This work was supported by the Science and Technology Program of Zhuhai, China (grant number 20171009E030064), the Science and Technology Program of Guangdong, China (grant number 2015A020211004) and the Science and Technology Program of General Administration of Quality Supervision, Inspection and Quarantine of the People&#39;s Republic of China (grant number 2016IK302, 2017IK224).

The protocol follows the guidelines set by the human research ethics committee of Zhuhai International Travel Healthcare Center. Please use standard sterile operation during the experiment.
1. Culture Media Composition and Preparation
<ol>
	<li>Prepare Nutrient Broth: Dissolve 1% peptone, 0.3% beef extract, 0.5% sodium chloride, 0.1% glucose in H2O, adjust pH to 7.5 and autoclave it in 121 &#176;C for 15 min.</li>
	<li>Prepare Selenite Cystine medium: Dissolve 0.5% peptone, 0.4% lactose, 1%Na2HCO3, 0.4% sodium hydrogen selenite, 0.001% L-Cystine in H2O, adjust pH to 7.0 and boil it for 5 min.</li>
	<li>Prepare the Xylose, Lysine, Deoxycholate agar (XLD) plate: Dissolve 0.3% yeast extract, 0.5% L-lysine, 0.375% xylose, 0.75% lactose, 0.75% sucrose, 0.5% sodium chloride, 0.008% phenol red, 0.68% sodium thiosulfate, 0.08% ammonium ferric citrate, 0.25% sodium deoxycholate, 1.5% agar in H2O, and adjust pH to 7.4. Then boil it for 5 min and pour it into 90 mm plates.</li>
	<li>Prepare the Salmonella chromogenic agar plate: Dissolve 1.5% agar, 0.7% peptone and yeast extract, 1.29% selective reagent in H2O. Then boil it for 5 min and pour it into 90 mm plates.</li>
	<li>Prepare the Nutrient agar plate: Dissolve 1% peptone, 0.3% beef extract, 0.5% sodium chloride, 1.5% agar in H2O, and adjust pH to 7.3. Then autoclave it in 121 &#176;C for 15 min and pour it into 90 mm plates.</li>
	<li>Prepare the MacConkey agar (MAC) plate: Dissolve 2% peptone, 1% lactose, 0.5% sodium chloride, 0.5% OX Bile Salt, 0.0025% Neutral Red, 1.5% agar, 0.0001% crystal violet in H2O, and adjust pH to 7.2. Then autoclave it in 115 &#176;C for 20 min and pour it into 90 mm plates.</li>
</ol>
2. Real-time PCR
<ol>
	<li>Sample collection
	<ol>
		<li>Insert an anal swab into the patient&#39;s anus 3-5 cm deep, and rotate it 360&#176; around.</li>
		<li>Put the anal swab into a sterile collection tube. Mark sample ID.</li>
		<li>Send the sample to laboratory as soon as possible. 
		NOTE: Samples could be stored at 4 &#176;C for no more than 24 h.</li>
	</ol>
	</li>
	<li>Pre-enrichment
	<ol>
		<li>Add 3 mL of Nutrient Broth into each sample in the collection tube.</li>
		<li>Incubate at 36 &#176;C for 6 h in an incubator.</li>
	</ol>
	</li>
	<li>Sample mixing (optional)
	<ol>
		<li>Collect 100 &#181;L of each pre-enrichment culture and mix 8-10 samples of 1 specimen into a 1.5 mL tube if there are more than 10 samples.</li>
		<li>Mark properly.</li>
	</ol>
	</li>
	<li>DNA extraction
	<ol>
		<li>Centrifuge the pre-enrichment culture at 800 x g for 2 min to allow large particles to settle down, and transfer the supernatant to a new tube and centrifuge at 12,000 x g for 5 min. Discard the supernatant by aspiration.</li>
		<li>Add 100 &#181;L of DNA extraction solution (0.01 M pH 8.0 Tris-EDTA, 0.01% Nonidet P 40 (NP40)) to the pellet. Vortex vigorously for 1 min.</li>
		<li>Boil at 100 &#176;C for 5 min on a dry bath.</li>
		<li>Centrifuge at 12,000 x g for 5 min. Collect the supernatant using a new tube, which will be the template for the succeeding real-time PCR analysis.</li>
	</ol>
	</li>
	<li>Real-time PCR
	<ol>
		<li>Setup the reaction mixture as follow: for each sample, add 12.5 &#181;L of 2x reaction mixture, 0.4 &#181;M of each primer, 0.2 &#181;M of each probe (sequences in Table 1)27, 5 &#181;L of the template as prepared in step 2.4.4, and use ddH2O to add up to 25 &#181;L total volume.</li>
		<li>Setup the cycling program as follow: 95 &#176;C for 3 min, followed by 40 cycles of 95 &#176;C for 15 s, 55 &#176;C for 30 s, 72 &#176;C for 34 s. Collect fluorescent signals from 6-carboxy-fluorescein (FAM) and Hexachlorofluorescein (HEX) channels at the elongation step (72 &#176;C) automatically by the fluorescent real-time PCR machine.</li>
		<li>Perform real-time PCR on a fluorescent real-time PCR machine, according to instructions of the instrument.</li>
		<li>Go to Step 4 directly and issue negative reports if negative results occur on the FAM/HEX channels, which means that samples are negative for Salmonella spp./Shigella spp.</li>
		<li>Go to step 3.1 and/or 3.2 if positive results occur on the HEX and/or FAM channels, which means that the sample may be positive for Salmonella spp. and/or Shigella spp., respectively. 
		NOTE: If sample mixing has been performed in step 2.3, then real-time PCR on individual samples which made up the positive one should be performed to screen out the real positive sample.</li>
	</ol>
	</li>
</ol>
3. Guided Culture
<ol>
	<li>Salmonella spp. PCR positive sample
	<ol>
		<li>Selective culture in medium
		<ol>
			<li>Add 100 &#181;L of pre-enrichment culture into 5 mL of Selenite Cystine medium in a test tube. Incubate at 36 &#176;C for 18&#8211;24 h in an incubator.</li>
		</ol>
		</li>
		<li>Separating culture on plate
		<ol>
			<li>Collect one loop of the culture with a micro-loop and spread onto a XLD plate or Salmonella chromogenic agar plate. Incubate at 36 &#176;C for 18-24 h in an incubator.</li>
		</ol>
		</li>
		<li>Biochemical identification
		<ol>
			<li>Select suspicious colony on XLD plate (pink colony with/without dark heart; dark colony; yellow colony with/without dark heart) or Salmonella chromogenic agar plate (purple or prunosus colony, smooth and round) (Figure 2).</li>
			<li>Subject suspicious colony for biochemical identification on automated microbial identification system, according to instructions of the instrument.</li>
		</ol>
		</li>
		<li>Serological characterization
		<ol>
			<li>O antigen characterization
			<ol>
				<li>Add one drop of the O antigen polyvalent sera onto a clean slide.</li>
				<li>Collect one loop of the colony with a micro-loop and grind in the sera.</li>
				<li>Go to step 3.1.4.1.4 if it looks like flowing sand, which means that the colony is reactive to the sera (Figure 3). Otherwise, go to step 3.1.4.1.5.</li>
				<li>Use O antigen monovalent sera to repeat steps 3.1.4.1.1 to 3.1.4.1.3 until the specific O antigen is characterized.</li>
				<li>Use Vi sera to repeat steps 3.1.4.1.1 to 3.1.4.1.3. Collect those Vi sera reactive colonies in a tube and boil at 100 &#176;C for 5 min in a dry bath. Centrifuge at 12,000 x g for 5 min. Collect the pellet and repeat steps 3.1.4.1.1 to 3.1.4.1.4 until specific O antigen is characterized.</li>
			</ol>
			</li>
			<li>H antigen characterization
			<ol>
				<li>Add one drop of the H antigen polyvalent sera onto a clean slide.</li>
				<li>Collect one loop of the colony with a micro-loop and grind in the sera.</li>
				<li>Go to step 3.1.4.2.4 if it looks like flowing sand, which means that the colony is reactive to the sera.</li>
				<li>Use H antigen monovalent sera to repeat steps 3.1.4.2.1 to 3.1.4.2.3 until specific H antigen is characterized. 
				NOTE: Sometimes serum induction may be needed to characterize the second phase H antigen. If so, then the following optional steps should be performed.</li>
				<li>(Optional) Add one drop of specific H antigen sera onto Nutrient agar plate. Wait until all the sera are absorbed.</li>
				<li>(Optional) Collect one loop of the colony with a micro-loop and spread onto the plate where specific H antigen sera are absorbed. Incubate at 36 &#176;C for 18-24 h in an incubator.</li>
				<li>(Optional) Use H antigen monovalent sera to repeat steps 3.1.4.2.1 to 3.1.4.2.3 until second phase H antigen is characterized.</li>
				<li>Go to step 4.</li>
			</ol>
			</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Shigella spp. PCR positive sample
	<ol>
		<li>Separating culture on plate
		<ol>
			<li>Collect one loop of the pre-enrichment culture with a micro-loop and spread onto a XLD plate or MAC plate. Incubate at 36 &#176;C for 18&#8211;24 h in an incubator.</li>
		</ol>
		</li>
		<li>Biochemical identification
		<ol>
			<li>Collect suspicious colony on XLD plate (smooth, round, transparent and red colony) or MAC plate (smooth, round, transparent and colorless colony with 2-3 mm in diameter; Shigella sonnei may be bigger and turn to light pink as the elongation of incubation time) (Figure 4).</li>
			<li>Subject suspicious colony for biochemical identification on automated microbial identification system, according to instructions of the instrument.</li>
		</ol>
		</li>
		<li>Serological characterization
		<ol>
			<li>Add one drop of the Shigella spp. polyvalent sera onto a clean slide.</li>
			<li>Collect one loop of the colony with a micro-loop and grind in the sera.</li>
			<li>Go to step 3.2.3.4 if it looks like flowing sand, which means that the colony is reactive to the sera.</li>
			<li>Use Shigella spp. monovalent sera to repeat steps 3.2.3.1 to 3.2.3.3 until specific Shigella spp. is characterized.</li>
			<li>Go to step 4.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
4. Report
<ol>
	<li>Issue positive or negative reports according to the above results.</li>
</ol>

<ol>
	<li>Roy, S. L., Scallan, E., Beach, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rate+of+acute+gastrointestinal+illness+in+developed+countries.">The rate of acute gastrointestinal illness in developed countries.</a> Journal of Water and Health. 4, 31-69 (2006).</li><li>Wilking, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acute+gastrointestinal+illness+in+adults+in+Germany:+a+population-based+telephone+survey.">Acute gastrointestinal illness in adults in Germany: a population-based telephone survey.</a> Epidemiology and Infection. 141 (11), 2365-2375 (2013).</li><li>Friesema, I. H. M., Lugn&#233;r, A. K., van Duynhoven, Y. T. H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Costs+of+gastroenteritis+in+the+Netherlands,+with+special+attention+for+severe+cases.">Costs of gastroenteritis in the Netherlands, with special attention for severe cases.</a> European Journal of Clinical Microbiology &amp; Infectious Diseases. 31 (8), 1895-1900 (2012).</li><li>Henson, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Estimation+of+the+costs+of+acute+gastrointestinal+illness+in+British+Columbia,+Canada.">Estimation of the costs of acute gastrointestinal illness in British Columbia, Canada.</a> International Journal of Food Microbiology. 127 (1-2), 43-52 (2008).</li><li>Okhuysen, P. C., Jiang, Z. D., Carlin, L., Forbes, C., DuPont, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-diarrhea+chronic+intestinal+symptoms+and+irritable+bowel+syndrome+in+North+American+travelers+to+Mexico.">Post-diarrhea chronic intestinal symptoms and irritable bowel syndrome in North American travelers to Mexico.</a> The American Journal of Gastroenterology. 99 (9), 1774-1778 (2004).</li><li>Wongboot, W., Okada, K., Chantaroj, S., Kamjumphol, W., Hamada, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+and+quantification+of+19+diarrhea-related+pathogens+with+a+quantitative+real-time+PCR+panel+assay.">Simultaneous detection and quantification of 19 diarrhea-related pathogens with a quantitative real-time PCR panel assay.</a> Journal of Microbiological Methods. 151, 76-82 (2018).</li><li>Van Lint, P., De Witte, E., Ursi, J. P., Van Herendael, B., Van Schaeren, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+screening+algorithm+for+diagnosing+bacterial+gastroenteritis+by+real-time+PCR+in+combination+with+guided+culture.">A screening algorithm for diagnosing bacterial gastroenteritis by real-time PCR in combination with guided culture.</a> Diagnostic Microbiology and Infectious Disease. 85 (2), 255-259 (2016).</li><li>Liu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+quantitative+molecular+diagnostic+methods+to+identify+causes+of+diarrhoea+in+children:+a+reanalysis+of+the+GEMS+case-control+study.">Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: a reanalysis of the GEMS case-control study.</a> Lancet. 388 (10051), 1291-1301 (2016).</li><li>Wang, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surveillance+of+shigellosis+by+real-time+PCR+suggests+underestimation+of+shigellosis+prevalence+by+culture-based+methods+in+a+population+of+rural+China.">Surveillance of shigellosis by real-time PCR suggests underestimation of shigellosis prevalence by culture-based methods in a population of rural China.</a> Journal of Infection. 61 (6), 471-475 (2010).</li><li>Wikswo, M. E., Hall, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outbreaks+of+acute+gastroenteritis+transmitted+by+person-to-person+contact--United+States,+2009-2010.">Outbreaks of acute gastroenteritis transmitted by person-to-person contact--United States, 2009-2010.</a> MMWR Surveillance Summaries. 61 (9), 1-12 (2012).</li><li>Shen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+12+Gastrointestinal+Pathogens+Spectrum+of+Acute+Infectious+Diarrhea+in+a+Sentinel+Hospital,+Shenzhen,+China.">The 12 Gastrointestinal Pathogens Spectrum of Acute Infectious Diarrhea in a Sentinel Hospital, Shenzhen, China.</a> Frontiers in Microbiology. 7, 1926 (2016).</li><li>Tariq, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+antimicrobial+resistance+and+integron+association+of+multidrug-resistant+clinical+isolates+of+Shigella+species+from+Faisalabad,+Pakistan.">Molecular profiling of antimicrobial resistance and integron association of multidrug-resistant clinical isolates of Shigella species from Faisalabad, Pakistan.</a> Canadian Journal of Microbiology. 58 (9), 1047-1054 (2012).</li><li>Ferrari, R. G., Panzenhagen, P. H. N., Conte-Junior, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+and+Genotypic+Eligible+Methods+for+Salmonella+Typhimurium+Source+Tracking.">Phenotypic and Genotypic Eligible Methods for Salmonella Typhimurium Source Tracking.</a> Frontiers in Microbiology. 8, 2587 (2017).</li><li>Oliver, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viable+but+nonculturable+state+in+bacteria.">The viable but nonculturable state in bacteria.</a> The Journal of Microbiology. 43, 93-100 (2005).</li><li>Rintala, A., Munukka, E., Weintraub, A., Ullberg, M., Eerola, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+multiplex+real-time+PCR+kit+Amplidiag(R)+Bacterial+GE+in+the+detection+of+bacterial+pathogens+from+stool+samples.">Evaluation of a multiplex real-time PCR kit Amplidiag(R) Bacterial GE in the detection of bacterial pathogens from stool samples.</a> Journal of Microbiological Methods. 128, 61-65 (2016).</li><li>Wohlwend, N., Tiermann, S., Risch, L., Risch, M., Bodmer, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+Multiplex+Real-Time+PCR+Assay+for+Detecting+Major+Bacterial+Enteric+Pathogens+in+Fecal+Specimens:+Intestinal+Inflammation+and+Bacterial+Load+Are+Correlated+in+Campylobacter+Infections.">Evaluation of a Multiplex Real-Time PCR Assay for Detecting Major Bacterial Enteric Pathogens in Fecal Specimens: Intestinal Inflammation and Bacterial Load Are Correlated in Campylobacter Infections.</a> Journal of Clinical Microbiology. 54 (9), 2262-2266 (2016).</li><li>Van Lint, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+real-time+multiplex+PCR+for+the+simultaneous+detection+of+Campylobacter+jejuni,+Salmonella+spp.,+Shigella+spp./EIEC,+and+Yersinia+enterocolitica+in+fecal+samples.">Evaluation of a real-time multiplex PCR for the simultaneous detection of Campylobacter jejuni, Salmonella spp., Shigella spp./EIEC, and Yersinia enterocolitica in fecal samples.</a> Eur Journal of Clinical Microbiology Infect Dis. 34 (3), 535-542 (2015).</li><li>Kamkamidze, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+Identification+Of+The+Etiological+Factors+Causing+Diarrheal+Diseases.">Rapid Identification Of The Etiological Factors Causing Diarrheal Diseases.</a> Georgian Medical News. (258), 89-92 (2016).</li><li>Li, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+and+Application+of+a+Visual+DNA+Microarray+for+the+Detection+of+Food-borne+Pathogens.">Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.</a> Analytical Sciences. 32 (2), 215-218 (2016).</li><li>Zhuang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Salmonella+spp.+by+a+loop-mediated+isothermal+amplification+(LAMP)+method+targeting+bcfD+gene.">Detection of Salmonella spp. by a loop-mediated isothermal amplification (LAMP) method targeting bcfD gene.</a> Letters in Applied Microbiology. 59 (6), 658-664 (2014).</li><li>Shi, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+simultaneous+detection+of+Salmonella+and+Shigella+using+modified+molecular+beacons+and+real-time+PCR.">Rapid simultaneous detection of Salmonella and Shigella using modified molecular beacons and real-time PCR.</a> Zhonghua Liu Xing Bing Xue Za Zhi. 27 (12), 1053-1056 (2006).</li><li>Mo, Q. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+a+96-microwell+plate+DNA+diagnostic+chip+for+detection+of+foodborne+bacteria+and+its+application+in+an+incident+of+food+poisoning.">Preparation of a 96-microwell plate DNA diagnostic chip for detection of foodborne bacteria and its application in an incident of food poisoning.</a> Nan Fang Yi Ke Da Xue Xue Bao. 30 (3), 417-421 (2010).</li><li>Wang, H. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probe-free+and+sensitive+detection+of+diarrhea-causing+pathogens+using+RT-PCR+combined+high+resolution+melting+analysis.">Probe-free and sensitive detection of diarrhea-causing pathogens using RT-PCR combined high resolution melting analysis.</a> Biologicals. 44 (5), 360-366 (2016).</li><li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+simultaneous+screening+of+seven+clinically+important+enteric+pathogens+using+a+magnetic+bead+based+DNA+microarray.">Rapid simultaneous screening of seven clinically important enteric pathogens using a magnetic bead based DNA microarray.</a> World Journal of Microbiology and Biotechnology. 27 (1), 163-169 (2011).</li><li>Qi, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+assay+for+rapid+detection+of+five+important+pathogenic+vibrios.">Multiplex PCR assay for rapid detection of five important pathogenic vibrios.</a> Chinese Journal of health laboratory technology. (24), 3497-3500 (2014).</li><li>Blanco, G., Diaz de Tuesta, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture-+and+molecular-based+detection+of+swine-adapted+Salmonella+shed+by+avian+scavengers.">Culture- and molecular-based detection of swine-adapted Salmonella shed by avian scavengers.</a> Science of the Total Environment. 634, 1513-1518 (2018).</li><li>Tang, X. J., Yang, Z., Chen, X. B., Tian, W. F., Tu, C. N., Wang, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Verification+and+large+scale+clinical+evaluation+of+a+national+standard+protocol+for+Salmonella.spp./Shigella.spp.+screening+using+real-time+PCR+combined+with+guided+culture.">Verification and large scale clinical evaluation of a national standard protocol for Salmonella.spp./Shigella.spp. screening using real-time PCR combined with guided culture.</a> Journal of Microbiological Methods. 145, 14-19 (2018).</li><li>Dekker, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drinking+water+from+dug+wells+in+rural+ghana--salmonella+contamination,+environmental+factors,+and+genotypes.">Drinking water from dug wells in rural ghana--salmonella contamination, environmental factors, and genotypes.</a> International Journal of Environmental Research and Public Health. 12 (4), 3535-3546 (2015).</li><li>Gargano, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mortality+from+selected+diseases+that+can+be+transmitted+by+water+-+United+States,+2003-2009.">Mortality from selected diseases that can be transmitted by water - United States, 2003-2009.</a> Journal of Water and Health. 15 (3), 438-450 (2017).</li><li>Kumar, R., Surendran, P. K., Thampuran, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+culture,+ELISA+and+PCR+assays+for+the+detection+of+Salmonella+in+seafood.">Evaluation of culture, ELISA and PCR assays for the detection of Salmonella in seafood.</a> Letters in Applied Microbiology. 46 (2), 221-226 (2008).</li><li>Herrera-Leon, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blind+comparison+of+traditional+serotyping+with+three+multiplex+PCRs+for+the+identification+of+Salmonella+serotypes.">Blind comparison of traditional serotyping with three multiplex PCRs for the identification of Salmonella serotypes.</a> Research in Microbiology. 158 (2), 122-127 (2007).</li><li>Cunningham, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-hour+molecular+detection+of+Campylobacter,+Salmonella,+Yersinia,+and+Shigella+species+in+feces+with+accuracy+as+high+as+that+of+culture.">Three-hour molecular detection of Campylobacter, Salmonella, Yersinia, and Shigella species in feces with accuracy as high as that of culture.</a> Journal of Clinical Microbiology. 48 (8), 2929-2933 (2010).</li><li>Eriksson, E., Aspan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+culture,+ELISA+and+PCR+techniques+for+salmonella+detection+in+faecal+samples+for+cattle,+pig+and+poultry.">Comparison of culture, ELISA and PCR techniques for salmonella detection in faecal samples for cattle, pig and poultry.</a> BMC Veterinary Research. 3, 21 (2007).</li><li>Dutta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitivity+and+performance+characteristics+of+a+direct+PCR+with+stool+samples+in+comparison+to+conventional+techniques+for+diagnosis+of+Shigella+and+enteroinvasive+Escherichia+coli+infection+in+children+with+acute+diarrhoea+in+Calcutta,+India.">Sensitivity and performance characteristics of a direct PCR with stool samples in comparison to conventional techniques for diagnosis of Shigella and enteroinvasive Escherichia coli infection in children with acute diarrhoea in Calcutta, India.</a> Journal of Medical Microbiology. 50 (8), 667-674 (2001).</li></ol>

The authors have nothing to disclose.

Since Salmonella spp./Shigella spp. are often associated with food poisoning and fecal-oral transmission of acute gastroenteritis28,29 and the routine method is either labor-intensive or time-consuming7, we describe a high-throughput platform for the Salmonella spp./Shigella spp. screening, using real-time PCR combined with guided culture.
There are several steps that need consideration to maximize the capability of this platform. The first one is the pre-enrichment step of samples in Nutrient Broth (step 2.2). Though no pre-enrichment step is needed for stool samples collected from those patients with obvious symptoms, such as diarrhea, etc., a general 6 h pre-enrichment step is still needed for anal swab samples, when collected during the pre-employment physical examination for people who would handle food and water, as those people were mainly healthy or at least asymptomatic adults. If the protocol was only applied for the detection of Salmonella spp., then pre-enrichment could be conducted in Selenite Cystine medium in order to increase the sensitivity. The second critical step is the identification of suspicious colonies (step 3.1.3.1 and 3.2.2.1). There are many interfering background flora in the stool samples that may mask the detection and isolation of target pathogens30. Therefore, the characteristic of the suspicious colonies as defined in step 3.1.3.1 and 3.2.2.1 should be kept in mind during the experiment. The third critical step is the serological characterization of Salmonella spp. As a majority of Salmonella spp. contain a second phase for H antigen31, serum induction needs to be performed. However, the serum induction is not always successful, and several rounds of induction may be needed to determine the correct second H phase.
The protocol is highly specific and sensitive as verified by our previous study27. The high specificity of the protocol is demonstrated by its ability, in which Salmonella spp./Shigella spp. could be distinguished from other related pathogens27. The lower limit of detection of the protocol is 104 CFU/mL and 103 CFU/mL for Salmonella spp. and Shigella spp., respectively27, which are comparable to previous reports7,32,33,34. As we stated above, the sensitivity of Salmonella spp. detection could be further increased by Selenite Cystine pre-enrichment if the protocol was only applied for the detection of Salmonella spp. Moreover, the protocol could increase the positive rate by two folds and decrease the workload/median turnaround time significantly27.
Similar to other NAAT assays, one major limitation of the protocol, when compared to classic bacteria culture method, is that the protocol could only identify Salmonella spp./Shigella spp., while other common diarrhea-causing bacteria are omitted7. In contrast, during classic bacteria culture, those bacteria could be identified in parallel if they existed. Another limitation of the protocol is that some of Salmonella spp./Shigella spp. could not be identified by the real-time PCR due to sequence variations27. However, if negative real-time PCR results appear for those samples from patients with obvious clinical symptoms, laboratory technicians should pay attention and may conduct other experiments to confirm the results. During a large outbreak, we may use a single sample instead of pooled samples for the first round of PCR screening.
In conclusion, the protocol provided here could serve as a valuable platform for the screening of Salmonella spp./Shigella spp.

Diarrhea is still a common health issue with a high incidence rate globally1,2. Though the mortality is relatively low, some patients show various symptoms for weeks (such as loose and watery stools, an urgency to go to the bathroom), which make the socioeconomic impact very high3,4. More seriously, some patients may even develop irritable bowel syndrome if left untreated5. There are various kinds of bacteria, viruses and parasites that can cause diarrhea6. Salmonella spp./Shigella spp. are among the most common bacteria for the transmission of acute gastroenteritis7,8,9,10,11. Therefore, many counties have issued laws or regulations for regular Salmonella spp./Shigella spp. screening among people who would handle food and water. For example, the Chinese government have issued laws for obligatory Salmonella spp./Shigella spp. screening once a year.
The gold standard method for Salmonella spp./Shigella spp. detection is bacteria culture. Through bacteria culture and successive biochemical identification and serological characterization, we can identify the species of bacteria, which could facilitate disease outbreak management and antimicrobial profiling to aid the treatment of patients12. It could also help trace the source of infection during the Salmonella spp./Shigella spp. outbreak13. However, this method is labor-intensive (requiring manual operation) and time-consuming (taking several days), especially for the testing of large numbers of samples7. Moreover, viable but non-culturable (VBNC) Salmonella spp./Shigella spp.may exist in some stool samples14. In view of these drawbacks, many laboratories have tried to develop new techniques for the detection of Salmonella spp./Shigella spp.15,16,17,18,19,20,21,22,23,24,25. All these methods use the nuclear acid amplification test (NAAT), among which the polymerase chain reaction (PCR) is the most common. One major limitation of these NAAT based methods is that dead bacteria, even bacterial debris containing incomplete genomic DNA, could show positive results26, which could largely influence the accurate diagnosis of disease. Blanco et al. showed that molecular assay is highly sensitive, not only to viable Salmonella in cultures, but also to partial genomes and dead or unviable bacteria from past infections or contamination26. Therefore, new technology should be developed.
Here, we described a novel method that combines the NAAT based method and culturing. As shown in Figure 1, this new method applies real-time PCR screening first and then positive samples are sent for bacteria culture and identification.

<table border="0" cellpadding="0" cellspacing="0" style="width:732px;" width="732">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Tris</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:119px;">10708976001</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">EDTA</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:119px;">798681</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">NP40</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:119px;">11332473001</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:249px;">ddH2O</td>
			<td style="width:112px;">Takara</td>
			<td style="width:119px;">9012</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">PrimeSTAR HS (Premix)</td>
			<td style="width:112px;">Takara</td>
			<td style="width:119px;">R040Q</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Nutrient Broth</td>
			<td style="width:112px;">LandBridge</td>
			<td style="width:119px;">CM106</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Nutrient agar</td>
			<td style="width:112px;">LandBridge</td>
			<td style="width:119px;">CM107</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Selenite Cystine medium</td>
			<td style="width:112px;">LandBridge</td>
			<td style="width:119px;">CM225</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">XLD</td>
			<td style="width:112px;">LandBridge</td>
			<td style="width:119px;">CM219</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">MAC&#160;</td>
			<td style="width:112px;">LandBridge</td>
			<td style="width:119px;">CM908</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Salmonella chromogenic agar</td>
			<td style="width:112px;">CHROMagar</td>
			<td style="width:119px;">SA130</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Salmonella diagnostic serum</td>
			<td style="width:112px;">Tianrun</td>
			<td style="width:119px;">SAL60</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Shigella diagnostic serum</td>
			<td style="width:112px;">Tianrun</td>
			<td style="width:119px;">SHI54</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">anal swab (collecting tube plus)</td>
			<td style="width:112px;">Huachenyang</td>
			<td style="width:119px;"></td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">slide</td>
			<td style="width:112px;">Mingsheng</td>
			<td style="width:119px;">7102</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">micro-loop</td>
			<td style="width:112px;">Weierkang</td>
			<td style="width:119px;">W511</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">incubator</td>
			<td style="width:112px;">Jinghong</td>
			<td style="width:119px;">DNP-9082</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">autoclave</td>
			<td style="width:112px;">AUL</td>
			<td style="width:119px;">SS-325</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">dry bath</td>
			<td style="width:112px;">Jinghong</td>
			<td style="width:119px;">KB-20</td>
			<td style="width:252px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:249px;">automated microbial identification system</td>
			<td style="width:112px;">bioM&#233;rieux</td>
			<td style="width:119px;">VITEK2</td>
			<td style="width:252px;">other equivalent system could be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:249px;">fluorescent real-time PCR machine</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:119px;">ABI7500</td>
			<td style="width:252px;">other equivalent machine could be used</td>
		</tr>
	</tbody>
</table>

a high-throughput platform for the screening of salmonella spp./shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

The protocol was applied for the screening of Salmonella spp./Shigella spp. in anal stool samples from people who would handle food and water.
In the real-time PCR step, as shown in Figure 5A, there was a successful amplification in HEX channel, which meant that the mixed sample was positive for Salmonella spp. Then a further real-time PCR was conducted on individual samples which made up the positive one. As shown in Figure 5B, sample 2 was positive. Therefore, sample 2 was chosen for the guided culture of Salmonella spp. In Figure 5C, there was a successful amplification in the FAM channel, which meant that the mixed sample was positive for Shigella spp. Then a further real-time PCR was conducted and sample 10 was found to be positive (Figure 5D). Therefore, sample 10 was chosen for the guided culture of Shigella spp.
In the guided culture of Salmonella spp., there were pink colonies and purple colonies on XLD plate and Salmonella chromogenic agar plate, separately, as shown in Figure 2. Then these colonies were subjected to biochemical identification on automated microbial identification system. Results showed that it was Salmonella spp., with species unknown. Therefore, serological characterization was performed (Figure 3) and it was reactive to O4, O12, Hb, H1,2. According to the White-Kauffmann-Le Minor scheme, sample 2 was finally reported as positive for Salmonella paratyphi B. While for the guided culture of Shigella spp., there were pink red and colorless colonies on XLD plate and MAC plate, separately, as shown in Figure 4. Then these colonies were also subjected to biochemical identification on automated microbial identification system. Results showed that it was Shigella sonnei. To confirm its specific serotype, serological characterization was performed (Figure 3) and it was reactive to sonnei phase II. Therefore, sample 10 was finally reported as positive for Shigella sonnei phase II.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58200/58200fig1.jpg" /> 
Figure 1: The diagram of the protocol. Two major steps were shown and separated by dash line. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58200/58200fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58200/58200fig2.jpg" /> 
Figure 2: Representative culture results of Salmonella spp. on XLD plate and Salmonella chromogenic agar plate. On XLD plate, there were pink colonies with/without dark heart, while on Salmonella chromogenic agar plate, there were purple colonies. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58200/58200fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58200/58200fig3.jpg" /> 
Figure 3: Representative serological characterization result. If the colony was reactive to the sera, it looked like flowing sand (left). Otherwise, it was turbid (right). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58200/58200fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58200/58200fig4.jpg" /> 
Figure 4: Representative culture results of Shigella spp. on XLD plate and MAC plate. On XLD plate, there were red colonies, while on MAC plate, there were transparent and colorless colonies. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58200/58200fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58200/58200fig5.jpg" /> 
Figure 5: Representative real-time PCR results.&#160;(A)&#160;HEX channel for mix samples. (B)&#160;HEX channel for individual samples. (C)&#160;FAM channel for mix samples. (D)&#160;FAM channel for individual samples. PC: positive control. NC: negative control. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58200/58200fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Pathogen</td>
			<td>Name</td>
			<td>Sequence(5&#39;-3&#39;)</td>
		</tr>
		<tr>
			<td>Salmonella</td>
			<td>Sal-F 
			Sal-R 
			Sal-probe</td>
			<td>gctcatattaattccggcatttac 
			caggtcaatagccagaaagg 
			HEX-ataagtaatccaatccgaaatgcctgcgt-Eclipse</td>
		</tr>
		<tr>
			<td>Shigella</td>
			<td>Shi-F 
			Shi-R 
			Shi-probe</td>
			<td>ccgggataaagtcagaactc 
			cagtggagagctgaagtttc 
			FAM-aggccaggtagacttctatctcatccac-Eclipse</td>
		</tr>
	</tbody>
</table>
Table 1: Primers and probes used. The name and sequences of the primers and probes were provided.

Watch this Scientific Journal Video about A High-throughput Platform for the Screening of Salmonella spp./Shigella spp. at JoVE.com

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

a-high-throughput-platform-for-screening-salmonella-sppshigella

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.8K Views.  Zhuhai International Travel Healthcare Center. Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Video: A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying Salmonella-host interactions are&#160;important to elucidate the molecular pathogenesis of Salmonella infection. The Gentamicin protection assay to phenotype Salmonella association, invasion and replication in phagocytic cells was adapted to allow high-throughput screening to define the roles of deletion mutants of Salmonella enterica serotype Typhimurium in host interactions using RAW 264.7 murine macrophages. Under this protocol, the variance in measurements is significantly reduced compared to the standard protocol, because wild-type and multiple mutant strains can be tested in the same culture dish and at the same time. The use of multichannel pipettes increases the throughput and enhances precision. Furthermore, concerns related to using less host cells per well in 96-well culture dish were addressed. Here, the protocol of the modified in vitro Salmonella invasion assay using phagocytic cells was successfully employed to phenotype 38 individual Salmonella deletion mutants for association, invasion and intracellular replication. The in vitro phenotypes are presented, some of which were subsequently confirmed to have in vivo phenotypes in an animal model. Thus, the modified, standardized assay to phenotype Salmonella association, invasion and replication in macrophages with high-throughput capacity could be utilized more broadly to study bacterial-host interactions.

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

A high-throughput assay to in vitro phenotype Salmonella or other bacterial association, invasion, and replication in phagocytic cells with high-throughput capacity was developed. The method was employed to evaluate Salmonella gene knockout mutant strains for their involvements in host-pathogen interactions.

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying ...

Establishment of a High-throughput Setup for Screening Small Molecules That Modulate c-di-GMP Signaling in Pseudomonas aeruginosa

Bacterial resistance to traditional antibiotics has driven research attempts to identify new drug targets in recently discovered regulatory pathways. Regulatory systems that utilize intracellular cyclic di-GMP (c-di-GMP) as a second messenger are one such class of target. c-di-GMP is a signaling molecule found in almost all bacteria that acts to regulate an extensive range of processes including antibiotic resistance, biofilm formation and virulence. The understanding of how c-di-GMP signaling controls aspects of antibiotic resistant biofilm development has suggested approaches whereby alteration of the cellular concentrations of the nucleotide or disruption of these signaling pathways may lead to reduced biofilm formation or increased susceptibility of the biofilms to antibiotics. We describe a simple high-throughput bioreporter protocol, based on green fluorescent protein (GFP), whose expression is under the control of the c-di-GMP responsive promoter cdrA, to rapidly screen for small molecules with the potential to modulate c-di-GMP cellular levels in Pseudomonas aeruginosa (P. aeruginosa). This simple protocol can screen upwards of 3,500 compounds within 48 hours and has the ability to be adapted to multiple microorganisms.

Establishment of a High-throughput Setup for Screening Small Molecules That Modulate c-di-GMP Signaling in Pseudomonas aeruginosa

This article describes the high-throughput assay that has been successfully established to screen large libraries of small molecules for their potential ability to manipulate cellular levels of cyclic di-GMP in Pseudomonas aeruginosa, providing a new powerful tool for antibacterial drug discovery and compound testing.

Bacterial resistance to traditional antibiotics has driven research attempts to identify new drug targets in recently discovered regulatory pathways. ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or cellular processes. With the advancement of biotechnologies and the high translational potential of small molecules, a number of innovative approaches in drug discovery have evolved, which explains the resurgent interest in the use of HTS. The oncology field is currently the most active research area for drug screening, with no major breakthrough made for the identification of new immunomodulatory compounds targeting transplantation-related complications or autoimmune ailments. Here, we present a novel in vitro murine fluorescent-based lymphocyte assay easily adapted for the identification of new immunomodulatory compounds. This assay uses T or B cells derived from a transgenic mouse, in which the Nur77 promoter drives GFP expression upon T- or B-cell receptor stimulation. As the GFP intensity reflects the activation/transcriptional activity of the target cell, our assay defines a novel tool to study the effect of given compound(s) on cellular/biological responses. For instance, a primary screening was performed using 4,398 compounds in the absence of a &#34;target hypothesis&#34;, which led to the identification of 160 potential hits displaying immunomodulatory activities. Thus, the use of this assay is suitable for drug discovery programs exploring large chemical libraries prior to further in vitro/in vivo validation studies.

We present in the current study a novel fluorescence-based assay using lymphocytes derived from a transgenic mouse. This assay is suitable for high-throughput screening (HTS) of small molecules endowed with the capacity of either inhibiting or promoting lymphocyte activation.

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Building Up a High-throughput Screening Platform to Assess the Heterogeneity of HER2 Gene Amplification in Breast Cancers

Targeted therapies against the human epidermal growth factor receptor 2 (HER2) have radically changed the outcome of patients with HER2-positive breast cancers. However, a minority of cases displays a heterogeneous distribution of HER2-positive cells, which generates major clinical challenges. To date, no reliable and standardized protocols for the characterization and quantification of HER2 heterogeneous gene amplification in large cohorts have been proposed. Here, we present a high-throughput methodology to simultaneously assess the HER2 status across different topographic areas of multiple breast cancers. In particular, we illustrate the laboratory procedure to construct enhanced tissue microarrays (TMAs) incorporating a targeted mapping of the tumors. All TMA parameters have been specifically optimized for the silver in situ hybridization (SISH) of formalin-fixed paraffin-embedded (FFPE) breast tissues. Immunohistochemical analysis of the prognostic and predictive biomarkers (i.e., ER, PR, Ki67, and HER2) should be performed using automated procedures. A customized SISH protocol has been implemented to allow a high-quality molecular analysis across multiple tissues that underwent different fixation, processing, and storage procedures. In this study, we provide a proof-of-principle that specific DNA sequences could be localized simultaneously in distinct topographic areas of multiple and heterogeneously processed breast cancers using an efficient and cost-effective method.

Heterogeneous distribution of HER2-positive cells can be observed in a subset of breast cancers and generates clinical dilemmas. Here, we introduce a reliable and cost-effective protocol to define, quantify, and compare HER2 intra-tumor genetic heterogeneity in a large series of heterogeneously processed breast cancers.

Targeted therapies against the human epidermal growth factor receptor 2 (HER2) have radically changed the outcome of patients with HER2-positive breast ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

Automated Behavioral Analysis of Large C. elegans Populations Using a Wide Field-of-view Tracking Platform

Caenorhabditis elegans is a well-established animal model in biomedical research, widely employed in functional genomics and ageing studies. To assess the health and fitness of the animals under study, one typically relies on motility readouts, such as the measurement of the number of body bends or the speed of movement. These measurements usually involve manual counting, making it challenging to obtain good statistical significance, as time and labor constraints often limit the number of animals in each experiment to 25 or less. Since high statistical power is necessary to obtain reproducible results and limit false positive and negative results when weak phenotypic effects are investigated, efforts have recently been made to develop automated protocols focused on increasing the sensitivity of motility detection and multi-parametric behavioral profiling. In order to extend the limit of detection to the level needed to capture the small phenotypic changes that are often crucial in genetic studies and drug discovery, we describe here a technological development that enables the study of up to 5,000 individual animals simultaneously, increasing the statistical power of the measurements by about 1,000-fold compared to manual assays and about 100-fold compared to other available automated methods.

Automated Behavioral Analysis of Large C. elegans Populations Using a Wide Field-of-view Tracking Platform

We describe protocols for using the wide field-of-view nematode tracking platform (WF-NTP), which enables high-throughput phenotypic characterization of large populations of Caenorhabditis elegans. These protocols can be used to characterize subtle behavioral changes in mutant strains or in response to pharmacological treatment in a highly scalable fashion.

Caenorhabditis elegans is a well-established animal model in biomedical research, widely employed in functional genomics and ageing studies. To assess the ...

High Throughput Co-culture Assays for the Investigation of Microbial Interactions

The study of interactions between microorganisms has led to numerous discoveries, from novel antimicrobials to insights in microbial ecology. Many approaches used for the study of microbial interactions require specialized equipment and are expensive and time intensive. This paper presents a protocol for co-culture interaction assays that are inexpensive, scalable to large sample numbers, and easily adaptable to numerous experimental designs. Microorganisms are cultured together, with each well representing one pairwise combination of microorganisms. A test organism is cultured on one side of each well and first incubated in monoculture. Subsequently, target organisms are simultaneously inoculated onto the opposite side of each well using a 3D-printed inoculation stamp. After co-culture, the completed assays are scored for visual phenotypes, such as growth or inhibition. These assays can be used to confirm phenotypes or identify patterns among isolates of interest. Using this simple and effective method, users can analyze combinations of microorganisms rapidly and efficiently. This co-culture approach is applicable to antibiotic discovery as well as culture-based microbiome research and has already been successfully applied to both applications.

The co-culture interaction assays presented in this protocol are inexpensive, high throughput, and simple. These assays can be used to observe microbial interactions in co-culture, identify interaction patterns, and characterize the inhibitory potential of a microbial strain of interest against human and environmental pathogens.