This work was supported by National Natural Science Foundation of China (81402535 and 81672969) and National Key Research and Development Project (2016YFC0904703).

NOTE: Steps are performed under the indicated temperature. For steps in which the temperature is not mentioned, perform under room temperature (18&#8211;25 &#176;C). Cell culture medium should be stored at 4 &#176;C, and other reagents should be stored according to the manufacturer&#8217;s guides. Medium should be pre-warmed to 37 &#176;C before being added to cells.
1. Cell sorting
<ol>
	<li>Antibody conjugation 
	NOTE: Considering the shorter incubation time, direct-labeled antibody is preferred for cell sorting. If no commercial direct-labeled antibody is available, use fluorescein-conjugating reagents to conjugate the antibody to a fluorescent dye according to the manufacturer&#8217;s guide (see Table of Materials). As cells will be cultured after sorting, all steps should be performed in a biological safety cabinet or laminar clean bench. To avoid contamination, antibiotics (penicillin and streptomycin) are recommended to be added to the culture medium after sorting.
	<ol>
		<li>Add 1 &#181;L of modifier reagent for each 10 &#181;L of antibody to be labeled. Mix gently.</li>
		<li>Add the mixture of antibody and modifier directly onto the lyophilized fluorescein. Pipet gently. Leave the vial standing for 3 h or overnight at room temperature (RT) in the dark.</li>
		<li>Add 1 &#181;L of quencher reagent for every 10 &#181;L of antibody. The conjugate can be used after 30 min. The fluorescein conjugate can be stored at 4 &#176;C for up to 18 months.</li>
		<li>Before sorting, titration of conjugated antibody is recommended. Prepare cells that express (e.g., H1299 or A549 for &#945;2&#948;1) and do not express (e.g., H1975) the marker. Aliquot the cells and incubate them with antibody at different concentrations (e.g., 15 &#956;g/mL, 7.5 &#956;g/mL, 1.5 &#956;g/mL, and 0.75 &#956;g/mL, respectively).</li>
		<li>Perform flow cytometric analysis (with histogram or dot plot) and choose the concentration in which positive cells of H1299 or A549 can be separated from the isotype control and H1975 cells&#160;have little unspecific signals.</li>
	</ol>
	</li>
	<li>Cell labeling
	<ol>
		<li>Culture A549 cells in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) in 10 cm dishes at 37 &#176;C and 5% CO2 in a cell culture incubator. Digest cells as follows for sorting when they reach 80%&#8211;90% confluence (about 5&#8211;10 x 106 cells per dish).</li>
		<li>Remove the culture medium. Wash cells with 3 mL of phosphate buffered saline (PBS) briefly. Add 3 mL of 0.05% trypsin to each dish. Remove the trypsin and leave the residuary trypsin to digest cells at 37 &#176;C for 1&#8211;3 min. Check the detachment of the cells frequently to avoid overdigestion. 
		NOTE: Some cell lines may be relatively difficult to digest, such as NSCLC cell lines H520 and PC9. In such situation, 3 mL of trypsin can be left in the dish, rather than digestion with residuary trypsin. Moreover, the digestion time can be extended.</li>
		<li>When cells become loose and begin to detach from the dishes, add 3 mL of RPMI 1640 medium supplemented with 10% FBS and pipette the cell suspension into a 50 mL tube.</li>
		<li>Centrifuge at 300 x g at 4 &#176;C for 5 min. Discard the supernatant. Add 10 mL of PBS to resuspend the cells. Transfer 0.5 mL (or at least 5 x 105 cells) of cell suspension into a new tube as an isotype control.&#160;The remaining cells are for sorting.</li>
		<li>Centrifuge both the control and experimental tubes at 300 x g at 4 &#176;C for 5 min. Discard the supernatant.</li>
		<li>Prepare the working solution for staining by diluting the fluorescent dye-conjugated isotype control or antibody in PBS to the optimal concentration titrated as mentioned above. 
		NOTE: In this experiment, FITC-conjugated 1B50-1 (the antibody of &#945;2&#948;1) was diluted into 7.5 &#956;g/mL. The volume of working solution is dependent on the cell amount.</li>
		<li>Resuspend the control and experimental cells with each working solution at about 2&#8211;5 x 107 cells/mL and mix gently. Incubate the samples at RT for 30&#8211;40 min in the dark.</li>
		<li>Wash the cells by adding 10 mL of PBS to samples, mix gently and centrifuge at 300 x g at 4 &#176;C for 5 min. Discard the supernatant. Resuspend cells with 10 mL of PBS.</li>
		<li>Put 40 &#956;m cell strainers on new 50 mL tubes for control and experimental cells respectively. Apply cell suspension onto the strainer and collect the flow-through. 
		NOTE: This step removes the cell clumps that may block the capillary of the cell sorter.</li>
		<li>Centrifuge the flow-through at 300 x g at 4 &#176;C for 5 min. Discard the supernatant. Resuspend the cells with 0.2&#8211;1.0 mL PBS then transfer into a 5 mL tube for flow cytometry.</li>
	</ol>
	</li>
	<li>Cell sorting by flow cytometry
	<ol>
		<li>Prepare two 5 mL tubes to collect the positive and negative cell populations. Add 1 mL of RPMI 1640 medium in each tube. Place the tubes at the collection platform of the cell sorter.</li>
		<li>Analyze the control cells and experimental cells respectively with the dot plot. Gate the live cells with the parameters forward scatter (FSC) and side scatter (SSC). Gate the positive and negative population of live cells according to the FL-1 intensity.</li>
		<li>Collect the &#945;2&#948;1-positive cells and &#945;2&#948;1-negative cells. Record the number of cells obtained.</li>
		<li>To confirm that the harvested cell populations have different level of &#945;2&#948;1 expression, a quantitative polymerase chain reaction (QPCR) can be performed.
		<ol>
			<li>Extract RNA of positive and negative cells with guanidinium thiocyanate reagent and reverse transcript the RNA into cDNA according to the manufacturer&#8217;s guide. Perform QPCR with SYBR green reagent. The sequences of primers are as follows: &#945;2&#948;1-F, CAGTTGAGATGGAGGATGATG; &#945;2&#948;1-R, TTGTATGAGCAGTCGTGTGTC; GAPDH-F, GTCGGAGTCAACGGATTTGG; and GAPDH-R, AAAAGCAGCCCTGGTGACC.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Sphere formation assay
NOTE: Sphere formation assay is applied to determine the self-renewal capacity of cells. Cells with self-renewal capacity could form spheres in this serum-free semisolid medium supplemented with growth factors. All steps should be performed in a biological safety cabinet or laminar clean bench. To avoid contamination, antibiotics (penicillin and streptomycin) are recommended to be added to the culture medium after sorting.
<ol>
	<li>Medium preparation
	<ol>
		<li>Prepare 2x DMEM/F-12 medium by reconstituting a 1 L package of DMEM/F-12 powder into 475 mL of distilled water. Add 2.438 g of NaHCO3. Adjust the pH to 7.0&#8211;7.2 by slowly adding 1 N NaOH or 1 N HCl with stirring. Add distilled water to a final volume of 500 mL. Sterilize the medium by filtering through a 0.2 &#956;m filter.</li>
		<li>Prepare a 2% methylcellulose solution by adding 2 g of methylcellulose into 100 mL of distilled water. Autoclave the solution. The methylcellulose may show a cotton-like state after autoclaving. Mix it by reversing the bottle up and down gently for few times and leave it for natural cooling. It will become a transparent semisolid overnight.</li>
		<li>To obtain 20 mL of self-renewal medium, add 10 mL of 2x DMEM/F-12 medium to a 50 mL tube. Add 400 &#956;L of B27 to the medium. Add recombinant human epidermal growth factor (EGF) to a final concentration of 25 ng/mL. Add recombinant human basic fibroblast growth factor (bFGF) to a final concentration of 25 ng/mL. Add 2% methylcellulose to reach a final volume of 20 mL.</li>
		<li>Mix the medium by vortex so that the self-renewal medium is obtained.</li>
	</ol>
	</li>
	<li>Cell seeding
	<ol>
		<li>Transfer the harvested cells into the self-renewal medium to reach 2000 cells/mL and mix them with a brief vortex. Add 100 &#956;L of cell suspension to each well of an ultra-low attachment 96 well plate. Do not use the wells at the rim of the plate, as the medium is more likely to evaporate in these wells. Add sterilized water to these wells.</li>
		<li>Culture at 37 &#176;C with 5% CO2 in cell culture incubator for 10&#8211;14 days. Add 50 &#956;L of self-renewal medium at day 5&#8211;7.</li>
	</ol>
	</li>
	<li>Sphere counting and calculation
	<ol>
		<li>10&#8211;14 days after seeding, count the number of spheres with more than 50 cells (approximately) or with a diameter more than 100 &#956;m under a microscope (4x objective lens, 10x eyepiece). 
		NOTE: Starting from the upper left of the well, count the spheres while moving the objective table horizontally towards the right with the joystick of the microscope. Then, move the objective table to the middle row of the visual field and count the spheres from right to left. Then, move to the lower row and count from left to right. A well of 96 well plate can be counted within three rows.</li>
		<li>Calculate the sphere formation efficiency as the number of spheres divided by the number of cells seeded. Compare the sphere formation efficiency between the positive and negative cell populations.</li>
	</ol>
	</li>
</ol>
3. Colony formation assay
NOTE: Colony formation assay is applied to determine the radiosensitivity of cells. Radiation can be delivered by a linear accelerator used for radiotherapy. Cell irradiation system for laboratory use can also be used if the equipment is available. Steps 3.1, 3.2.3, and 3.2.6 should be performed in a biological safety cabinet or laminar clean bench. To avoid contamination, antibiotics (penicillin and streptomycin) are recommended to be added to the culture medium after sorting.
<ol>
	<li>Cell seeding
	<ol>
		<li>Prepare one 6 well plate for each radiation dose including the 0 Gy group. Add 1.5 mL of medium to each well of 6 well plate. Culture medium for colony formation assay is the conventional RPMI 1640 medium supplemented with 10% FBS (named as &#8220;completed 1640&#8221;).</li>
		<li>Dilute harvested cells with completed 1640 medium&#160;to 1000 cells/mL.</li>
		<li>Add cell suspension to the wells. Shake the plates horizontally to make cells distribute evenly in the wells. Record the volume added in each dose group. 
		NOTE: Generally, seed 200 cells per well for 0 Gy, 200 cells for 2 Gy, 400 cells for 4 Gy, 800 cells for 6 Gy, and 1600 cells for 8 Gy, respectively. It is better to adjust the cell numbers in unsorted cells in pre-experiments.</li>
		<li>Culture at 37 &#176;C with 5% CO2 in cell culture incubator.</li>
	</ol>
	</li>
	<li>Radiation
	<ol>
		<li>After cells have attached to the bottom of the wells (usually one day after seeding, and longer time is not recommended considering cell proliferation), proceed to perform cell radiation.</li>
		<li>Calculate the number of monitor units (MU) for each dose at a depth of 1 cm in a 20 cm x 20 cm radiation field. 
		NOTE: Number of MU = dose (cGy)/output factor for the radiation field/percentage depth dose (PDD) for the depth. For example, the output factor for a 20 cm x 20 cm field is 1.066, PDD for 1.0 cm is 0.987, and number of MU for 8 Gy (800 cGy) is 760 (800/1.066/0.987 = 760.35). If multiple plates need to be radiated for each dose, a larger field can also be used, and the numbers of MU need to be recalculated according to the size of the field. Output factor and PDD differ in different accelerators. Refer to radiation physicists for these parameters.</li>
		<li>Add completed 1640 to each well to reach 1 cm for the height of the medium. 
		NOTE: Cell growth area of 6 well plate can be found on the manufacturer&#8217;s guide. For example, if the growth area is 9.5 cm2 for each well of 6 well plate, and 1.5 mL of medium and 0.4 mL of cell suspension has been added on the day before, then add 7.6 mL medium to the well. The height is needed for dose build-up. A medium height of less than 0.8 cm is not recommended. 
		NOTE:&#160;Keep the plates covered during radiation. When the plates are transferred between cell culture room and radiation therapy room, wrap the plates with aluminum foil or put them in a clean box to avoid contamination. Hold the plates flat to avoid medium spilling out.</li>
		<li>Set a 20 cm x 20 cm radiation field. Place a tissue-equivalent bolus of 1.0 cm thickness on the treatment couch, and place the 6 well plate on the bolus to keep them in contact. Make sure the whole plate is within the radiation field. Set the source skin distance as 100 cm. Align the medium surface level to the laser level by adjusting the height of the treatment couch. 
		NOTE: Plates with the same radiation dose can be radiated at the same time. For this case, a larger radiation field is needed, and the number of MU should be recalculated according to the corresponding output factor. Make sure all the plates are within the radiation field.</li>
		<li>Deliver the each assigned dose to each plate in sequence. 
		CAUTION: The linear accelerator can only be operated by qualified technicians. Keep away from radiation.</li>
		<li>Take the plates back to the cell culture room. Change the medium with 2 mL of completed medium for each well. Culture at 37 &#176;C with 5% CO2 in cell culture incubator. Change the medium every 3&#8211;5 days.</li>
	</ol>
	</li>
	<li>Staining
	<ol>
		<li>7&#8211;10 days after radiation, when many colonies form and before they grow too large and merge together, then perform staining and counting as follows. Remove the medium and wash briefly with PBS. Add 1 mL of 4% formaldehyde to each well to fix the cells. 
		CAUTION: Formaldehyde is volatile. Use formaldehyde in a fume hood.</li>
		<li>After 10 min of fixation, remove the formaldehyde and wash with 2 mL of distilled water each well twice.</li>
		<li>Add 1 mL of 1% crystal violet stain solution to each well. Stain for 10 min. Remove the crystal violet stain solution, and wash with distilled water 3 times. Remove the water and dry the plates.</li>
	</ol>
	</li>
	<li>Colony counting and calculation
	<ol>
		<li>Count the number of colonies with more than 50 cells. Do not include small colonies with less than 50 cells. Check the colonies under a microscope to get an impression of a colony constituted by 50 cells and mark it on the bottom of the plate with a marker pen. 
		NOTE: Photographing the wells and using the software ImageJ will facilitate the counting process.</li>
		<li>Calculate the colony formation efficiency as the number of colonies divided by the number of cells seeded. Calculate the survival fraction as the colony formation efficiency at a certain irradiation dose divided by the colony formation efficiency at 0 Gy.</li>
		<li>Using the dose as the x-axis and survival fraction as the y-axis, a survival curve can be obtained. Compare the survival curves between the positive and negative cell populations.</li>
	</ol>
	</li>
</ol>

<ol><li>Brunner, T. B., Kunz-Schughart, L. A., Grosse-Gehling, P., Baumann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+stem+cells+as+a+predictive+factor+in+radiotherapy%5BTitle%5D)+AND+%22Seminars+in+Radiation+Oncology%22%5BJournal%5D)">Cancer stem cells as a predictive factor in radiotherapy.</a> Seminars in Radiation Oncology. 22 (2), 151-174 (2012).</li>
<li>Baumann, M., Krause, M., Hill, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exploring+the+role+of+cancer+stem+cells+in+radioresistance%5BTitle%5D)+AND+%22Nature+Reviews+Cancers%22%5BJournal%5D)">Exploring the role of cancer stem cells in radioresistance.</a> Nature Reviews Cancers. 8 (7), 545-554 (2008).</li>
<li>Clarke, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+stem+cells--perspectives+on+current+status+and+future+directions%3A+AACR+Workshop+on+cancer+stem+cells%5BTitle%5D)+AND+%22Cancer+Research%22%5BJournal%5D)">Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells.</a> Cancer Research. 66 (19), 9339-9344 (2006).</li>
<li>Bao, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Glioma+stem+cells+promote+radioresistance+by+preferential+activation+of+the+DNA+damage+response%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Glioma stem cells promote radioresistance by preferential activation of the DNA damage response.</a> Nature. 444 (7120), 756-760 (2006).</li>
<li>Wang, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MYC+regulation+of+CHK1+and+CHK2+promotes+radioresistance+in+a+stem+cell-like+population+of+nasopharyngeal+carcinoma+cells%5BTitle%5D)+AND+%22Cancer+Research%22%5BJournal%5D)">MYC regulation of CHK1 and CHK2 promotes radioresistance in a stem cell-like population of nasopharyngeal carcinoma cells.</a> Cancer Research. 73 (3), 1219-1231 (2012).</li>
<li>Diehn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Association+of+reactive+oxygen+species+levels+and+radioresistance+in+cancer+stem+cells%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Association of reactive oxygen species levels and radioresistance in cancer stem cells.</a> Nature. 458 (7239), 780-783 (2009).</li>
<li>Gomez-Casal, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Non-small+cell+lung+cancer+cells+survived+ionizing+radiation+treatment+display+cancer+stem+cell+and+epithelial-mesenchymal+transition+phenotypes%5BTitle%5D)+AND+%22Molecular+Cancer%22%5BJournal%5D)">Non-small cell lung cancer cells survived ionizing radiation treatment display cancer stem cell and epithelial-mesenchymal transition phenotypes.</a> Molecular Cancer. 12 (1), 94(2013).</li>
<li>Mihatsch, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Selection+of+radioresistant+tumor+cells+and+presence+of+ALDH1+activity+in+vitro%5BTitle%5D)+AND+%22Radiotherapy+and+Oncology%22%5BJournal%5D)">Selection of radioresistant tumor cells and presence of ALDH1 activity in vitro.</a> Radiotherapy and Oncology. 99 (3), 300-306 (2011).</li>
<li>Sui, X., Geng, J. H., Li, Y. H., Zhu, G. Y., Wang, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calcium+channel+%CE%B12%CE%B41+subunit+%28CACNA2D1%29+enhances+radioresistance+in+cancer+stem-like+cells+in+non-small+cell+lung+cancer+cell+lines%5BTitle%5D)+AND+%22Cancer+Management+and+Research%22%5BJournal%5D)">Calcium channel α2δ1 subunit (CACNA2D1) enhances radioresistance in cancer stem-like cells in non-small cell lung cancer cell lines.</a> Cancer Management and Research. 10, 5009-5018 (2018).</li>
<li>Zhao, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((1B50-1%2C+a+mAb+raised+against+recurrent+tumor+cells%2C+targets+liver+tumor-initiating+cells+by+binding+to+the+calcium+channel+%CE%B12%CE%B41+subunit%5BTitle%5D)+AND+%22Cancer+Cell%22%5BJournal%5D)">1B50-1, a mAb raised against recurrent tumor cells, targets liver tumor-initiating cells by binding to the calcium channel α2δ1 subunit.</a> Cancer Cell. 23 (4), 541-556 (2013).</li>
<li>Moncharmont, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeting+a+cornerstone+of+radiation+resistance%3A+Cancer+stem+cell%5BTitle%5D)+AND+%22Cancer+Letters%22%5BJournal%5D)">Targeting a cornerstone of radiation resistance: Cancer stem cell.</a> Cancer Letters. 322 (2), 139-147 (2012).</li>
<li>Zhang, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Glycine+decarboxylase+activity+drives+non-small+cell+lung+cancer+tumor-initiating+cells+and+tumorigenesis%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Glycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesis.</a> Cell. 148 (1-2), 259-272 (2012).</li>
<li>Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clonogenic+assay+of+cells+in+vitro%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Clonogenic assay of cells in vitro.</a> Nature Protocols. 1 (5), 2315-2319 (2006).</li>
<li>O'Brien, C. A., Kreso, A., Jamieson, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+stem+cells+and+self-renewal%5BTitle%5D)+AND+%22Clinical+Cancer+Research%22%5BJournal%5D)">Cancer stem cells and self-renewal.</a> Clinical Cancer Research. 16 (12), 3113-3120 (2010).</li>
<li>Morgan, M. A., Lawrence, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+pathways%3A+overcoming+radiation+resistance+by+targeting+DNA+damage+response+pathways%5BTitle%5D)+AND+%22Clinical+Cancer+Research%22%5BJournal%5D)">Molecular pathways: overcoming radiation resistance by targeting DNA damage response pathways.</a> Clinical Cancer Research. 21 (13), 2898-2904 (2015).</li>
<li>Yu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanistic+exploration+of+cancer+stem+cell+marker+voltage-dependent+calcium+channel+%CE%B12%CE%B41+subunit-mediated+chemotherapy+resistance+in+small-cell+lung+cancer%5BTitle%5D)+AND+%22Clin+Cancer+Res%22%5BJournal%5D)">Mechanistic exploration of cancer stem cell marker voltage-dependent calcium channel α2δ1 subunit-mediated chemotherapy resistance in small-cell lung cancer.</a> Clin Cancer Res. 24 (9), 2148-2158 (2018).</li>
</ol>

The authors declare no conflict of interest.

This protocol describes methods to study the radiosensitivity of CSCs in cancer cell lines in vitro. In this study, the expression of &#945;2&#948;1 is continuous in NSCLC cell lines. Therefore, gating is based on an isotype control. Before sorting, &#945;2&#948;1 expression should be examined in multiple cell lines by flow cytometry and validated by QPCR or western blot. It is recommended to re-analyze &#945;2&#948;1 expression of the sorted &#945;2&#948;1-high and &#945;2&#948;1-low cells by flow cytometry, by observing fluorescence under a fluorescent microscope, or by QPCR (after sorting).
Sphere formation assay is a simple way to evaluate self-renewal capacity, which can be used to preliminarily characterize putative CSCs. This method has been used to culture neurospheres or mammospheres to characterize stem cells in glioma or breast cancer cells, and the formula is modified to culture other types of cancer4,6,10. EGF and bFGF can support the self-renewal of stem cells in serum-free medium; however, basic medium and growth factors may differ for culturing different cell types. The semisolid medium is used to immobilize cells so that spheres are formed by cell proliferation rather than clustering together. Ultralow attachment plate is used in the experiment to maintain sphere morphology. Moreover, as CSCs are enriched after sphere culture, when the spheres are collected, digested, and seeded for secondary sphere formation, sphere formation efficiency is likely to increase in subsequent serial propagation9,10. A more rigorous criteria for characterizing CSCs is in vivo limiting dilution assay, in which a series of numbers of sorted positive and negative cells are injected subcutaneously into immunodeficient mice, then the frequencies of tumorigenic cells in positive and negative cell populations are calculated10,14. If a putative cancer stem cell marker is identified by sphere formation assay, further characterization by in vivo limiting dilution assay is recommended.
In this study the radiosensitivity of CSCs is evaluated. Colony formation assay is a classical way to assess the radiosensitivity. Seeding same number of cells in parallel wells in important. Adjust the cell number per mL to a suitable range to ensure the volume of cell suspension added to each well is more than 100 &#956;L. If the volume is too small, the error is likely to increased. For cell radiation, medium with a 1 cm height is added for dose build-up, and a tissue-equivalent bolus is placed under the plate for dose backscatter. Researchers are recommended to refer to radiation physicists and technicians to set up the cell radiation model and calculate the dose.
This manuscript provides the initial few steps for the radiosensitivity study of CSCs. Further mechanism studies may involve proteins related to DNA damage repair, clearance of reactive oxygen species, cell cycle arrest, etc.15. These experiments need a large amount of cells; therefore, many dishes of cells are needed to be prepared. Overexpression or knockout/knockdown of CSC genes also provide important insights into how CSCs gain radioresistance.
These methods can potentially be applied to identify CSCs in cancer tissues. Zhang et al. described isolating CD166-positive Lin-negative cells from NSCLC surgical samples12. Tissues were chopped with a sterile blade and digested with an enzyme cocktail. Cells collected by passing through cell strainers were labeled for sorting, and then characterized by sphere formation assay and in vivo limiting dilution assay. For &#945;2&#948;1 as a CSC marker, it has been reported to isolate CSC in hepatocellular carcinoma surgical tissues and small cell lung cancer patient-derived xenograft tissues10,16. Considering a high number of cells are required for analysis, it is relatively difficult to isolate CSCs in biopsies or circulating tumor cells. Alternatively, staining the sections of biopsies may potentially provide clues for the existence of CSC in the tumors. However, this presumptive application needs to be evaluated in patient tissues and clinical data.

Radiotherapy plays an important role in cancer treatment. However, existence of radioresistant cancer stem cells (CSCs) may lead to relapse or poor outcomes after radiotherapy1,2. CSCs are characterized by their self-renewal capacity and ability to generate heterogenous cancer cells3. Armored with a more efficient DNA damage repair capacity or higher levels of free-radical scavenging systems or other mechanisms, CSCs are relatively resistant to radiotherapy4,5,6,7,8. Identifying CSC markers and exploring their mechanisms will facilitate the development of drugs that will overcome radioresistance without increasing normal tissue damage.
Voltage-gated calcium channel &#945;2&#948;1 subunit isoform 5 has been reported as a marker for radioresistant CSCs in NSCLC cell lines9. &#945;2&#948;1 was originally identified as a CSC marker for hepatocellular carcinoma (HCC)10. Using subtractive immunization with a pair of HCC cell lines derived from the primary and recurrent tumors in the same patient, an antibody named 1B50-1 was identified to target recurrent HCC cells specifically. 1B50-1-positive cells showed high sphere formation efficiency in vitro and high tumorigenicity in vivo. Its antigen was identified by mass spectrometry, as calcium channel &#945;2&#948;1 subunit isoform 5. &#945;2&#948;1 specifically expresses in CSCs and is undetectable in most normal tissues, making it a potential candidate for targeting CSCs10. &#945;2&#948;1 can also serve as a CSC marker for NSCLC cell lines, and it has been shown to impart radioresistance to NSCLC cells partially by enhancing the efficiency of DNA damage repair in response to radiation9.
Studying radioresistant CSCs may provide clues to overcoming radioresistance. Using &#945;2&#948;1 in NSCLC as an example, major methods to study the radiosensitivity of CSCs are presented. Usually, CSCs are isolated with a putative surface marker, and the stem cell characteristics and radiosensitivity of the positive and negative cell populations are compared. Sphere formation in a serum-free medium supplemented with growth factors that support self-renewal is a useful assay to evaluate the stemness of cells in vitro. Cells with high sphere formation capacity are likely to show high tumorigenicity when injected into immunodeficient mice10,11,12. Colony formation assay is then used to assess the radiosensitivity of cells, which determines how many have lost the ability to generate descendants forming the colony after a dose of radiation13.

<table><tbody><tr><td>0.5% Trypsin-EDTA (10X), no phenol red</td><td>Thermo Fisher</td><td>15400054</td><td>Dilute in to 0.05% (1X) with autoclaved distilled water</td></tr><tr><td>1B50-1</td><td></td><td></td><td>This antibody is produced and friendly supplied by Laboratory of Carcinogenesis and Translational Reseach (Ministry of Education/Beijing), Department of Cell Biology, Peking University Cancer Hospital and Institute. See reference 10. Alternatively, commercial antibody of calcium channel &amp;alpha;2&amp;delta;1 subunit can be used (ABCAM, ab2864) (Yu, et al., Am J Cancer Res, 2016; 6(9): 2088-2097)</td></tr><tr><td>4% formaldehyde solution</td><td>Solarbio</td><td>G2160</td><td></td></tr><tr><td>A549</td><td>ATCC</td><td></td><td>RRID: CVCL_0023</td></tr><tr><td>B27</td><td>Thermo Fisher</td><td>17504044</td><td></td></tr><tr><td>Biological Safety Cabinet</td><td>Thermo Fisher</td><td>1336</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5910R</td><td></td></tr><tr><td>DMEM/F-12</td><td>Thermo Fisher</td><td>12500062</td><td></td></tr><tr><td>EGF Recombinant Human Protein</td><td>Thermo Fisher</td><td>PHG0311</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Thermo Fisher</td><td>16140071</td><td></td></tr><tr><td>FGF-Basic (AA 1-155) Recombinant Human Protein</td><td>Thermo Fisher</td><td>PHG0261</td><td></td></tr><tr><td>Flow cytometer/cell sorter</td><td>BD</td><td>FACSARIA III</td><td></td></tr><tr><td>H1299</td><td>ATCC</td><td></td><td>RRID: CVCL_0060</td></tr><tr><td>H1975</td><td>ATCC</td><td></td><td>RRID: CVCL_1511</td></tr><tr><td>Lightning-Link Fluorescein Kit</td><td>Innova Biosciences</td><td>310-0010</td><td></td></tr><tr><td>linear accelerator</td><td>VARIAN</td><td>CLINAC 600C/D</td><td></td></tr><tr><td>Methyl cellulose</td><td>Sigma Aldrich</td><td>M7027</td><td></td></tr><tr><td>Penicillin-Streptomycin, Liquid</td><td>Thermo Fisher</td><td>15140122</td><td></td></tr><tr><td>Phosphate buffered saline</td><td>Solarbio</td><td>P1020</td><td></td></tr><tr><td>RPMI-1640</td><td>Thermo Fisher</td><td>11875093</td><td></td></tr><tr><td>SYBRGREEN</td><td>TOYOBO</td><td>QPK-201</td><td></td></tr><tr><td>TRIzol</td><td>Thermo Fisher</td><td>15596026</td><td></td></tr><tr><td>Violet crystal staining solution</td><td>Solarbio</td><td>G1062</td><td></td></tr></tbody></table>

radiosensitivity of cancer stem cells in lung cancer cell lines

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide clues to overcoming radioresistance. Voltage-gated calcium channel &#945;2&#948;1 subunit isoform 5 has been reported as a marker for radioresistant CSCs in non-small cell lung cancer (NSCLC) cell lines. Using calcium channel &#945;2&#948;1 subunit as an example of a CSC marker, methods to study the radiosensitivity of CSCs in NSCLC cell lines are presented. CSCs are sorted with putative markers by flow cytometry, and the self-renewal capacity of sorted cells is evaluated by sphere formation assay. Colony formation assay, which determines how many cells lose the ability to generate descendants forming the colony after a certain dose of radiation, is then performed to assess the radiosensitivity of sorted cells. This manuscript provides initial steps for studying the radiosensitivity of CSCs, which establishes the basis for further understanding of the underlying mechanisms.

&#945;2&#948;1-high and &#945;2&#948;1-low A549 cells were sorted (Figure 1A). Some markers may show distinct populations and are easy to gate. However, some markers just show high and low expression patterns, rather than distinct positive and negative populations. In this situation, an isotype control is very important for gating. The expression of &#945;2&#948;1 in sorted cells is validated by qPCR. The expression of CACNA2D1, the gene that encode &#945;2&#948;1, is higher in sorted &#945;2&#948;1-high cells compared with &#945;2&#948;1-low cells (Figure 1B).
Typical morphology of spheres is shown in Figure 2A. The sphere formation efficiency is calculated in &#945;2&#948;1-high and &#945;2&#948;1-low cells (Figure 2B). &#945;2&#948;1-high cells showed higher sphere formation efficiency, suggesting a higher self-renewal capacity. Typical images of cell colonies are shown in Figure 3A. A colony with about 50 cells can be examined under a microscope and marked as a reference. A survival fraction at each dose can be calculated, and the survival curves are&#160;presented in Figure 3B. &#945;2&#948;1-high cells are relatively resistant to radiation compared to &#945;2&#948;1-low cells.
Unpaired two-sided Student&#8217;s t-test was performed to evaluate the significance between groups. A value of p &#60; 0.05 was considered to be statistically significant. Data are represented with the mean and standard deviation (SD). Representative data from at least three biologically independent experiments with similar results are presented.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60046/60046fig1.jpg" /> 
Figure 1: Sorting &#945;2&#948;1-high and &#945;2&#948;1-low cells in A549. (A) Representative flow cytometry analysis of &#945;2&#948;1 expression. Cells are gated based on the isotype control. (B) Confirmation of &#945;2&#948;1 expression in high and low populations by QPCR. The error bars indicate SD. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60046/60046fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60046/60046fig2.jpg" /> 
Figure 2: Sphere formation assay of &#945;2&#948;1-high and &#945;2&#948;1-low A549 cells. (A) Representative morphology of the spheres formed by the sorted &#945;2&#948;1-high and &#945;2&#948;1-low cells (bar = 200 &#956;m). (B) Sphere formation efficiency of &#945;2&#948;1-high and &#945;2&#948;1-low cells. The error bars indicate SD (***p &#60; 0.001). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60046/60046fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60046/60046fig3.jpg" /> 
Figure 3: Colony formation assay of &#945;2&#948;1-high and &#945;2&#948;1-low A549 cells. (A) Representative images of the colonies formed by the sorted &#945;2&#948;1-high and &#945;2&#948;1-low cells. (B) Survival curves of &#945;2&#948;1-high and &#945;2&#948;1-low cells. The numbers of seeded cells were 200 cells per well for 0 Gy, 400 cells per well for 4 Gy, and 800 cells for 8 Gy. The error bars indicate SD (**p &#60; 0.05, ***p &#60; 0.001). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60046/60046fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines at JoVE.com

Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

The presence of cancer stem cells have been associated with relapse or poor outcomes after radiotherapy. This manuscript describes the methods to study the radiosensitivity of cancer stem cells in lung cancer cell lines.

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide ...

radiosensitivity-of-cancer-stem-cells-in-lung-cancer-cell-lines

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.0K Views.  Peking University Cancer Hospital and Institute. The presence of cancer stem cells have been associated with relapse or poor outcomes after radiotherapy. This manuscript describes the methods to study the radiosensitivity of cancer stem cells in lung cancer cell lines.

Video: Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to overcome this challenge. Here, a 2-step dose-escalation method for establishing dual-resistance to an epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor (TKI), gefitinib, and a MET-TKI, PHA665752, is described. This method is based on simple stepwise dose-escalation of inhibitors for inducing acquired resistance in cell lines. The alternate method for generating resistant sublines involves exposing the cells to high concentrations of the inhibitor in one step. The stepwise dose-escalation method has a higher possibility of successfully inducing acquired resistance than this method. Activating EGFR mutations are biomarkers of a response to treatment with EGFR-TKI, which is an applied first-line treatment for non-small cell lung cancers (NSCLC) that harbor these mutations. However, despite reports of effective responses, the use of EGFR-TKI is limited because tumors inevitably acquire resistance. The major mechanisms behind EGFR-TKI resistance include a secondary mutation at the gatekeeper site, T790M in exon 20 of EGFR, and a bypass signal of MET. Thus, a potential solution for this issue would be a combination of EGFR-TKI and MET-TKI. This combined treatment has been shown to be effective in an in vitro study model. Acquired gefitinib-resistance was established through MET-amplification by stepwise dose-escalation of gefitinib for 12 months, and a cell line named PC-9MET1000 was generated in a previous study. To further investigate the mechanisms of acquired MET-TKI and EGFR-TKI resistance, a MET-TKI, PHA665752, was administered to these cells with stepwise dose-escalation in the presence of gefitinib for 12 months. This protocol has also been successfully applied for a number of combination therapies to establish acquired resistance to other inhibitor molecules.

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

An in vitro method for establishing dual resistance to an EGFR-TKI and a MET-TKI in cancer cells is described. This method is useful for developing treatments for patients with EGFR-mutations, who exhibit disease progression despite EGFR-TKI treatment with MET-amplification. It can also be modified for inhibitors targeting other molecules.

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to ...

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and recurrent disease. This population can be identified by surface markers, enzymatic activity and a functional profile. These approaches per se are limited, due to phenotypic heterogeneity and CSC plasticity. Here, we update the sphere-forming protocol to obtain CSC spheres from breast and gynecological cancers, assessing functional properties, CSC markers and protein expression. The spheres are obtained with single-cell seeding at low density in suspension culture, using a semi-solid methylcellulose medium to avoid migration and aggregates. This profitable protocol can be used in cancer cell lines but also in primary tumors. The tridimensional non-adherent suspension culture thought to mimic the tumor microenvironment, particularly the CSC-niche, is supplemented with epidermal growth factor and basic fibroblast growth factor to ensure CSC signaling. Aiming for robust identification of CSC, we propose a complementary approach, combining functional and phenotypic evaluation. Sphere-forming capacity, self-renewal and sphere projection area establish CSC functional properties. Additionally, characterization comprises flow cytometry evaluation of the markers, represented by CD44+/CD24- and CD133, and Western blot, considering ALDH. The presented protocol was also optimized for primary tumor samples, following a sample digestion procedure, useful for translational research.

The aim of this methodology is to identify cancer stem cells (CSC) in cancer cell lines and primary human tumor samples with the sphere-forming protocol, in a robust manner, using functional assays and phenotypic characterization with flow cytometry and Western blot.

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and ...

Generation of a Novel Dendritic-cell Vaccine Using Melanoma and Squamous Cancer Stem Cells

We identified cancer stem cell (CSC)-enriched populations from murine melanoma D5 syngeneic to C57BL/6 mice and the squamous cancer SCC7 syngeneic to C3H mice using ALDEFLUOR/ALDH as a marker, and tested their immunogenicity using the cell lysate as a source of antigens to pulse dendritic cells (DCs). DCs pulsed with ALDHhigh CSC lysates induced significantly higher protective antitumor immunity than DCs pulsed with the lysates of unsorted whole tumor cell lysates in both models and in a lung metastasis setting and a s.c.&#160;tumor growth setting, respectively. This phenomenon was due to CSC vaccine-induced humoral as well as cellular anti-CSC responses. In particular, splenocytes isolated from the host subjected to CSC-DC vaccine produced significantly higher amount of IFN&#947; and GM-CSF than splenocytes isolated from the host subjected to unsorted tumor cell lysate pulsed-DC vaccine. These results support the efforts to develop an autologous CSC-based therapeutic vaccine for clinical use in an adjuvant setting.

Evaluated in syngeneic immunocompetent hosts, cancer stem cell (CSC) based dendritic cell (DC) vaccine demonstrated significantly higher antitumor immunity than traditional DC vaccines pulsed with heterogeneous bulk tumor cells.

We identified cancer stem cell (CSC)-enriched populations from murine melanoma D5 syngeneic to C57BL/6 mice and the squamous cancer SCC7 syngeneic to C3H ...

Immunology and Infection

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major contributors to breast cancer initiation, relapse, metastasis and therapy resistance. It is imperative to understand the biology of breast cancer stem cells in order to identify novel therapeutic targets to treat breast cancer. Breast cancer stem cells are isolated and characterized based on expression of unique cell surface markers such as CD44, CD24 and enzymatic activity of aldehyde dehydrogenase (ALDH). These ALDHhighCD44+CD24- cells constitute the BCSC population and can be isolated by fluorescence-activated cell sorting (FACS) for downstream functional studies. Depending on the scientific question, different in vitro and in vivo methods can be used to assess the functional characteristics of BCSCs. Here, we provide a detailed experimental protocol for isolation of human BCSCs from both heterogenous populations of breast cancer cells as well as primary tumor tissue obtained from breast cancer patients. In addition, we highlight downstream in vitro and in vivo functional assays including colony forming assays, mammosphere assays, 3D culture models and tumor xenograft assays that can be used to assess BCSC function.

This experimental protocol describes the isolation of BCSCs from breast cancer cell and tissue samples as well as the in vitro and in vivo assays that can be used to assess BCSC phenotype and function.

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major ...

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 &#181;M cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

Cancer stem cells (CSCs) are&#160;implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing&#160;in a stem cell promoting media we enrich for non-adherent CSC cultures.

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

Medicine

Radiation Response in Patient-Derived Tumor Organoids Using a Clonogenic Assay

Live Imaging to Quantify Cellular Radiosensitivity in Patient-Derived Tumor Organoids

Radiation therapy (RT) is one of the mainstays of modern clinical cancer management. However, not all cancer types are equally sensitive to irradiation, often (but not always) because of differences in the ability of malignant cells to repair oxidative DNA damage as elicited by ionizing rays. Clonogenic assays have been employed for decades to assess the sensitivity of cultured cancer cells to ionizing irradiation, largely because irradiated cancer cells often die in a delayed manner that is difficult to quantify with short-term flow cytometry- or microscopy-assisted techniques. Unfortunately, clonogenic assays cannot be employed as such for more complex tumor models, such as patient-derived tumor organoids (PDTOs). Indeed, irradiating established PDTOs may not necessarily abrogate their growth as multicellular units, unless their stem-like compartment is completely eradicated. Moreover, irradiating PDTO-derived single-cell suspensions may not properly recapitulate the sensitivity of malignant cells to RT in the context of established PDTOs. Here, we detail an adaptation of conventional clonogenic assays that involves exposure of established PDTOs to ionizing radiation, followed by single-cell dissociation, replating in suitable culture conditions and live imaging. Non-irradiated (control) PDTO-derived stem-like cells reform growing PDTOs with a PDTO-specific efficiency, which is negatively influenced by irradiation in a dose-dependent manner. In these conditions, PDTO-forming efficiency and growth rate can be quantified as a measure of radiosensitivity on time-lapse images collected until control PDTOs achieve a predefined space occupancy.

Author Spotlight: Radiotherapy and Clonogenic Assays for Advancing Cancer Research and Personalized Medicine

Here, we detail a straightforward live imaging approach for quantifying the sensitivity of patient-derived tumor organoids to ionizing radiation.

Radiation therapy (RT) is one of the mainstays of modern clinical cancer management. However, not all cancer types are equally sensitive to irradiation, ...

Clinical Factors Influencing the Radiation Dose of Circulating Immune Cells during Radiotherapy for Small Cell Lung Cancer

Small cell lung cancer (SCLC) has garnered significant attention due to its high malignancy, propensity for distant metastasis, and poor prognosis. Radiotherapy remains the cornerstone of treatment for limited-stage small cell lung cancer (LS-SCLC). However, outcomes with radiotherapy alone or in combination with chemotherapy remain suboptimal. Radiotherapy can induce lymphopenia by directly irradiating hematopoietic organs or destroying mature circulating lymphocytes, leading to immunosuppression and consequently diminishing therapeutic efficacy. The estimated dose of radiation to immune cells (EDRIC) model integrates factors such as hemodynamics, lymphocyte radiosensitivity, and proliferation capacity. This study employs the EDRIC model with enhancements to calculate the circulating immune cell radiation dose. By utilizing the EDRIC methodology, the study explores the correlation between EDRIC and tumor target size, average lung dose, average heart dose, clinical features, and peripheral blood lymphocytopenia during radiotherapy for LS-SCLC, aiming to inform personalized patient treatment strategies.
This study analyzed data from 64 LS-SCLC patients who met the inclusion criteria at the General Hospital of Ningxia Medical University from January 2023 to January 2024, all of whom received radical thoracic conventional fractionated radiotherapy. Lymphocyte counts were recorded at the following points: before radiotherapy, at the lowest observed value during radiotherapy, at the end of radiotherapy, and one-month post-radiotherapy. Dosimetric data, including average lung, heart, and body doses, were extracted from the treatment planning system, and the circulating EDRIC was calculated using this model. The relationship between EDRIC values and therapeutic outcomes was analyzed. In LS-SCLC, the EDRIC model effectively predicts lymphocyte count reduction, correlating with planning target volume (PTV; cm3), TNM stage, and the percentage of target lesion shrinkage. Post-radiotherapy, there was a significant decrease in peripheral blood lymphocyte counts, with greater EDRIC values indicating more pronounced lymphocyte reduction.

Here, we present a protocol to evaluate the effects of radiation therapy on immune system lymphocytes in small cell lung cancer.

Small cell lung cancer (SCLC) has garnered significant attention due to its high malignancy, propensity for distant metastasis, and poor prognosis. ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Characterization of a Head and Neck Squamous Cell Carcinoma Subpopulation Having Stem Cell Characteristics

Despite advances in the understanding of head and neck squamous cell carcinomas (HNSCC) progression, the five-year survival rate remains low due to local recurrence and distant metastasis. One hypothesis to explain this recurrence is the presence of cancer stem-like cells (CSCs) that present inherent chemo- and radio-resistance. In order to develop new therapeutic strategies, it is necessary to have experimental models that validate the effectiveness of targeted treatments and therefore to have reliable methods for the identification and isolation of CSCs. To this end, we present a protocol for the isolation of CSCs from human HNSCC cell lines that relies on the combination of two successive cell sortings performed by fluorescence activated cell sorting (FACS). The first one is based on the property of CSCs to overexpress ATP-Binding Cassette (ABC) transporter proteins and thus exclude, among others, vital DNA dyes such as Hoechst 33342. The cells sorted with this method are identified as a &#34;side population&#34; (SP). As the SP cells represent a low percentage (&#60;5%) of parental cells, a growing phase is necessary in order to increase their number before the second cell sorting. The next step allows for the selection of cells that possess two other HNSCC stem cell characteristics i.e. high expression level of the cell surface marker CD44 (CD44high) and the over-expression of aldehyde dehydrogenase (ALDHhigh). Since the use of a single marker has numerous limitations and pitfalls for the isolation of CSCs, the combination of SP, CD44 and ALDH markers will provide a useful tool to isolate CSCs for further analytical and functional assays requiring viable cells. The stem-like characteristics of CSCs was finally validated in vitro by the formation of tumorispheres and the expression of &#946;-catenin.

Understanding the role of cancer stem-like cells in tumor recurrence and resistance to therapies has become a topic of great interest in the last decade. This article describes the isolation and characterization of the sub-population of cancer stem-like cells from head and neck squamous carcinoma cell lines (HNSCC).

Despite advances in the understanding of head and neck squamous cell carcinomas (HNSCC) progression, the five-year survival rate remains low due to local ...

Pre-Conditioning the Airways of Mice with Bleomycin Increases the Efficiency of Orthotopic Lung Cancer Cell Engraftment

Lung cancer is a deadly treatment refractory disease that is biologically heterogeneous. To understand and effectively treat the full clinical spectrum of thoracic malignancies, additional animal models that can recapitulate diverse human lung cancer subtypes and stages are needed. Allograft or xenograft models are versatile and enable the quantification of tumorigenic capacity in vivo, using malignant cells of either murine or human origin. However, previously described methods of lung cancer cell engraftment have been performed in non-physiological sites, such as the flank of mice, due to the inefficiency of orthotopic transplantation of cells into the lungs. In this study, we describe a method to enhance orthotopic lung cancer cell engraftment by pre-conditioning the airways of mice with the fibrosis inducing agent bleomycin. As a proof-of-concept experiment, we applied this approach to engraft tumor cells of the lung adenocarcinoma subtype, obtained from either mouse or human sources, into various strains of mice. We demonstrate that injuring the airways with bleomycin prior to tumor cell injection increases the engraftment of tumor cells from 0-17% to 71-100%. Significantly, this method enhanced lung tumor incidence and subsequent outgrowth using different models and mouse strains. In addition, engrafted lung cancer cells disseminate from the lungs into relevant distant organs. Thus, we provide a protocol that can be used to establish and maintain new orthotopic models of lung cancer with limiting amounts of cells or biospecimen and to quantitatively assess the tumorigenic capacity of lung cancer cells in physiologically relevant settings.

We describe a method to significantly enhance orthotopic engraftment of lung cancer cells into the murine lungs by pre-conditioning the airways with injury. This approach may also be applied to study stromal interactions within the lung microenvironment, metastatic dissemination, lung cancer co-morbidities, and to more efficiently generate patient derived xenografts.

Lung cancer is a deadly treatment refractory disease that is biologically heterogeneous. To understand and effectively treat the full clinical spectrum of ...

Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

Podsumowanie

Przeglądaj więcej filmów

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Generation of a Novel Dendritic-cell Vaccine Using Melanoma and Squamous Cancer Stem Cells

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Live Imaging to Quantify Cellular Radiosensitivity in Patient-Derived Tumor Organoids

Clinical Factors Influencing the Radiation Dose of Circulating Immune Cells during Radiotherapy for Small Cell Lung Cancer

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Isolation and Characterization of a Head and Neck Squamous Cell Carcinoma Subpopulation Having Stem Cell Characteristics

Pre-Conditioning the Airways of Mice with Bleomycin Increases the Efficiency of Orthotopic Lung Cancer Cell Engraftment