This work was supported by NIH grant 1SC2GM092789-01A1, and MS was a research scholar of NMSU Howard Hughes Medical Institution Undergraduate Research Programs. The video was directed and produced by Amy Lanasa and coordinated by Dr. Philip Lewis with the Creative Media Institute at NMSU.

Procedure
1. Mosquito Rearing
<ol>
 <li>Rear mosquito Anopheles gambiae G3 strain in an insectary at 27.5 &deg;C with 80% humidity and 12:12 hr cycle of light/dark. </li>
 <li>Feed larvae with ground cat food with brewer's yeast at ratio 1:1. </li>
 <li>Feed adult mosquitoes on mice blood at day 3 post-emergence for egg production. </li>
</ol>
2. Mosquito Gut Dissection 
<ol>
 <li>Autoclave dissection tools (slides and forceps). </li>
 <li>Collect 50 mosquitoes using an aspirator and place them on CO2 flow bed (Ultimate Flypad). Rinse a mosquito specimen sequentially in three Petri dishes containing 70% ethanol to clean the mosquito body surface. </li>
 <li>Place the specimen on a glass slide under a stereomicroscopy. Remove the gut. </li>
 <li>Collect 50 guts per condition for metagenomic DNA isolation. Collect 50 guts per condition for metagenomic RNA isolation. </li>
</ol>
3. Metagenomic DNA Isolation 
Note: Metagenomic DNA is isolated using the Meta-G-Nome DNA Isolation Kit (Epicentre Biotechnologies) with the modification described below.
<ol>
 <li>Place 50 mosquito guts in 300 &mu;l TE. Homogenize them for 1 min using Bio-Gen PRO200 homogenizer (PRO Scientific Inc, USA) at speed 2,000 rpm on ice. </li>
 <li>Add 2 &mu;l of Ready-Lyse Lysozyme Solution and 1 &mu;l of RNase A to the cell suspension. Mix by vortexing and incubate at 37 &deg;C for 30 min. </li>
 <li>Add 300 &mu;l of Meta-Lysis Solution (2X) and 1 &mu;l of Proteinase K to the tube. Mix by vortexing. Briefly pulse-centrifuge the tube to ensure that all of the solution is in the bottom of the tube, and incubate at 65 &deg;C for 15 min, cool to room temperature, then place on ice for 3-5 min. </li>
 <li>Add 350 &mu;l of MPC Protein Precipitation Reagent to the tube and mix by vortexing vigorously for 10 sec. </li>
 <li>Pellet the debris by centrifugation for 10 min at 12,000 x g at 4 &deg;C.</li>
 <li>Transfer the supernatant to a clean 2-ml tube, and discard the pellet. </li>
 <li>Add 570 &mu;l of isopropanol to the supernatant. Mix by inverting the tube several times. </li>
 <li>Pellet the DNA by centrifugation for 10 min at 12,000 x g at 4 &deg;C. Remove the isopropanol without dislodging the DNA pellet. </li>
 <li>Add 500 &mu;l of 75% ethanol to wash the pellet. Centrifuge for 5 min at 12,000 x g at 4 &deg;C. Remove the ethanol without disturbing the DNA pellet. Air-dry the pellet at room temperature for 2 min. Note: Do not over-dry the DNA pellet.</li>
 <li>Resuspend the DNA pellet in 50 &mu;l of TE Buffer. </li>
 <li>Validate the size of the isolated DNA by comparison to the Fosmid Control DNA (40 kb; 100 ng/&mu;l) provided in the kit, via gel electrophoresis on a 1% agarose gel. </li>
</ol>
4. Total RNA Isolation
Note: Clean the working area with RNaseZap to minimize RNase contamination. Metagenomic RNA was isolated from mosquito gut specimens using the TriPure Isolation Reagent (Roche) with a minor modification.
<ol>
 <li>Put 50 mosquito guts in a 2-ml tube with 500 &mu;l TriPure Isolation Reagent. Homogenize for 1 min at speed 2,000 rpm on ice using a homogenizer. Let sit at RT for 5 min to allow dissociation of nucleoprotein complexes. </li>
 <li>Add 100 &mu;l chloroform and vortex for 12 sec, and let sit at RT for 2 min. </li>
 <li>Centrifuge at 10,000 x g for 10 min. Carefully take out the tube without disturbing separated phases. </li>
 <li>Transfer aqueous phase to a new tube, add 250 &mu;l isopropanol, mix well, and put at -20 &deg;C for 20 min. </li>
 <li>Centrifuge at 12,000 x g for 10 min at 4 &deg;C to precipitate RNA. </li>
 <li>Discard the supernatant without dislodging pellet. Wash the pellet with 750 &mu;l 75% ethanol. </li>
 <li>Pipette off the supernatant without disturbing the pellet. Air dry the tube for 2 min. </li>
 <li>Resuspend the RNA with 30 &mu;l nuclease free water. </li>
 <li>Treat the total RNA with DNase at 37 &deg;C for 20 min, and then inactivate the DNase by incubating at 75 &deg;C for 15 min. Precipitate RNA with ethanol and resuspend RNA in 30 &mu;l nuclease free water. </li>
 <li>Determine the quantity of total RNA using a NanoDrop. </li>
</ol>
5. Ribosomal RNA Depletion 
Note: The protocol was developed based on previously described methods12,13,15. 
<ol>
 <li>PCR amplification of ribosomal RNA gene fragments 
This step creates sample-specific rRNA pools, which will be used as templates for in vitro transcription to produce anti-sense ribosomal RNA (arRNA) probes that are complimentary to rRNA in the total RNA sample.
 <ol>
 <li>Design and synthesize primer sets for rRNA fragment PCR (Table 1). </li>
 <li>Run PCR in 50 &mu;l reaction using Taq DNA polymerase (Qiagen) with 50 ng DNA template, 1 x PCR buffer, 1.5mM Mg2Cl, 0.2 &mu;M primers with 35 cycles of denaturing at 94 &deg;C for 10 sec, annealing 15 sec at 40 &deg;C for bacterial 23S amplicon, and 50 &deg;C for the other amplicons, and extending at 72 &deg;C for 1 min (final extension at 72 &deg;C for 5 min).</li>
 <li>View PCR products on 1% agarose gel. </li>
 <li>Purify PCR products using the QIAquick PCR purification kit with elution in 50 &mu;l elution buffer. Quantify the concentration using NanoDrop. </li>
 </ol>
 </li>
 <li>In vitro transcription of biotin-labeled anti-sense rRNA probes (arRNA). 
 Note: In this step, sample specific probes from various rRNA amplicons are synthesized using the MEGAscript T7 kit. 
 <ol>
 <li>Set up a 20 &mu;l reaction for each sample specific rRNA amplicon by mixing the below ingredients (Table 2). Incubate overnight at 37 &deg;C. Note: usually the reaction yields &gt;50 &mu;g RNA. </li>
 <li>Add 1 &mu;l DNase I (included in the kit) to the reaction and incubate at 37 &deg;C for 20 min to remove the DNA template. </li>
 <li>Add 100 &mu;l 100% ethanol to the reaction, centrifuge at 12,000 x g for 10 min at 4 &deg;C to precipitate synthesized arRNA. Discard supernatant and wash the pellet with 750 &mu;l 75% ethanol. Resuspend RNA probes in 50 &mu;l nuclease free water.</li>
 <li>Quantify RNA concentration using a NanoDrop. Store probes at -80 &deg;C. </li>
 </ol>
 </li>
 <li>rRNA subtraction with biotinylated arRNA.
 Note: This step employs the biotinylated arRNA to hybridize to rRNA in the total RNA sample. The rRNA-arRNA hybrids are captured by streptavidin-coated magnetic beads. The procedure is based on the protocol described in reference 13 with minor modification. 
 <ol>
 <li>Reagents 
 <ol>
 <li>Prepare 0.1 N NaOH, 20X sodium chloride-citrate (SSC) and 1 X SSC with 20% formamide. </li>
 </ol>
 </li>
 <li>Hybridization 
 <ol>
 <li>Mix 1 &mu;g total RNA with bacterial 16S and 23S probes (0.75 &mu;g each), mosquito 18S and 28S probes (0.75 &mu;g each), 1 &mu;l RNase inhibitor, 2.5 &mu;l 20X SSC buffer, 10 &mu;l 100% formamide in a 200 &mu;l PCR tube, add nuclease-free water to 50 &mu;l. </li>
 <li>Place the reaction tube in a thermal cycler and incubate at 70 &deg;C for 5 minutes to open secondary structure and ramp down to 25 &deg;C using 5 &deg;C increments for 1 min each &deg;C to allow the hybridization of rRNA and arRNA probes. </li>
 </ol>
 </li>
 <li>Removal of rRNA 
 <ol>
 <li>Transfer 300 &mu;l streptavidin coated beads into a 1.7 ml tube. Place the tube on a magnetic separation rack to immobilize the beads. Remove supernatant. Resuspend the beads in 300 &mu;l of 0.1N NaOH and mix well. Place the tube back to the magnetic rack and pipette off the supernatant. Resuspend the beads in 300 &mu;l of 1X SSC, mix well, immobilize the beads and pipette off the supernatant. Repeat the wash with 300 &mu;l of 1X SSC one more time. </li>
 <li>Make 3 aliquots of beads, 100 &mu;l each, in 1.7 ml tubes. Place the tube on the magnetic rack, and remove the supernatant by pipetting. Note: The aliquots of beads are used for 3 rounds of capturing biotinylated rRNA-arRNA hybrids. </li>
 <li>Add 50 &mu;l 1X SSC with 20% formamide into the 50 &mu;l hybridization reaction. Transfer the reaction into the first bead aliquot tube, and mix well. Incubate at RT for 10 min to allow the biotinylated probe-rRNA hybrids to be captured by streptavidin beads. Flick the tube every 2 minutes to mix during the incubation. </li>
 <li>Place the tube on the magnetic rack to immobilize the beads, transfer the supernatant to the second aliquot of beads, mix well and incubate as above. Conduct the third capture by transferring supernatant into the third tube of beads. Mix and incubate. </li>
 <li>Transfer non-rRNA supernatant into a new tube and conduct purification using RNeasy MinElute kit to remove formamide following the manufacturer's manual. </li>
 <li>Check the rRNA depletion efficiency by using an Agilent RNA 6000 Pico chip kit on a Bioanalyzer (Figure 4). </li>
 </ol>
 </li>
 </ol>
 </li>
</ol>
Note: The rRNA depleted RNA samples are subject to mRNA amplification if necessary8.

<ol>
	<li>Wang, Z., Gerstein, M., Snyder, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq:+a+revolutionary+tool+for+transcriptomics.">RNA-Seq: a revolutionary tool for transcriptomics.</a> Nat. Rev. Genet. 10, 57-63 (2009).</li><li>Xie, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrosequencing+the+Bemisia+tabaci+Transcriptome+Reveals+a+Highly+Diverse+Bacterial+Community+and+a+Robust+System+for+Insecticide+Resistance.">Pyrosequencing the Bemisia tabaci Transcriptome Reveals a Highly Diverse Bacterial Community and a Robust System for Insecticide Resistance.</a> PLoS One. 7, e35181 (2012).</li><li>Xie, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+the+metatranscriptome+of+the+protistan+community+in+Coptotermes+formosanus+with+emphasis+on+the+lignocellulolytic+system.">Profiling the metatranscriptome of the protistan community in Coptotermes formosanus with emphasis on the lignocellulolytic system.</a> Genomics. 99, 246-255 (2012).</li><li>Gosalbes, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metatranscriptomic+approach+to+analyze+the+functional+human+gut+microbiota.">Metatranscriptomic approach to analyze the functional human gut microbiota.</a> PLoS One. 6, e17447 (2011).</li><li>Urich, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+assessment+of+soil+microbial+community+structure+and+function+through+analysis+of+the+meta-transcriptome.">Simultaneous assessment of soil microbial community structure and function through analysis of the meta-transcriptome.</a> PLoS One. 3, e2527 (2008).</li><li>Gilbert, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+large+numbers+of+novel+sequences+in+the+metatranscriptomes+of+complex+marine+microbial+communities.">Detection of large numbers of novel sequences in the metatranscriptomes of complex marine microbial communities.</a> PLoS One. 3, e3042 (2008).</li><li>Gifford, S. M., Sharma, S., Rinta-Kanto, J. M., Moran, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+a+deeply+sequenced+marine+microbial+metatranscriptome.">Quantitative analysis of a deeply sequenced marine microbial metatranscriptome.</a> ISME J. 5, 461-472 (2011).</li><li>Poretsky, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+day/night+metatranscriptomic+analysis+of+microbial+communities+in+the+North+Pacific+subtropical+gyre.">Comparative day/night metatranscriptomic analysis of microbial communities in the North Pacific subtropical gyre.</a> Environmental microbiology. 11, 1358-1375 (2009).</li><li>Shrestha, P. M., Kube, M., Reinhardt, R., Liesack, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+activity+of+paddy+soil+bacterial+communities.">Transcriptional activity of paddy soil bacterial communities.</a> Environmental Microbiology. 11, 960-970 (2009).</li><li>Mettel, C., Kim, Y., Shrestha, P. M., Liesack, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+mRNA+from+soil.">Extraction of mRNA from soil.</a> Applied and Environmental Microbiology. 76, 5995-6000 (2010).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+two+ribosomal+RNA+removal+methods+for+microbial+metatranscriptomics.">Validation of two ribosomal RNA removal methods for microbial metatranscriptomics.</a> Nat. Meth. 7, 807-812 (2010).</li><li>Pang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+mRNA+purification+by+magnetic+capture-hybridization+method.">Bacterial mRNA purification by magnetic capture-hybridization method.</a> Microbiol. Immunol. 48, 91-96 (2004).</li><li>Stewart, F. J., Ottesen, E. A., DeLong, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+quantitative+analyses+of+a+universal+rRNA-subtraction+protocol+for+microbial+metatranscriptomics.">Development and quantitative analyses of a universal rRNA-subtraction protocol for microbial metatranscriptomics.</a> ISME J. 4, 896-907 (2010).</li><li>Wang, Y., Gilbreath, T. M., Kukutla, P., Yan, G., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+gut+microbiome+across+life+history+of+the+malaria+mosquito+Anopheles+gambiae+in+Kenya.">Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya.</a> PLoS One. 6, e24767 (2011).</li><li>Su, C., Sordillo, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+to+enrich+mRNA+from+total+prokaryotic+RNA.">A simple method to enrich mRNA from total prokaryotic RNA.</a> Mol. Biotechnol. 10, 83-85 (1998).</li><li>Gusmao, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture-dependent+and+culture-independent+characterization+of+microorganisms+associated+with+Aedes+aegypti+(Diptera:+Culicidae)+(L.)+and+dynamics+of+bacterial+colonization+in+the+midgut.">Culture-dependent and culture-independent characterization of microorganisms associated with Aedes aegypti (Diptera: Culicidae) (L.) and dynamics of bacterial colonization in the midgut.</a> Acta Trop. 115, 275-281 (2010).</li><li>Lindh, J. M., Terenius, O., Faye, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=16S+rRNA+gene-based+identification+of+midgut+bacteria+from+field-caught+Anopheles+gambiae+sensu+lato+and+A.+funestus+mosquitoes+reveals+new+species+related+to+known+insect+symbionts.">16S rRNA gene-based identification of midgut bacteria from field-caught Anopheles gambiae sensu lato and A. funestus mosquitoes reveals new species related to known insect symbionts.</a> Appl. Environ. Microbiol. 71, 7217-7223 (2005).</li><li>Simon, C., Daniel, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analyses:+past+and+future+trends.">Metagenomic analyses: past and future trends.</a> Appl. Environ. Microbiol. 77, 1153-1161 (2011).</li><li>Wang, Y., Qian, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservative+fragments+in+bacterial+16S+rRNA+genes+and+primer+design+for+16S+ribosomal+DNA+amplicons+in+metagenomic+studies.">Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.</a> PLoS One. 4, e7401 (2009).</li><li>Hunt, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+23S+rRNA+PCR+primers+for+use+in+phylogenetic+studies+of+bacterial+diversity.">Evaluation of 23S rRNA PCR primers for use in phylogenetic studies of bacterial diversity.</a> Appl. Environ. Microbiol. 72, 2221-2225 (2006).</li></ol>

The authors declare that they have no competing financial interests.

A complex microbial community resides in the mosquito gut ecosystem 14,16,17. Metatranscriptomic sequencing (RNA-seq) can reveal context dependent functional information by interrogating the entire microbial transcriptome4,18. Technically, oligo-d(T) mediated enrichment of prokaryotic mRNA is not applicable due to the absence of stable poly (A) tails of the messengers. Alternatively, rRNA depletion has been used for mRNA enrichment. Here, we developed a subtraction-based protocol to deplete rRNA using rRNA probes made from the very own metagenomic DNA in the mosquito gut microbial community. The efficiency of the rRNA removal depends on the coverage of the rRNA capture probes that are generated by the rRNA PCR. The annealing efficiency of different primer sets targeting conserved regions varies across different taxa 19. Therefore, we recommend trying different combinations of primers on metagenomic samples, and then pooling the rRNA products to maximize the coverage. In our procedure, we create capture probes by combining rRNA PCR products of two forward and two reverse primers, which can form 4 combinations of primer sets (Table 1). In addition, rRNA intends to form a secondary structure. Compared to full length rRNA as probes13, smaller rRNA fragments have a lower tendency to form secondary structure, which may facilitate the hybridization of capture probes to the sample rRNA. The biotinylated probes efficiently hybridize to rRNA in the total RNA sample and the hybrids are removed by capturing with streptavidin coated beads. The procedure removes most of the rRNA (Figure 4). In the four samples we have processed, 90-99% of rRNA was effectively depleted (Table 3). This procedure can be further modified for a variety of insect-associated microbiome studies.

Next-generation sequencing technology has greatly advanced metagenomics study by allowing to assess the taxonomic composition and genetic functionality of a microbial assemblage. RNA-Sequencing (RNA-Seq)1 can bypass culture-based methods to investigate microbial metatranscriptomes in different contexts 2-5. A major obstacle to microbial RNA-seq is the difficulty in enriching mRNA, as the prokaryotic mRNA species are not stably polyadenylated. Therefore, oligo d(T) mediated messenger enrichment is not applicable. Removal of abundant rRNA is an alternative approach to enrich mRNA. Commercial rRNA depletion kits, such as Microexpress Bacterial mRNA Enrichment kit (Ambion), RiboMinus Transcriptome Isolation Kit (Bacteria) (Life Technologies), and mRNA-ONLY Prokaryotic mRNA Isolation kit (Epicentre) that preferentially degrades rRNA with an exonuclease, have been used for removing rRNA 6-8. However, the capture probes in Microexpress or RiboMinus are good for removing known rRNA from typical Gram-positive and Gram-negative bacteria (see manufacturers' specifications), but less compatible with rRNA from unknown microbes. Consequently, the removal may be less efficient for metagenomic samples8-10. Besides, the mRNA abundance fidelity was questionable when the exonuclease treatment was applied 11. Overall, subtraction-based rRNA depletion was less biased and more effective in mRNA enrichment in metagenomic settings 10-13. 
The mosquito gut accommodates a dynamic microbial community14. We are interested in characterizing the function of the mosquito gut microbiome by using RNA-Seq. In an RNA sample isolated from the mosquito guts, both mosquito and microbial RNA are present. Here, we describe a modified protocol to use community specific rRNA probes to efficiently deplete mosquito and microbial rRNA by subtractive hybridization. The resultant mRNA enriched samples are appropriate for RNA-Seq. The overall workflow is depicted in Figure 1.

<table border="1">
 <tbody>
 <tr>
 <td></td>
 <td></td>
 <td></td>
 <td>Reagent/Material </td>
 </tr>
 <tr>
 <td>Meta-G-Nome 				DNA isolation kit</td>
 <td>Epicentre</td>
 <td>MGN0910</td>
 <td>Metagenomic 				DNA isolation</td>
 </tr>
 <tr>
 <td>TriPure </td>
 <td>Roche</td>
 <td>11667165001</td>
 <td>Mdetagenomic 				RNA isolation</td>
 </tr>
 <tr>
 <td>MEGAscript 				T7 kit</td>
 <td>Ambion</td>
 <td>AM1334</td>
 <td>In 				vitro synthesis of RNA probes</td>
 </tr>
 <tr>
 <td>RNaseZap</td>
 <td>Ambion</td>
 <td>AM9780</td>
 <td>RNase 				free working area </td>
 </tr>
 <tr>
 <td>Biotin-16-UTP</td>
 <td>Roche</td>
 <td>11388908910</td>
 <td>In 				vitro synthesis of RNA</td>
 </tr>
 <tr>
 <td>Biotin-11-CTP</td>
 <td>Roche</td>
 <td>4739205001</td>
 <td>In 				vitro synthesis of RNA</td>
 </tr>
 <tr>
 <td>Streptavidin 				magnetic beads</td>
 <td>NEB</td>
 <td>S1420S</td>
 <td>Capture 				of rRNA hybrids</td>
 </tr>
 <tr>
 <td>Magnetic 				separation rack</td>
 <td>NEB</td>
 <td>S1506S</td>
 <td>Capture 				of rRNA hybrids</td>
 </tr>
 <tr>
 <td>RNeasy 				mini kit</td>
 <td>QIAGEN</td>
 <td>74104</td>
 <td>Purification 				of subtracted RNA</td>
 </tr>
 <tr>
 <td>RNase-Free 				DNase Set</td>
 <td>QIAGEN</td>
 <td>79254</td>
 <td>Removal 				DNA contamination </td>
 </tr>
 <tr>
 <td>Agilent 				RNA 6000 Pico Kit</td>
 <td>Agilent 				Technologies Inc.</td>
 <td>5067-1513</td>
 <td>Electropherogram 				of RNA</td>
 </tr>
 <tr>
 <td></td>
 <td></td>
 <td></td>
 <td>Equipment </td>
 </tr>
 <tr>
 <td>Bio-Gen 				PRO200 				Homogenizer</td>
 <td>PRO 				Scientific</td>
 <td>01-01200</td>
 <td>Mosquito 				gut tissue homogenization</td>
 </tr>
 <tr>
 <td>NanoDrop 				1000 Spectrophotometer</td>
 <td>Thermo 				Scientific</td>
 <td></td>
 <td>DNA 				&amp; RNA quantitation</td>
 </tr>
 <tr>
 <td>2100 				Bioanalyzer</td>
 <td>Agilent 				Technologies Inc.</td>
 <td>G2940CA</td>
 <td>Electropherogram 				of RNA</td>
 </tr>
 </tbody>
</table>

depletion of ribosomal rna for mosquito gut metagenomic rna-seq

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity and functionality of the gut community will provide insight into the effects of gut microbiota on mosquito life traits. Metagenomic RNA-Seq has become an important tool to analyze transcriptomes from various microbes present in a microbial community. Messenger RNA usually comprises only 1-3% of total RNA, while rRNA constitutes approximately 90%. It is challenging to enrich messenger RNA from a metagenomic microbial RNA sample because most prokaryotic mRNA species lack stable poly(A) tails. This prevents oligo d(T) mediated mRNA isolation. Here, we describe a protocol that employs sample derived rRNA capture probes to remove rRNA from a metagenomic total RNA sample. To begin, both mosquito and microbial small and large subunit rRNA fragments are amplified from a metagenomic community DNA sample. Then, the community specific biotinylated antisense ribosomal RNA probes are synthesized in vitro using T7 RNA polymerase. The biotinylated rRNA probes are hybridized to the total RNA. The hybrids are captured by streptavidin-coated beads and removed from the total RNA. This subtraction-based protocol efficiently removes both mosquito and microbial rRNA from the total RNA sample. The mRNA enriched sample is further processed for RNA amplification and RNA-Seq.

The protocol includes three sections: (1) preparation of metagenomic DNA templates for rRNA PCR; (2) creation of sample specific capture rRNA probes; (3) depletion of rRNA from total RNA by subtractive hybridization. Isolation of high quality metagenomic DNA and RNA is essential to the entire process. The modified Meta-G-Nome DNA isolation protocol yields high-quality metagenomic DNA from mosquito guts, as shown in Figure 2. It can be challenging to isolate high-quality total RNA from mosquito guts. This is likely due to the presence of various enzymes, including RNase, in mosquito guts. We compared the total RNA extraction performance of Qiagen RNA isolation kit to Roche TriPure. Electropherogram of Agilent Bioanalyzer analysis showed that the total RNA isolated using TriPure contains clear rRNA peaks (Figure 3), which is not seen in the RNA obtained using the Qiagen kit. Perhaps mosquito-derived RNase is effectively inactivated by the phenol in TriPure. Typically, 50 mosquito guts yield ~ 20 &mu;g total RNA. The ideal amount of total RNA input for the current rRNA depletion process is ~1 &mu;g, which optimizes the efficiency of rRNA subtraction and yields ~ 150 ng purified RNA. Figure 4 shows the comparison of RNA electropherograms before and after rRNA subtraction. The rRNA was efficiently removed while the non-rRNA species were greatly enriched in the remaining RNA. The presence of large size RNA (&gt;2,000 bp) indicates a good quality of enriched mRNA (Figure 4B). The protocol can be scaled up to accommodate a greater input of RNA for processing. Usually 5 &mu;g RNA is required for the RNA-seq process. Therefore, we used MessageAmp II-Bacteria RNA Amplification Kit to generate an adequate amount of rRNA depleted RNA for RNA-Seq. We recommend using 150 ng or more purified RNA for the RNA amplification to ensure the fidelity of amplification. This protocol has been applied to a mosquito gut RNA-Seq project. The rRNA depletion was effectively achieved by using sample derived capture probes. Table 3 lists the percentage of rRNA reads in the RNA-Seq output of four samples. Two sugar-fed and two blood-fed gut samples were processed for depletion and RNA-Seq. The Illumina sequencing generated 23-24M reads for each sample. The rRNA subtraction effectively removed 90-99% rRNA from both mosquito tissue and microbes in the gut samples. Depletion was almost complete in the sugar-fed gut samples, and 6.12-10.98% rRNA remained in the blood-fed samples (Table 3).
<table border="1">
 <tbody>
 <tr>
 <td fo:width="1in">Amplicon</td>
 <td fo:width="2in">Forward 5'-3'</td>
 <td fo:width="3.5in">Reverse 5'-3'</td>
 </tr>
 <tr>
 <td>Bacterial 16S</td>
 <td>27F </td>
 <td>803R_T7</td>
 </tr>
 <tr>
 <td></td>
 <td>AGAGTTTGATCCTGGCTCAG</td>
 <td>TAATACGACTCACTATAGGNCTACCTGGGTATCTAATCC</td>
 </tr>
 <tr>
 <td></td>
 <td>347F </td>
 <td>1492R_T7 </td>
 </tr>
 <tr>
 <td></td>
 <td>GGAGGCAGCAGTRRGGAAT</td>
 <td>TAATACGACTCACTATAGGGACGGCTACCTTGTTACGACTT</td>
 </tr>
 <tr>
 <td>Bacterial 23S</td>
 <td>189F </td>
 <td>2490R_T7 </td>
 </tr>
 <tr>
 <td></td>
 <td>GAASTGAAACATCTHAGTA</td>
 <td>TAATACGACTCACTATAGGGCGACATCGAGGTGCCAAAC</td>
 </tr>
 <tr>
 <td></td>
 <td>1075F </td>
 <td>2241R_T7 </td>
 </tr>
 <tr>
 <td></td>
 <td>GTTGGCTTRGARGCAGC</td>
 <td>TAATACGACTCACTATAGGGACCGCCCCAGTHAAACT</td>
 </tr>
 <tr>
 <td>Mosquito 18S</td>
 <td>18SF1 </td>
 <td>18SR1_T7</td>
 </tr>
 <tr>
 <td></td>
 <td>GGTTGATCCTGCCAGTAGTAT</td>
 <td> TAATACGACTCACTATAGGCAAACGCTTTCGCTTCTGT</td>
 </tr>
 <tr>
 <td></td>
 <td>18SF2 </td>
 <td>18SR2_T7 </td>
 </tr>
 <tr>
 <td></td>
 <td>GGGCCGGCGTTGGCCGAGAAT</td>
 <td>TAATACGACTCACTATAGGTTCACTTACGGAAACCTTG</td>
 </tr>
 <tr>
 <td>Mosquito 28S</td>
 <td>28SF1 </td>
 <td>28SR1_T7 </td>
 </tr>
 <tr>
 <td></td>
 <td>AGG AAC CAC AGG TAC GGA CC</td>
 <td>TAATACGACTCACTATAGGACCACCAAGCATGGGTCGCC</td>
 </tr>
 <tr>
 <td></td>
 <td>28SF2</td>
 <td>28SR2_T7 </td>
 </tr>
 <tr>
 <td></td>
 <td>AGGAACCACAGGTACGGACC</td>
 <td>TAATACGACTCACTATAGGTCCCGGAGGTGCCTCAA</td>
 </tr>
 </tbody>
</table>
Table 1. Primer sets for rRNA fragment amplification
Bacterial 16S and 23 primers are designed based on 20,19. T7 promoter sequences are in bold.
<table border="1">
 <tbody>
 <tr>
 <td fo:width="1.5in">10 x buffer</td>
 <td fo:width="1.5in">2 &mu;l</td>
 </tr>
 <tr>
 <td>PCR products (0.5-1 &mu;g) </td>
 <td>1.5 &mu;l</td>
 </tr>
 <tr>
 <td>ATP (75mM)</td>
 <td>2 &mu;l</td>
 </tr>
 <tr>
 <td>GTP (75mM)</td>
 <td>2 &mu;l</td>
 </tr>
 <tr>
 <td>CTP (75mM)</td>
 <td>1.5 &mu;l</td>
 </tr>
 <tr>
 <td>UTP (75mM)</td>
 <td>1.5 &mu;l</td>
 </tr>
 <tr>
 <td>Biotin-11-CTP (10mM)</td>
 <td>3.75 &mu;l</td>
 </tr>
 <tr>
 <td>Biotin-16-UTP (10mM)</td>
 <td>3.75 &mu;l</td>
 </tr>
 <tr>
 <td>T7 RNA polymerase</td>
 <td>2 &mu;l</td>
 </tr>
 </tbody>
</table>
Table 2. Components of in vitro synthesis of rRNA probes.
<table border="1">
 <tbody>
 <tr>
 <td>Sample</td>
 <td>Total reads</td>
 <td>Mosquito rRNA reads (%)</td>
 <td>Microbial 16S reads (%)</td>
 <td>Microbial 23S reads (%)</td>
 <td>Total % of rRNA reads*</td>
 </tr>
 <tr>
 <td>SM1</td>
 <td>24,341,850</td>
 <td>121,987 (0.50)</td>
 <td>3,717 (0.02)</td>
 <td>6,810 (0.03)</td>
 <td>0.54</td>
 </tr>
 <tr>
 <td>SM2</td>
 <td>23,487,202</td>
 <td>114,430 (0.49)</td>
 <td>30,271 (0.13)</td>
 <td>38,261 (0.16)</td>
 <td>0.78</td>
 </tr>
 <tr>
 <td>BM1</td>
 <td>23,438,304</td>
 <td>265,433 (1.13)</td>
 <td>2,054,777 (8.77)</td>
 <td>253,051 (1.08)</td>
 <td>10.98</td>
 </tr>
 <tr>
 <td>BM2</td>
 <td>24,212,240</td>
 <td>110,240 (0.46)</td>
 <td>1,186,423 (4.90)</td>
 <td>185,074 (0.76)</td>
 <td>6.12</td>
 </tr>
 </tbody>
</table>
Table 3. Statistics of rRNA reads in RNA-seq output. SM: sugar fed gut; BM: blood fed gut. *:The sum of percentages of mosquito rRNA and microbial rRNA reads. 
<img src="/files/ftp_upload/50093/50093fig1.jpg" alt="Figure 1" /> 
Figure 1. Flow chart showing the procedural steps of metagenomic DNA and RNA isolation, rRNA capture probe synthesis, hybridization, and capture beads based depletion.
<img src="/files/ftp_upload/50093/50093fig2.jpg" alt="Figure 2" /> 
Figure 2. Metagenomic DNA isolation. DNA samples were separated on 1% agarose gel. 1, Fosmid DNA (40kb); 2, Mosquito gut metagenomic DNA.
<img src="/files/ftp_upload/50093/50093fig3.jpg" alt="Figure 3" fo:content-width="4in" fo:src="/files/ftp_upload/50093/50093fig3highres.jpg"/> 
Figure 3. Comparison of two total RNA isolation reagents for their efficiency in extracting a quality RNA from mosquito gut. Overlay of electropherograms shows that total RNA from TriPure isolation (in blue) had rRNA peaks and wide RNA distribution, while that from Qiagen isolation (in red) had no clear rRNA peaks. 
<img src="/files/ftp_upload/50093/50093fig4.jpg" alt="Figure 4" fo:content-width="4in" fo:src="/files/ftp_upload/50093/50093fig4highres.jpg"/> 
Figure 4. Efficiency of rRNA depletion. Electropherograms show the total RNA before (A) and after (B) rRNA depletion. The rRNA peaks were efficiently removed. RNA greater than 4kb remains in rRNA depleted sample. The RNA concentration was 107.6 ng/ &mu;l in (A) and 8.6 ng/ &mu;l in (B).

Watch this Scientific Journal Video about Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq at JoVE.com

Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

A ribosomal RNA (rRNA) depletion protocol was developed to enrich messenger RNA (mRNA) for RNA-seq of the mosquito gut metatranscriptome. Sample specific rRNA probes, which were used to remove rRNA via subtraction, were created from the mosquito and its gut microbes. Performance of the protocol can result in the removal of approximately 90-99% of rRNA.

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity ...

depletion-of-ribosomal-rna-for-mosquito-gut-metagenomic-rna-seq

Nanyang Technological University

Research

JoVE Journal

Biology

19.5K Views.  New Mexico State University. A ribosomal RNA (rRNA) depletion protocol was developed to enrich messenger RNA (mRNA) for RNA-seq of the mosquito gut metatranscriptome. Sample specific rRNA probes, which were used to remove rRNA via subtraction, were created from the mosquito and its gut microbes. Performance of the protocol can result in the removal of approximately 90-99% of rRNA.

Video: Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Protocol for Mosquito Rearing (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night cycle. For this procedure, you'll need mosquito cages, 10% sterile sucrose solution, paper towels, beaker, whatman filter paper, glass feeders, human blood and serum, water bath, parafilm, distilled water, clean plastic trays, mosquito food (described below), mosquito net to cover the trays, vacuum, and a collection chamber to collect adults.

Protocol for Mosquito Rearing A. gambiae

This video illustrates the general techniques used to rear Anopheles gambiae in the laboratory. The methods for caring for laboratory mosquitoes are demonstrated through all stages of the organism's life cycle from larvae to pupae to blood-feeding adults.

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel production 1. Chemical methods to modify or degrade cellulose typically require strong acids and high temperatures. As such, enzymatic methods have become prominent in the bioconversion process. While the identification of active cellulases from bacterial and fungal isolates has been somewhat effective, the vast majority of microbes in nature resist laboratory cultivation. Environmental genomic, also known as metagenomic, screening approaches have great promise in bridging the cultivation gap in the search for novel bioconversion enzymes. Metagenomic screening approaches have successfully recovered novel cellulases from environments as varied as soils 2, buffalo rumen 3 and the termite hind-gut 4 using carboxymethylcellulose (CMC) agar plates stained with congo red dye (based on the method of Teather and Wood 5). However, the CMC method is limited in throughput, is not quantitative and manifests a low signal to noise ratio 6. Other methods have been reported 7,8 but each use an agar plate-based assay, which is undesirable for high-throughput screening of large insert genomic libraries. Here we present a solution-based screen for cellulase activity using a chromogenic dinitrophenol (DNP)-cellobioside substrate 9. Our library was cloned into the pCC1 copy control fosmid to increase assay sensitivity through copy number induction 10. The method uses one-pot chemistry in 384-well microplates with the final readout provided as an absorbance measurement. This readout is quantitative, sensitive and automated with a throughput of up to 100X 384-well plates per day using a liquid handler and plate reader with attached stacking system.

This protocol describes a high throughput screen for cellulolytic activity from a metagenomic library expressed in Escherichia coli. The screen is solution based and highly automated, and uses one-pot chemistry in 384 well microplates with the final readout as an absorbance measurement.

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

RNA-seq Analysis of Transcriptomes in Thrombin-treated and Control Human Pulmonary Microvascular Endothelial Cells

The characterization of gene expression in cells via measurement of mRNA levels is a useful tool in determining how the transcriptional machinery of the cell is affected by external signals (e.g. drug treatment), or how cells differ between a healthy state and a diseased state. With the advent and continuous refinement of next-generation DNA sequencing technology, RNA-sequencing (RNA-seq) has become an increasingly popular method of transcriptome analysis to catalog all species of transcripts, to determine the transcriptional structure of all expressed genes and to quantify the changing expression levels of the total set of transcripts in a given cell, tissue or organism1,2 . RNA-seq is gradually replacing DNA microarrays as a preferred method for transcriptome analysis because it has the advantages of profiling a complete transcriptome, providing a digital type datum (copy number of any transcript) and not relying on any known genomic sequence3.
Here, we present a complete and detailed protocol to apply RNA-seq to profile transcriptomes in human pulmonary microvascular endothelial cells with or without thrombin treatment. This protocol is based on our recent published study entitled "RNA-seq Reveals Novel Transcriptome of Genes and Their Isoforms in Human Pulmonary Microvascular Endothelial Cells Treated with Thrombin,"4 in which we successfully performed the first complete transcriptome analysis of human pulmonary microvascular endothelial cells treated with thrombin using RNA-seq. It yielded unprecedented resources for further experimentation to gain insights into molecular mechanisms underlying thrombin-mediated endothelial dysfunction in the pathogenesis of inflammatory conditions, cancer, diabetes, and coronary heart disease, and provides potential new leads for therapeutic targets to those diseases.
The descriptive text of this protocol is divided into four parts. The first part describes the treatment of human pulmonary microvascular endothelial cells with thrombin and RNA isolation, quality analysis and quantification. The second part describes library construction and sequencing. The third part describes the data analysis. The fourth part describes an RT-PCR validation assay. Representative results of several key steps are displayed. Useful tips or precautions to boost success in key steps are provided in the Discussion section. Although this protocol uses human pulmonary microvascular endothelial cells treated with thrombin, it can be generalized to profile transcriptomes in both mammalian and non-mammalian cells and in tissues treated with different stimuli or inhibitors, or to compare transcriptomes in cells or tissues between a healthy state and a disease state.

This protocol presents a complete and detailed procedure to apply RNA-seq, a powerful next-generation DNA sequencing technology, to profile transcriptomes in human pulmonary microvascular endothelial cells with or without thrombin treatment. This protocol is generalizable to various cells or tissues affected by different reagents or disease states.

The characterization of gene expression in cells via measurement of mRNA levels is a useful tool in determining how the transcriptional machinery of the ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

Photoperiodic diapause is an important adaptation that allows individuals to escape harsh seasonal environments via a series of physiological changes, most notably developmental arrest and reduced metabolism. Global gene expression profiling via RNA-Seq can provide important insights into the transcriptional mechanisms of photoperiodic diapause. The Asian tiger mosquito, Aedes albopictus, is an outstanding organism for studying the transcriptional bases of diapause due to its ease of rearing, easily induced diapause, and the genomic resources available. This manuscript presents a general experimental workflow for identifying diapause-induced transcriptional differences in A. albopictus. Rearing techniques, conditions necessary to induce diapause and non-diapause development, methods to estimate percent diapause in a population, and RNA extraction and integrity assessment for mosquitoes are documented. A workflow to process RNA-Seq data from Illumina sequencers culminates in a list of differentially expressed genes. The representative results demonstrate that this protocol can be used to effectively identify genes differentially regulated at the transcriptional level in A. albopictus due to photoperiodic differences. With modest adjustments, this workflow can be readily adapted to study the transcriptional bases of diapause or other important life history traits in other mosquitoes.

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

RNA-Seq analyses are becoming increasingly important for identifying the molecular underpinnings of adaptive traits in non-model organisms. Here, a protocol to identify differentially expressed genes between diapause and non-diapause Aedes albopictus mosquitoes is described, from mosquito rearing, to RNA sequencing and bioinformatics analyses of RNA-Seq data.

Photoperiodic diapause is an important adaptation that allows individuals to escape harsh seasonal environments via a series of physiological changes, ...

Physiological Recordings and RNA Sequencing of the Gustatory Appendages of the Yellow-fever Mosquito Aedes aegypti

Electrophysiological recording of action potentials from sensory neurons of mosquitoes provides investigators a glimpse into the chemical perception of these disease vectors. We have recently identified a bitter sensing neuron in the labellum of female Aedes aegypti that responds to DEET and other repellents, as well as bitter quinine, through direct electrophysiological investigation. These gustatory receptor neuron responses prompted our sequencing of total mRNA from both male and female labella and tarsi samples to elucidate the putative chemoreception genes expressed in these contact chemoreception tissues. Samples of tarsi were divided into pro-, meso- and metathoracic subtypes for both sexes. We then validated our dataset by conducting qRT-PCR on the same tissue samples and used statistical methods to compare results between the two methods. Studies addressing molecular function may now target specific genes to determine those involved in repellent perception by mosquitoes. These receptor pathways may be used to screen novel repellents towards disruption of host-seeking behavior to curb the spread of harmful viruses.

Physiological Recordings and RNA Sequencing of the Gustatory Appendages of the Yellow-fever Mosquito Aedes aegypti

Using two methods to estimate gene expression in the major gustatory appendages of Aedes aegypti, we have identified the set of genes putatively underlying the neuronal responses to bitter and repulsive compounds, as determined by electrophysiological examination.

Electrophysiological recording of action potentials from sensory neurons of mosquitoes provides investigators a glimpse into the chemical perception of ...

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects facilitated research in new facets of mosquito biology, including functional genetic studies in the primary African malaria vector Anopheles gambiae and the dengue and yellow fever vector Aedes aegypti. RNA interference- (RNAi-) mediated gene silencing has been used to target genes of interest in both of these disease vector mosquito species. Here, we describe a procedure for preparation of chitosan/interfering RNA nanoparticles that are combined with food and ingested by larvae. This technically straightforward, high-throughput, and relatively inexpensive methodology, which is compatible with long double stranded RNA (dsRNA) or small interfering RNA (siRNA) molecules, has been used for the successful knockdown of a number of different genes in A. gambiae and A. aegypti larvae. Following larval feedings, knockdown, which is verified through qRT-PCR or in situ hybridization, can persist at least through the late pupal stage. This methodology may be applicable to a wide variety of mosquito and other insect species, including agricultural pests, as well as other non-model organisms. In addition to its utility in the research laboratory, in the future, chitosan, an inexpensive, non-toxic and biodegradable polymer, could potentially be utilized in the field.

Here we describe a procedure for inhibiting gene function in disease vector mosquitoes through the use of chitosan/interfering RNA nanoparticles that are ingested by larvae.

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects ...

Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Large-Scale Screens of Metagenomic Libraries

Protocol for Mosquito Rearing (A. gambiae)

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

Substrate Generation for Endonucleases of CRISPR/Cas Systems

RNA-seq Analysis of Transcriptomes in Thrombin-treated and Control Human Pulmonary Microvascular Endothelial Cells

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

Physiological Recordings and RNA Sequencing of the Gustatory Appendages of the Yellow-fever Mosquito Aedes aegypti

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae