>
			<li>Pick up 12 colonies from the plate and transfer them to the LB medium with ampicillin. Place the medium on a shaker at 300 rpm for 60 min.</li>
			<li>Use 1 &#181;L of the bacteria solution (from step 1.1.7.12) as template for PCR and select the positive colonies.</li>
			<li>Sequence the positive colonies by the U6 primers, use the colony with the designed sgRNA sequences in the next step.</li>
		</ol>
		</li>
		<li>Extract the plasmid using a midi kit (see Table of Materials). 
		NOTE: The quality and the quantity of the plasmid using a mini kit are not enough for the following nucleofection experiment. Midi or maxi kit is more suitable than the mini kit.</li>
	</ol>
	</li>
	<li>HESC culture and nucleofection. 
	NOTE: Prewarm all the reagents to RT.
	<ol>
		<li>Thaw 1 x 106 H9 cells into a pre-coated 6-well plate with 10 &#181;M Y-27632 (ROCK inhibitor) and 2 mL of fresh ncEpic-hiPSC/hESC culture medium. 
		NOTE: Coat the 6-well plate with 1% Growth factor reduced basement membrane matrix for at least 30 min at 37 &#176;C before use.</li>
		<li>The next day, remove the supernatant, rinse the cells with 1x Dulbecco&#39;s Phosphate-Buffered Saline (DPBS), and then add 2 mL of fresh ncEpic-hiPSC/hESC culture medium.</li>
		<li>Change the medium every day with 2 mL of fresh ncEpic-hiPSC/hESC culture medium in the following 3-5 days until the cells grow to around 80% confluency.</li>
		<li>Passage once or twice to adjust the state of the hESC. 
		NOTE: The easiest way to identify the state of the hESC is the morphology.</li>
		<li>Culture the undifferentiated H9 cells in a 6-well plate until they reach 80% confluency.</li>
		<li>Change the medium 2 h before the nucleofection with 2 mL of fresh ncEpic-hiPSC/hESC culture medium mixed with 10 &#181;M of Y-27632 and precoat one well of a 12-well plate using 1% Growth factor reduced basement membrane matrix.</li>
		<li>Aspirate the medium and rinse with 1 mL of prewarmed DPBS.</li>
		<li>Remove the DPBS and incubate with 1 mL of cell dissociation enzyme (see Table of Materials) for 3.5 min at 37 &#176;C.</li>
		<li>Add 1 mL of fresh ncEpic-hiPSC/hESC culture medium to the cells and pipette twice to make the H9 cells into a single cell suspension.</li>
		<li>Take out 100 &#181;L of the mixture for cell counting and transfer the remaining to a 15 mL centrifuge tube containing another 2 mL of ncEpic-hiPSC/hESC culture medium inside.</li>
		<li>Centrifuge at 200 x g for 5 min. Remove the supernatant and resuspend around 2 x 106 cells into a 100 &#181;L reaction volume. According to the manufacturer&#39;s protocol, optimize the volume for the cells, plasmids, nucleofector, and reaction conditions. See Table of Materials for the nucleofection system used in this protocol. 
		NOTE: Generally, bubbles are not allowed during the nucleofection.</li>
		<li>After transfection, transfer the cells to the precoated 12-well plate, supplement with 1.5 mL of ncEpic-hiPSC/hESC culture medium and 10 &#181;M of Y-27632, and then culture the cells in a 37 &#176;C, 5% CO2 incubator.</li>
		<li>Change the medium daily. After 48 h, add 2 &#181;g/mL of puromycin for cell selection around one week. 
		NOTE: Numerous cells die during the first 3 days. The remaining cells may proliferate and generate into colonies in the following week after the puromycin selection. In the selection week, ensure that the medium always contains 2 &#181;g/mL of puromycin.</li>
		<li>Pick the colonies manually under a microscope. 
		NOTE: The colony morphology is the same as the hES colony. Cut the colonies into pieces (2-6 pieces per colony) with a 10 &#181;L white/normal pipette tip in the medium and transfer one colony into one precoated well of a 12-well plate.</li>
		<li>First, Identify the RB1 mutations and the off-target situations (Table 1), and then pluripotency to characterize the RB1 knockout H9 cell line. 
		&#8203;NOTE: Detect the RB1 mutations and the off-target situations using PCR and sanger sequencing. Identify the pluripotency markers by RT-PCR and Immunofluorescence.</li>
	</ol>
	</li>
</ol>
2. Generation of human retinoblastoma
<ol>
	<li>Maintenance of RB1-KO hESC.
	<ol>
		<li>Culture the gene-edited H9 cells in a Growth factor reduced basement membrane matrix coated 6-well plate with 2 mL of ncEpic-hiPSC/hESC culture medium and change the medium every day.</li>
		<li>Passage using EDTA buffer for 3.5 min at 37 &#176;C or 5 min at RT. 
		&#8203;NOTE: EDTA buffer is the mixture of 1x DPBS, 5 mM EDTA, and 0.9 mg/mL of NaCl.</li>
	</ol>
	</li>
	<li>Retinal cell differentiation. 
	NOTE: Prepare Medium I before the differentiation. To prepare Medium I, mix 24.5 mL of Dulbecco&#39;s Modified Eagle Medium (DMEM)/Nutrient Mixture F-12(F12)-Glutamine (1x), 24.5 mL of Neuronal basal medium, 250 &#181;L of 100x supplement A, 500 &#181;L of 50x supplement B, 0.1 mM &#223;-mercaptoethanol, and 250 &#181;L of 100x L-glutamine. Prewarm all the mixtures to RT before use.
	<ol>
		<li>Grow the RB1-KO hESC to 80% confluence in one well of a 6-well plate.</li>
		<li>Remove the medium and rinse the cells with 1 mL of 1x DPBS.</li>
		<li>Elevate the cell colonies using 1 mL of dispase buffer (see Table of Materials) for 5 min at 37 &#176;C. 
		NOTE: Check the cell colonies under a microscope. Usually, it takes 5 min for the edge of the colonies to roll out.</li>
		<li>Aspirate the dispase buffer and gently rinse the cells once with 1 mL of 1x DPBS.</li>
		<li>Add 1 mL of Medium I into the well.</li>
		<li>Cut the colonies into pieces (6-9 pieces per colony) with a 10 &#181;L white/normal pipette tip in the medium. 
		NOTE: Generally, around 60%-70% of cells detach from the well. Use a cell scraper to scrape the remaining cells in the medium.</li>
		<li>Harvest all the cells by centrifuging in a 15 mL tube at 200 x g for 5 min.</li>
		<li>Leave around 50 &#181;L of the supernatant to disperse the cells in the medium, and then mix the cells with 250 &#181;L of Growth factor reduced basement membrane matrix by gentle agitation. 
		NOTE: Keep the Growth factor reduced basement membrane matrix either at 4 &#176;C or on the ice before use. If it is aliquoted and stored at -20 &#176;C, place it at 4 &#176;C overnight or at least 1 h before use.</li>
		<li>Keep the 15 mL tube with the suspended cells into a 37 &#176;C incubator for 20 min. 
		NOTE: Ensure that the cells and Growth factor reduced basement membrane matrix form a solidified gel.</li>
		<li>Add 1 mL of Medium I into the 15 mL tube, and then lightly pipet the solidified gel two to three times to disperse the clump with a 1 mL pipette.</li>
		<li>Add 9 mL of Medium I and transfer the cell suspension into a 10 cm cell culture dish.</li>
		<li>Move the dish to a 37 &#176;C incubator with 5% CO2 and set the day as day 0.</li>
		<li>Examine the cells using a microscope on day 1. 
		NOTE: Thousands of hollow cysts could be observed in the dish. On average, 3 to 4 cysts are observed in one piece of gel.</li>
		<li>Change the medium on day 5. Collect the supernatant into a 15 mL tube, wait for the cysts to settle to the bottom, and then remove the medium and replace it with fresh Medium I. 
		NOTE: If the medium becomes yellow on day 4, change the medium on day 4, otherwise on day 5. Add 10 mL of fresh Medium I into the original dish. Hundreds of cysts have already attached to the culture surface; keep them there.</li>
		<li>Disperse the cysts in the tube into two 10 cm dishes. 
		NOTE: Make sure at least 300 cysts are in a dish. If the cysts are not confluent, do not separate the cysts into other dishes; return them to the original 10 cm dish.</li>
		<li>On day 7, most cysts (above 95%) attach to the dish, spread out, and form adherent colonies. 
		NOTE: As early as day 3, the adherent colonies can be observed.</li>
		<li>On day 10, change the medium with fresh Medium I. Ensure that all the cysts are attached to the dish.</li>
		<li>Prepare Medium II before the next step by mixing the following: 36 mL of DMEM, 12 mL of F12, 2% of supplement B (v/v), 0.1 mM MEM Non-Essential Amino Acids Solution (NEAA).</li>
		<li>Ensure that the cells are spread out by day 13-17. Perform the next step on day 15 when the cells are spread out but not interacting with the neighboring colonies.</li>
		<li>Rinse the cells once with 1 mL of DPBS and add 1 mL of dispase solution for 5 min at 37 &#176;C. 
		NOTE: Within 5 min, the edge of the cells elevate.</li>
		<li>Remove the dispase buffer and gently rinse the cultures with 1 mL of 1x DPBS.</li>
		<li>Add 10 mL of Medium II to each 10 cm dish and culture in a 37 &#176;C, 5% CO2 incubator.</li>
		<li>The adherent cultures spontaneously detach after 24 h and assemble into retinal organoids. 
		NOTE: Numerous cells that do not form the organoids would die in the following 2 days.</li>
		<li>Three days after detachment, collect the cells from the cell culture dish and allow the organoids to settle in a 15 mL tube.</li>
		<li>Remove the supernatant from the tube and transfer the organoids to a new non-adherent dish (Petri dish) with 10 mL of Medium II for the following four days.</li>
		<li>Prepare Medium III by mixing DMEM: F12 at 3:1 ratio (v/v), 2% supplement B (v/v), 0.1 mM MEM Non-Essential Amino Acids Solution (NEAA), 8% Fetal Bovine Serum (FBS) (v/v), 100 &#181;M of Taurine, and 2 mM Glutamine.</li>
		<li>A week after the detachment, change the medium to Medium III.</li>
		<li>From this day onward, culture the organoids in Medium III and refresh the medium twice a week.</li>
	</ol>
	</li>
	<li>Establishment of RB cell line. 
	NOTE: All the reagents are prewarmed at RT.
	<ol>
		<li>On day 90, the RBs (80%-90%) encompass the retinal organoids. Therefore, choose the 90-day RB organoids for the generation of the RB cell line.</li>
		<li>Prepare the 1640 medium by mixing the Roswell Park Memorial Institute (RPMI)-1640 medium with 10% FBS.</li>
		<li>Cut the RB into pieces (20-25 pieces per RB) with a microsurgical knife under a microscope in RPMI-1640 medium.</li>
		<li>Remove the RPMI-1640 medium and treat the pieces with 0.25% Trypsin/EDTA for 10 min at 37 &#176;C.</li>
		<li>Add the RPMI-1640 medium to end the reaction and centrifuge at 200 x g for 5 min.</li>
		<li>Remove the supernatant and resuspend the cells in 1640 medium in a non-adherent dish.</li>
		<li>The RB cell line is a floating culture. Change the medium twice a week and passage the RB cells within 2 weeks. 
		NOTE: The proliferation rate of primary RB cells is quite slow.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Liu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+organoid+retinoblastoma+reveals+a+cancerous+origin.">Human embryonic stem cell-derived organoid retinoblastoma reveals a cancerous origin.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (52), 33628-33638 (2020).</li><li>Singh, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+stage-specific+proliferation+and+retinoblastoma+genesis+in+RB-deficient+human+but+not+mouse+cone+precursors.">Developmental stage-specific proliferation and retinoblastoma genesis in RB-deficient human but not mouse cone precursors.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (40), 9391-9400 (2018).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rb+suppresses+human+cone-precursor-derived+retinoblastoma+tumours.">Rb suppresses human cone-precursor-derived retinoblastoma tumours.</a> Nature. 514 (7522), 385-388 (2014).</li><li>Mendoza, P. R., Grossniklaus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+retinoblastoma.">The biology of retinoblastoma.</a> Progress in Molecular Biology and Translational Science. 134, 503-516 (2015).</li><li>Benavente, C. A., Dyer, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+of+human+retinoblastoma.">Genetics and epigenetics of human retinoblastoma.</a> Annual Review of Pathology. 10, 547-562 (2015).</li><li>Wu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+MYCN-driven+retinoblastoma+reveals+MYCN-independent+tumor+reemergence.">A mouse model of MYCN-driven retinoblastoma reveals MYCN-independent tumor reemergence.</a> The Journal of Clinical Investigation. 127 (3), 888-898 (2017).</li><li>Boucherie, C., Sowden, J. C., Ali, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+technology+for+generating+photoreceptors.">Induced pluripotent stem cell technology for generating photoreceptors.</a> Regenerative Medicine. 6 (4), 469-479 (2011).</li><li>Nakano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-formation+of+optic+cups+and+storable+stratified+neural+retina+from+human+ESCs.">Self-formation of optic cups and storable stratified neural retina from human ESCs.</a> Cell Stem Cell. 10 (6), 771-785 (2012).</li><li>Lowe, A., Harris, R., Bhansali, P., Cvekl, A., Liu, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+adhesion-dependent+cell+survival+and+rock-regulated+actomyosin-driven+forces+mediate+self-formation+of+a+retinal+organoid.">Intercellular adhesion-dependent cell survival and rock-regulated actomyosin-driven forces mediate self-formation of a retinal organoid.</a> Stem Cell Reports. 6 (5), 743-756 (2016).</li><li>Zheng, C., Schneider, J. W., Hsieh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+RB1+in+human+embryonic+stem+cell-derived+retinal+organoids.">Role of RB1 in human embryonic stem cell-derived retinal organoids.</a> Developmental Biology. 462 (2), 197-207 (2020).</li><li>Dimaras, H., Corson, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma,+the+visible+CNS+tumor:+A+review.">Retinoblastoma, the visible CNS tumor: A review.</a> Journal of Neuroscience Research. 97 (1), 29-44 (2019).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+has+properties+of+a+cone+precursor+tumor+and+depends+upon+cone-specific+MDM2+signaling.">Retinoblastoma has properties of a cone precursor tumor and depends upon cone-specific MDM2 signaling.</a> Cell. 137 (6), 1018-1031 (2009).</li><li>Qi, D. L., Cobrinik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MDM2+but+not+MDM4+promotes+retinoblastoma+cell+proliferation+through+p53-independent+regulation+of+MYCN+translation.">MDM2 but not MDM4 promotes retinoblastoma cell proliferation through p53-independent regulation of MYCN translation.</a> Oncogene. 36 (13), 1760-1769 (2017).</li></ol>

The authors are not aware of any affiliations, memberships, funding, or financial holdings that might affect the objectivity of this study.

Human retinoblastoma (RB) is caused by the inactivation of RB1 and the dysfunction of Rb protein. In this protocol, the RB1-KO hESC is the pivotal step for the generation of RB in a dish. While even with RB1-/- hESC, it is possible that there is no RB formation due to the methods of retinal organoid differentiation10. In this protocol, the transfer from adherent culture to floating culture is essential in the process of differentiation. The density of the cysts, types of pluripotent stem cells, and the proliferation rate are all the variables that would affect the timing for detachment. It is desirable to detach the cells when they are expanded but not interacted by neighboring colonies9. If the colonies are adjoining, it would lead to the contiguous retinal organoids and then reduce the differentiation efficiency.
By following the steps critically, it would be untroubled to harvest the RB. However, this method could only model RB with the biallelic inactivation of RB1. For the inherited RB patients, who harbored heterozygous RB1 mutation, it is unable to mimic the process of tumorigenesis with the heterozygous RB1 mutation11. Nevertheless, it is still an optimal RB model because it is currently closest to the actual RB tumorigenesis in patients1. It shares the same origin with primary RB3,12 and overcomes the species difference of mice models or simplified two-dimensional environment of immortalized cancer cell lines3,12,13.
The human RB is established in a dish derived from human ESC using the described method, and it exhibits great similarity to human primary RB. Therefore, it would provide an ideal platform for elucidating the molecular pathology of human RB and screening of pharmacological agents.

Human retinoblastoma (RB) is a rare, fatal tumor derived from the retinal cone-precursors1,2,3, is the most common type of intraocular malignancy in childhood4. Homozygous inactivation of RB1 gene is the initiating genetic lesion in RB5. However, mice with RB1 mutations fail to form the retinal tumor2. Although the mouse tumors could be generated with the combination of Rb1 mutations and other genetic modifications, they still lack the features of human RB6. Thanks to the development of retinal organoid differentiation, the hESC-derived RB could be obtained, displaying the characters of human RB1.
Numerous protocols for retinal organoid differentiation have been established in the past decade, including 2D7, 3D8, and a combination of 2D and 3D9. The method used here to generate the human RB is the consolidation of adherent culture and floating culture9. By differentiating the RB1 mutated hESC into retinal organoids, the formation of RB is detected at around day 45, and then it proliferates rapidly at around day 60. On day 90, isolation of RBs, and generation of the RB cell line is possible; furthermore, RB surrounds almost all retinal organoids at day 120.
hESC-derived RB is an innovative model for exploring the origin, tumorigenesis, and treatments for RB. In this protocol, the generation of gene-editing hESC, the differentiation of RB, and characterization for RB are described in detail.

<table><tbody><tr><td>2-mercaptoethanol</td><td>Life Technologies</td><td>21985-023</td><td></td></tr><tr><td>Anti-ARR3</td><td>Sigma</td><td>HPA063129</td><td>Antibody</td></tr><tr><td>Anti-CRX (M02)</td><td>Abnove</td><td>ABN-H00001406-M02</td><td>Antibody</td></tr><tr><td>Anti-Ki67</td><td>Abcam</td><td>&amp;nbsp;ab15580</td><td>Antibody</td></tr><tr><td>Anti-Syk (D3Z1E)</td><td>Cell Signaling Technology</td><td>13198</td><td>Antibody</td></tr><tr><td>BbsI</td><td>NEB</td><td>R3539S</td><td>Restriction enzymes</td></tr><tr><td>Dispase (1U/mL)</td><td>Stemcell Technologies</td><td>7923</td><td></td></tr><tr><td>DMEM basic</td><td>Gibco</td><td>10566-016</td><td></td></tr><tr><td>DMEM/F-12-GlutaMAX</td><td>Gibco</td><td>10565-042</td><td></td></tr><tr><td>DMSO</td><td>Sigma</td><td>D2650</td><td></td></tr><tr><td>DPBS</td><td>Gibco</td><td>C141905005BT</td><td></td></tr><tr><td>EDTA</td><td>Thermo</td><td>15575020</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS), Qualified for Human Embryonic Stem Cells</td><td>Biological Industry</td><td>04-002-1A</td><td></td></tr><tr><td>Glutamine</td><td>Gibco</td><td>35050-061</td><td></td></tr><tr><td>Ham&#039;s F-12 Nutrient Mix (Hams F12)</td><td>Gibco</td><td>11765-054</td><td></td></tr><tr><td>MEM Non-essential Amino Acid Solution (100X)</td><td>Sigma</td><td>M7145</td><td></td></tr><tr><td>Neurobasal Medium</td><td>Gibco</td><td>21103-049</td><td></td></tr><tr><td>P3 Primary Cell 4D-Nucleofector X Kit S</td><td>Lonza</td><td>V4XP-3032</td><td>Nucleofection kit</td></tr><tr><td>Pen Strep</td><td>Gibco</td><td>15140-122</td><td></td></tr><tr><td>Puromycin</td><td>Gene Operation</td><td>ISY1130- 0025MG</td><td></td></tr><tr><td>QIAquick PCR Purification Kit</td><td>QIAGEN</td><td>28104</td><td></td></tr><tr><td>ncEpic-hiPSC/hESC culture medium</td><td>Nuwacell</td><td>RP01001</td><td>ncEpic-hiPSC/hESC culture medium in 1.2.1</td></tr><tr><td>Growth factor reduced basement membrane matrix</td><td>BD</td><td>356231</td><td>Matrigel in 1.2.1</td></tr><tr><td>Cell dissociation enzyme</td><td>Gibco</td><td>12563-011</td><td>TrypLE Express in 1.2.8</td></tr><tr><td>RNeasy Midi Kit</td><td>QIAGEN</td><td>75144</td><td></td></tr><tr><td>RNeasy Mini Kit</td><td>QIAGEN</td><td>74104</td><td></td></tr><tr><td>Supplement A</td><td>Life Technologies</td><td>17502-048</td><td>N-2 Supplement (100X), liquid, supplemet in medum I</td></tr><tr><td>Supplement B</td><td>Life Technologies</td><td>17105-041</td><td>B-27 Supplement (50X),liquid, supplemet in medum I,II,III</td></tr><tr><td>T4 Polynucleotide Kinase</td><td>Life Technologies</td><td>EK0032</td><td></td></tr><tr><td>Taurine</td><td>Sigma</td><td>T-8691-25G</td><td></td></tr><tr><td>Y-27632 2HCl</td><td>Selleck</td><td>S1049</td><td></td></tr><tr><td>pX330-U6- Chimeric BB-CBh-hSpCas9-2A-Puro</td><td>Addgene</td><td>42230</td><td></td></tr><tr><td>Nucleofector 4D</td><td>Lonza</td><td></td><td></td></tr><tr><td>RPMI</td><td>Sigma</td><td>R0883-500ML</td><td></td></tr></tbody></table>

reconstruct human retinoblastoma in vitro

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent models, meanwhile regarding the interspecies differences between humans and rodents, a disease model derived from humans is more beneficial for uncovering the mechanisms of human RB and seeking the targets of therapy. Herein, the protocol describes the generation of two gene-edited hESC lines with a biallelic RB1 point mutation (RB1Mut/Mut) and an RB1 knockout mutation (RB1-/-), respectively. During the process of retinal development, the formation of RB is observed. The RB cell lines are also established by segregating from the RB organoids. Altogether, by differentiating the gene-edited hESC lines into the retinal organoids using a 2D and 3D combined differentiation protocol, we have successfully reconstructed the human RB in a dish and identified its cone-precursor origin. It would provide a helpful disease model for observing the retinoblastoma genesis, proliferation, and growth as well as further developing novel therapeutic agents.

The procedure of RB generation is elucidated in the Figure 1, which combines the adherent and floating culture. It was possible to harvest the human RB from RB1-KO hESC, and obtain the RB cell line by isolating the RB organoids.
Here, the protocol provides the details of the differentiation in different stages (Figure 2). Hollow spheres are formed in the first 3 days which attach to the culture surface and then expand (Figure 2A-E). From day 15 onward, cells are elevated and culture in suspension (Figure 2F). The day after the detachment, retinal organoids are formed, and the bright rims are visible (Figure 2G, black arrows). Moreover, those cells outside the organoids are likely to die in the following week (Figure 2G, orange arrows). On day 27, the optic vesicle architecture is evident and around 90% of organoids display this structure (Figure 2H); the organoids without this structure could be discarded. The first detection of the RB occurs on day 45, and then it becomes palpable on day 50 (Figure 2I). When it grows to day 90, the optic vesicle structures are principally enfolded by the RB (Figure 2J). Meanwhile, the RB could be isolated as an RB cell line for further culture (Figure 2K). Above 80% retinal organoids would be fully enveloped by the RB on day 105 (Figure 2L). They highly show expression of Ki67 (proliferation marker) and SYK (oncogene marker) comparing with the H9-derived retinal organoids, which indicates the tumorigenesis in the RB organoids (Figure 2M,N). Additionally, the high expression of ARR3 (cone precursor maker) and CRX (photoreceptor precursor marker) in the RB organoids demonstrates that they originate from cone precursor cells (Figure 2O,P).
The procedure of RB generation mainly undergoes three stages with morphology changes before the RB formation; here, the study provides the inferior and superior results at those stages (Figure 3). Differentiated and undifferentiated hESC (Figure 3A,B) is easy to distinguish from the morphology, and the undifferentiated hESC is chosen for RB formation. On day 5, a hollow sphere should generate (Figure 3D) rather than the solid one (Figure 3C). The RB is derived from the retinal organoids, which display optic vesicle architecture (Figure 3F). There is no RB that would generate in the inferior organoids (Figure 3E).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62629/62629fig01.jpg" /> 
Figure 1: Schematic view of the RB organoids differentiation. Day 0-day 15, the cells are 2D culture in medium I, and after day 15, the cells are suspension culture. RB is formed at around day 45. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62629/62629fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62629/62629fig02.jpg" /> 
Figure 2: RB generation and characterization. (A-C) The procedure of the early stage, hESC is elevated to form the cysts. The black arrows in (B) show the rolled edges of hESC after dispase treatment. (D,E) The cysts attach to the plates (D) and then expand (E). (F) Adherent cells are elevated to form the retinal organoids. Black arrows indicate the rolled edges after dispase treatment. (G,H) Early days retinal organoids without RB. (I, J) The retinal organoids with RB on day 50 (I) and day 90 (J), the green circles evidence the RB parts. (K) The isolated RB cell line from 90-day retinal organoids. (L) The RB organoids on day 105. (M-P) The immunofluorescence images for the oncogene markers (M,N) and photoreceptor markers (O,P). In A-L, scale bars = 200 &#181;m; in M-P, scale bars = 50 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62629/62629fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62629/62629fig03.jpg" /> 
Figure 3: Comparation of the negative and positive results. The inferior and superior images for differentiation on day 0 (A,B), day 5 (C,D), and day 30 (E,F). Scale bars = 200 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62629/62629fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

Reconstruct Human Retinoblastoma In Vitro

We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent ...

reconstruct-human-retinoblastoma-in-vitro

Nanyang Technological University

Research

JoVE Journal

Cancer Research

1.3K Views.  Capital Medical University, Beijing Ophthalmology & Visual Science Key Laboratory. We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Video: Reconstruct Human Retinoblastoma In Vitro

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Medicine

Whole Retinal Explants from Chicken Embryos for Electroporation and Chemical Reagent Treatments

The retina is a good model for the developing central nervous system. The large size of the eye and most importantly the accessibility for experimental manipulations in ovo/in vivo makes the chicken embryonic retina a versatile and very efficient experimental model. Although the chicken retina is easy to target in ovo by intraocular injections or electroporation, the effective and exact concentration of the reagents within the retina may be difficult to fully control. This may be due to variations of the exact injection site, leakage from the eye or uneven diffusion of the substances. Furthermore, the frequency of malformations and mortality after invasive manipulations such as electroporation is rather high.
This protocol describes an ex ovo technique for culturing whole retinal explants from chicken embryos and provides a method for controlled exposure of the retina to reagents. The protocol describes how to dissect, experimentally manipulate, and culture whole retinal explants from chicken embryos. The explants can be cultured for approximately 24 hr and be subjected to different manipulations such as electroporation. The major advantages are that the experiment is not dependent on the survival of the embryo and that the concentration of the introduced reagent can be varied and controlled in order to determine and optimize the effective concentration. Furthermore, the technique is rapid, cheap and together with its high experimental success rate, it ensures reproducible results. It should be emphasized that it serves as an excellent complement to experiments performed in ovo.

This protocol describes a method to dissect, experimentally manipulate and culture whole retinal explants from chicken embryos. The explant cultures are useful when high success rate, efficacy and reproducibility are needed to test the effects of plasmids for electroporation and/or reagent substances, i.e., enzymatic inhibitors.

The retina is a good model for the developing central nervous system. The large size of the eye and most importantly the accessibility for experimental ...

Developmental Biology

A Simplified Technique for In situ Excision of Cornea and Evisceration of Retinal Tissue from Human Ocular Globe

Enucleation is the process of retrieving the ocular globe from a cadaveric donor leaving the rest of the globe undisturbed. Excision refers to the retrieval of ocular tissues, especially cornea, by cutting it separate from the ocular globe. Evisceration is the process of removing the internal organs referred here as retina. The ocular globe consists of the cornea, the sclera, the vitreous body, the lens, the iris, the retina, the choroid, muscles etc (Suppl. Figure 1). When a patient is suffering from corneal damage, the cornea needs to be removed and a healthy one must be transplanted by keratoplastic surgeries. Genetic disorders or defects in retinal function can compromise vision. Human ocular globes can be used for various surgical procedures such as eye banking, transplantation of human cornea or sclera and research on ocular tissues. However, there is little information available on human corneal and retinal excision, probably due to the limited accessibility to human tissues. Most of the studies describing similar procedures are performed on animal models. Research scientists rely on the availability of properly dissected and well-conserved ocular tissues in order to extend the knowledge on human eye development, homeostasis and function. As we receive high amount of ocular globes out of which approximately 40% (Table 1) of them are used for research purposes, we are able to perform huge amount of experiments on these tissues, defining techniques to excise and preserve them regularly.
The cornea is an avascular tissue which enables the transmission of light onto the retina and for this purpose should always maintain a good degree of transparency. Within the cornea, the limbus region, which is a reservoir of the stem cells, helps the reconstruction of epithelial cells and restricts the overgrowth of the conjunctiva maintaining corneal transparency and clarity. The size and thickness of the cornea are critical for clear vision, as changes in either of them could lead to distracted, unclear vision. The cornea comprises of 5 layers; a) epithelium, b) Bowman's layer, c) stroma, d) Descemet's membrane and e) endothelium. All layers should function properly to ensure clear vision4,5,6. The choroid is the intermediate tunic between the sclera and retina, bounded on the interior by the Bruch's membrane and is responsible for blood flow in the eye. The choroid also helps to regulate the temperature and supplies nourishment to the outer layers of the retina5,6. The retina is a layer of nervous tissue that covers the back of the ocular globe (Suppl. Figure 1) and consists of two parts: a photoreceptive part and a non-receptive part. The retina helps to receive the light from the cornea and lens and converts it into the chemical energy eventually transmitted to the brain with help of the optic nerve5,6.
The aim of this paper is to provide a protocol for the dissection of corneal and retinal tissues from human ocular globes. Avoiding cross-contamination with adjacent tissues and preserving RNA integrity is of fundamental importance as such tissues are indispensable for research purposes aimed at (i) characterizing the transcriptome of the ocular tissues, (ii) isolating stem cells for regenerative medicine projects, and (iii) evaluating histological differences between tissues from normal/affected subjects. In this paper we describe the technique we currently use to remove the cornea, the choroid and retinal tissues from an ocular globe. Here we provide a detailed protocol for the dissection of the human ocular globe and the excision of corneal and retinal tissues. The accompanying video will help researchers to learn an appropriate technique for the retrieval of precious human tissues which are difficult to find regularly.

A Simplified Technique for In situ Excision of Cornea and Evisceration of Retinal Tissue from Human Ocular Globe

The paper describes a simplified technique to excise corneal and to eviscerate retinal tissues from the ocular globe of human cadaveric donors. The technique described here will help to excise good quality tissues to be used for transplantation, surgical or research purposes without damaging other tissues of the ocular globe.

Enucleation is the process of retrieving the ocular globe from a cadaveric donor leaving the rest of the globe undisturbed. Excision refers to the ...

Aqueous Humor as a Liquid Biopsy for Retinoblastoma: Clear Corneal Paracentesis and Genomic Analysis

There is significant potential clinical utility for the application of a liquid biopsy platform for retinoblastoma, given that direct tumor biopsy is prohibited in these patients. The aqueous humor (AH) forms in a separate compartment from the tumor but is enclosed within the same ocular space. Thus, it is an enriched source of eye-specific tumoral genomic information that can be used as a liquid biopsy or surrogate to tumor biopsy for this disease. This manuscript details a methodology for safely extracting the AH from retinoblastoma eyes via clear corneal paracentesis. Additionally, the steps for genomic analysis, including cell-free DNA isolation and purification, next-generation sequencing, somatic copy number alteration (SCNA) analysis, RB1 single nucleotide variant (SNV) mutation identification, and tumor fraction estimation are presented. The pre-analytical, analytical, and early clinical validity of the AH liquid biopsy platform have been evaluated; however, it is not without limitations. These are largely a consequence of the quantity of cell-free DNA that is required for certain steps of the assay. Compared to other blood-based liquid biopsy platforms currently under investigation for retinoblastoma, an AH-based platform is limited by the volume of biofluid (and thus the quantity of DNA) that can be extracted from the eye; the benefit is that AH is eye-specific. The platform discussed here is unique in that it detects circulating tumor DNA in the AH via two mechanisms (SCNAs and RB1 SNVs), yielding a higher sensitivity for identifying tumoral genomic information. The AH liquid biopsy has the potential for direct clinical application to precision oncology for retinoblastoma patients, with particular importance for patients with bilateral disease as the AH is specific to the tumors in each eye. There is ongoing research with applications of this platform to patients with other ocular tumors as well.

The aqueous humor is a high-yield liquid biopsy for retinoblastoma, intraocular cancer that cannot be biopsied in vivo due to the risk of extraocular spread. Herein, a method for safely extracting aqueous humor via clear corneal paracentesis and steps for genomic analysis to identify prognostic biomarkers are presented.

There is significant potential clinical utility for the application of a liquid biopsy platform for retinoblastoma, given that direct tumor biopsy is ...

Vibratome Sectioning Mouse Retina to Prepare Photoreceptor Cultures

The retina is a part of the central nervous system that has organized architecture, with neurons in layers from the photoreceptors, both rods and cones in contact with the retinal pigmented epithelium in the most distant part on the retina considering the direction of light, and the ganglion cells in the most proximal distance. This architecture allows the isolation of the photoreceptor layer by vibratome sectioning. The dissected neural retina of a mouse aged 8 days is flat-embedded in 4% gelatin on top of a slice of 20% gelatin photoreceptor layer facing down. Using a vibratome and a double edged razor blade, the 100 &#181;m thick inner retina is sectioned. This section contains the ganglion cells and the inner layer with notably the bipolar cells. An intermediary section of 15 &#181;m is discarded before 200 &#181;m of the outer retina containing the photoreceptors is recovered. The gelatin is removed by heating at 37 &#176;C. Pieces of outer layer are incubated in 500 &#181;l of Ringer&#39;s solution with 2 units of activated papain for 20 min at 37 &#176;C. The reaction is stopped by adding 500 &#181;l 10% fetal calf serum (FCS) in Dulbecco&#39;s Modified Eagle Medium (DMEM), then 25 units of DNAse I is added before centrifugation at RT, washed several times to remove serum and the cells are resuspended in 500 &#181;l of DMEM and seeded at 1 x 105 cells/cm2. The cells are grown to 5 days in vitro and their viability scored using live/dead assay. The purity of the culture is first determined by microscopic observation during the experiment. The purity is then validated by seeding and fixing cells on a histological slide and analyzing using a rabbit polyclonal anti-SAG, a photoreceptor marker and mouse monoclonal anti-RHO, a rod photoreceptor specific marker. Alternatively, the photoreceptor layer (97% rods) can be used for gene or protein expression analysis and for transplantation.

Neural retina of a mouse aged 8 days is on top of a 4% gelatin block. After isolation of the photoreceptor layer (200 &#181;m) by vibratome, the photoreceptors are seeded after mechanical and enzymatic dissociation for culture. The photoreceptor layer can be used for molecular, biochemical analyses or transplantation.

The retina is a part of the central nervous system that has organized architecture, with neurons in layers from the photoreceptors, both rods and cones in ...

Neuroscience

Generation of Human Patient iPSC-derived Retinal Organoids to Model Retinitis Pigmentosa

Retinitis pigmentosa (RP) is a rare and inherited retinal degenerative disease with a prevalence of approximately 1/4,000 people worldwide. The majority of RP patients have progressive photoreceptor degeneration leading to peripheral vision loss, night blindness, and finally, total blindness. To date, thousands of mutations in more than 90 genes have been reported to be associated with RP. Currently, there are few animal models available for all the affected genes and different types of mutations, which largely hampers the deciphering of the mechanisms underlying the gene/mutation pathology and limits treatment and drug development. Patient induced pluripotent stem cell (iPSC)-derived 3D retinal organoids (ROs) have provided a better system to model the human early-onset disease than cells and animals. In order to study RP, those patient-derived 3D retinal organoids were utilized to recapitulate the clinical phenotypes of RP. In the RP patient-derived ROs, Rhodopsin mislocalization was clearly displayed. Compared with other animal models, patient iPSC-derived retinal organoid models more closely recapitulated RP features and represent an ideal approach for investigating the disease pathogenesis and for drug development.

In this protocol, retinitis pigmentosa patient induced pluripotent stem cell (iPSC)-derived 3D retinal organoids were generated. Those organoids successfully recapitulated some clinical phenotypes of the retinitis pigmentosa disease.

Retinitis pigmentosa (RP) is a rare and inherited retinal degenerative disease with a prevalence of approximately 1/4,000 people worldwide. The majority ...

Enhanced 3D Neural Retina Differentiation from Human Embryonic Stem Cells

Generating Neural Retina from Human Pluripotent Stem Cells

Retinopathy is one of the main causes of blindness worldwide. Investigating its pathogenesis is essential for the early diagnosis and timely treatment of retinopathy. Unfortunately, ethical barriers hinder the collection of evidence from humans. Recently, numerous studies have shown that human pluripotent stem cells (PSCs) can be differentiated into retinal organoids (ROs) using different induction protocols, which have enormous potential in retinopathy for disease modeling, drug screening, and stem cell-based therapies. This study describes an optimized induction protocol to generate neural retina (NR) that significantly reduces the probability of vesiculation and fusion, increasing the success rate of production until day 60. Based on the ability of PSCs to self-reorganize after dissociation, combined with certain complementary factors, this new method can specifically drive NR differentiation. Furthermore, the approach is uncomplicated, cost-effective, exhibits notable repeatability and efficiency, presents encouraging prospects for personalized models of retinal diseases, and supplies a plentiful cell reservoir for applications such as cell therapy, drug screening, and gene therapy testing.

Author Spotlight: Simple and Efficient Neural Retina Organoid Production for Disease Modeling

The present protocol describes an optimized 3D neural retina induction system that reduces the adhesion and fusion of retinal organoids with high repeatability and efficiency.

Retinopathy is one of the main causes of blindness worldwide. Investigating its pathogenesis is essential for the early diagnosis and timely treatment of ...

Characterization of a Novel Human Organotypic Retinal Culture Technique

Previous human organotypic retinal culture (HORC) models have utilized detached retinas; however, without the structural support conferred by retinal pigment epithelium-choroid (RPE-choroid) and sclera, the integrity of the fragile retina can easily be compromised. The aim of this study was to develop a novel HORC model that contains the retina, RPE-choroid and sclera to maintain retinal integrity when culturing retinal explants.
After cutting circumferentially along the limbus to remove iris and lens, four deep incisions were made to flatten the eyecup. In contrast to previous HORC protocols, a trephine was used to cut through not only the retina but also the RPE-choroid and sclera. The resultant triple-layered explants were cultured for 72 h. Hematoxylin and Eosin staining (H&#38;E) was used to assess anatomical structures and retinal explants were further characterized by immunohistochemistry (IHC) for apoptosis, M&#252;ller cell integrity and retinal inflammation. To confirm the possibility of disease induction, explants were exposed to high glucose (HG) and pro-inflammatory cytokines (Cyt), to mimic diabetic retinopathy (DR). The Luminex magnetic bead assay was used to measure DR-related cytokines released into the culture medium.
H&#38;E staining revealed distinct retinal lamellae and compact nuclei in retinal explants with the underlying RPE-choroid and sclera, while retinas without the underlying structures exhibited reduced thickness and severe nuclei loss. IHC results indicated absence of apoptosis and retinal inflammation as well as preserved M&#252;ller cell integrity. The Luminex&#160;assays showed significantly increased secretion of DR-associated pro-inflammatory cytokines in retinal explants exposed to HG + Cyt relative to baseline levels at 24 h.
We successfully developed and characterized a novel HORC protocol in which retinal integrity was preserved without apoptosis or retinal inflammation. Moreover, the induced secretion of DR-associated pro-inflammatory biomarkers when exposing retinal explants to HG + Cyt suggests that this model could be used for clinically translatable retinal disease studies.

This study aims to develop a novel human organotypic retinal culture (HORC) model that prevents compromising retinal integrity during explant handling. This is achieved by culturing the retina with the overlying vitreous and the underlying retinal pigment&#160;epithelium-choroid (RPE-choroid) and sclera.

Previous human organotypic retinal culture (HORC) models have utilized detached retinas; however, without the structural support conferred by retinal ...

Retinal Pigment Epithelium Transplantation in a Non-human Primate Model for Degenerative Retinal Diseases

Retinal pigment epithelial (RPE) transplantation holds great promise for the treatment of inherited and acquired retinal degenerative diseases. These conditions include retinitis pigmentosa (RP) and advanced forms of age-related macular degeneration (AMD), such as geographic atrophy (GA). Together, these disorders represent a significant proportion of currently untreatable blindness globally. These unmet medical needs have generated heightened academic interest in developing methods of RPE replacement. Among the animal models commonly utilized for preclinical testing of therapeutics, the non-human primate (NHP) is the only animal model that has a macula. As it shares this anatomical similarity with the human eye, the NHP eye is an important and appropriate preclinical animal model for the development of advanced therapy medicinal products (ATMPs) such as RPE cell therapy.
This manuscript describes a method for the submacular transplantation of an RPE monolayer, cultured on a polyethylene terephthalate (PET) cell carrier, underneath the macula onto a surgically created RPE wound in immunosuppressed NHPs. The fovea-the central avascular portion of the macula-is the site of the greatest mechanical weakness during the transplantation. Foveal trauma will occur if the initial subretinal fluid injection generates an excessive force on the retina. Hence, slow injection under perfluorocarbon liquid (PFCL) vitreous tamponade is recommended with a dual-bore subretinal injection cannula at low intraocular pressure (IOP) settings to create a retinal bleb. 
Pretreatment with an intravitreal plasminogen injection to release parafoveal RPE-photoreceptor adhesions is also advised. These combined strategies can reduce the likelihood of foveal tears when compared to conventional techniques. The NHP is a key animal model in the preclinical phase of RPE cell therapy development. This protocol addresses the technical challenges associated with the delivery of RPE cellular therapy in the NHP eye.

The non-human primate (NHP) is an ideal model for studying human retinal cellular therapeutics due to the anatomical and genetic similarities. This manuscript describes a method for submacular transplantation of retinal pigment epithelial cells in the NHP eye and strategies to prevent intraoperative complications associated with macular manipulation.

Retinal pigment epithelial (RPE) transplantation holds great promise for the treatment of inherited and acquired retinal degenerative diseases. These ...

Retinal Explant of the Adult Mouse Retina as an Ex Vivo Model for Studying Retinal Neurovascular Diseases

One of the challenges in retina research is studying the cross-talk between different retinal cells such as retinal neurons, glial cells, and vascular cells. Isolating, culturing, and sustaining retinal neurons in vitro have technical and biological limitations. Culturing retinal explants may overcome these limitations and offer a unique ex vivo model to study the cross-talk between various retinal cells with well-controlled biochemical parameters and independent of the vascular system. Moreover, retinal explants are an effective screening tool for studying novel pharmacological interventions in various retinal vascular and neurodegenerative diseases such as diabetic retinopathy. Here, we describe a detailed protocol for retinal explants' isolation and culture for an extended period. The manuscript also presents some of the technical problems during this procedure that may affect the desired outcomes and reproducibility of the retinal explant culture. The immunostaining of the retinal vessels, glial cells, and neurons demonstrated intact retinal capillaries and neuroglial cells after 2 weeks from the beginning of the retinal explant culture. This establishes retinal explants as a reliable tool for studying changes in the retinal vasculature and neuroglial cells under conditions that mimic retinal diseases such as diabetic retinopathy.

Retinal Explant of the Adult Mouse Retina as an Ex Vivo Model for Studying Retinal Neurovascular Diseases

This protocol presents and describes steps for the isolation, dissection, culturing, and staining of retinal explants obtained from an adult mouse. This method is beneficial as an ex vivo model for studying different retinal neurovascular diseases such as diabetic retinopathy.

One of the challenges in retina research is studying the cross-talk between different retinal cells such as retinal neurons, glial cells, and vascular ...

Reconstruct Human Retinoblastoma In Vitro

Podsumowanie

Przeglądaj więcej filmów

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Whole Retinal Explants from Chicken Embryos for Electroporation and Chemical Reagent Treatments

A Simplified Technique for In situ Excision of Cornea and Evisceration of Retinal Tissue from Human Ocular Globe

Aqueous Humor as a Liquid Biopsy for Retinoblastoma: Clear Corneal Paracentesis and Genomic Analysis

Vibratome Sectioning Mouse Retina to Prepare Photoreceptor Cultures

Generation of Human Patient iPSC-derived Retinal Organoids to Model Retinitis Pigmentosa

Generating Neural Retina from Human Pluripotent Stem Cells

Characterization of a Novel Human Organotypic Retinal Culture Technique

Retinal Pigment Epithelium Transplantation in a Non-human Primate Model for Degenerative Retinal Diseases

Retinal Explant of the Adult Mouse Retina as an Ex Vivo Model for Studying Retinal Neurovascular Diseases