Method Article
Here, detailed methods for generating, maintaining, and characterizing human pluripotent stem cell-derived small intestinal and colonic organoids are described. These methods are designed to improve reproducibility, expand scalability, and decrease the working time required for plating and passaging of organoids.
Intestinal regional specification describes a process through which unique morphology and function are imparted to defined areas of the developing gastrointestinal (GI) tract. Regional specification in the intestine is driven by multiple developmental pathways, including the bone morphogenetic protein (BMP) pathway. Based on normal regional specification, a method to generate human colonic organoids (HCOs) from human pluripotent stem cells (hPSCs), which include human embryonic stem cells (hES) and induced pluripotent stem cells (iPSCs), was developed. A three-day induction of BMP signaling sufficiently patterns mid/hindgut tube cultures into special AT-rich sequence-binding protein 2 (SATB2)-expressing HCOs containing all of the main epithelial cell types present in human colon as well as co-developing mesenchymal cells. Omission of BMP (or addition of the BMP inhibitor NOGGIN) during this critical patterning period resulted in the formation of human intestinal organoids (HIOs). HIOs and HCOs morphologically and molecularly resemble human developing small intestine and colon, respectively. Despite the utility of HIOs and HCOs for studying human intestinal development, the generation of HIOs and HCOs is challenging. This paper presents methods for generating, maintaining, and characterizing HIOs and HCOs. In addition, the critical steps in the protocol and troubleshooting recommendations are provided.
Studying human colon development is difficult due to restrictions on the use of human fetal tissue. Animal models have been invaluable and historically used for genetic approaches in mice to study intestinal development. However, differences between mouse and human intestinal development limit the applicability of mice as a model system. For instance, although crypt formation in the small intestine and colon of mice occurs postnatally, humans are born with fully formed crypts1. Furthermore, the human small intestine and colon contain cell types that are not found in mice, including motilin (MLN)-expressing enteroendocrine cells in the small intestine2 and mucin 5B (MUC5B)-expressing goblet cells in the colon3,4. For this reason, it is important to have a cell culture system that accurately models the dynamic molecular events that define the early stages of colon development. Therefore, directing hPSCs to generate cells with colon characteristics provides a powerful model for the study of human colon development.
Protocols have been developed to facilitate the reproducible5, synchronous, and efficient formation of intestine-like6 and colon-like organoids7 from hPSCs. These protocols use a stepwise differentiation procedure that mimics the development of the fetal intestine and colon (Figure 1). First, definitive endoderm is generated from human pluripotent stem cells by treatment with Activin A, a Nodal mimetic. Exposure of the definitive endoderm to high levels of WNT and fibroblast growth factor (FGF) induces morphogenesis into CDX2+ mid/hindgut tube spheroids. Midgut/hindgut spheroids are then embedded in extracellular matrix (ECM) and patterned into either HIOs or HCOs through a transient manipulation of BMP signaling. Inhibiting BMP signaling using NOGGIN or adding growth medium alone results in the formation of HIOs, which resemble the human proximal small intestine.
By activating BMP signaling using BMP2, mid/hindgut spheroids are patterned into HCOs, which retain patterning in the epithelium and mesenchyme7. HCOs contain colon-enriched, MUC5B-expressing goblet cells and are competent to generate colon-specific insulin-like 5 (INSL5)-expressing enteroendocrine cells. Isolated mesenchyme from HCOs expresses homeobox A13 (HOXA13) and HOXD13, which are also expressed in human primary colon mesenchyme8. It is important to remember that the patterning step occurs during days 7-10 of the differentiation protocol. This three-day period is sufficient to induce colonic patterning that is maintained following extended in vitro culture.
The protocols described below are for researchers who are familiar with feeder-free hPSC culture. For researchers who are not familiar with this type of hPSC culture, a training course on hPSCs such as those offered by Stem Cell Technologies or the Pluripotent Stem Cell Facility (PSCF) at Cincinnati Children's Hospital is recommended. The quality of the starting hPSCs is critical and can affect all downstream steps. The protocol that follows would begin with hPSCs that have been grown for 4 days and are ready to split.
1. Generation of human intestinal and colonic organoids
2. Verifying the patterning of organoids by reverse-transcription quantitative polymerase chain reaction (RT-qPCR)
3. Verifying the patterning of organoids by immunofluorescence
The successful generation of spheroids during the mid/hindgut induction stage is indicative of successful patterning. Perform IF staining for CDX2 on floating spheroids and on the monolayer to confirm that patterning is correct. Although staining at the definitive endoderm (DE) stage can indicate the effectiveness of DE induction, spheroid generation is not possible without efficient DE induction. To test the efficiency of DE induction, perform IF staining and/or RT-qPCR for FOXA2 and SOX17.
Following the patterning stage, the expression of HOX factors is the best indicator of successful patterning. HOX factors are primarily expressed in the intestinal and colonic mesenchyme8,9. Therefore, HOX factor expression will reflect the patterning of the mesenchyme. The expression of mRNA of the anterior HOX factor HOXD3 should be highest in NOGGIN-treated HIOs, less in epithelial growth factor (EGF)-treated HIOs, and lowest in BMP-treated HCOs. Conversely, HOXA13 and HOXD13 mRNA expression should be low in HIOs and high in HCOs (Figure 4). In addition, perform RT-qPCR for MSX2, a direct target of BMP signaling at day 10. SATB2 expression can be seen in the epithelium of HCOs at day 10; however, examination of SATB2 by RT-qPCR is not a reliable indicator of patterning as HIOs contain populations of neurons10,11 that can also express SATB212,13. Therefore, use RT-qPCR to examine HOX factor expression to determine if patterning was successful. Perform immunofluorescence staining for SATB2, CDX2, and CDH1 to determine if HCO epithelium was properly patterned (Figure 5).
Figure 1: Schematic of the differentiation protocol for HCOs. The general timeline of HCO differentiation is shown. Although HIO differentiation is not shown, it would be the same except for the patterning stage in which NOG+EGF or EGF alone would be used from days 7-10. Abbreviations: hPSCs = human pluripotent stem cells; HCOs = human colonic organoids; HIOs = human intestinal organoids; EGF = epithelial growth factor; BMP2 = bone morphogenetic protein 2; NOG = Noggin. Please click here to view a larger version of this figure.
Figure 2: Generation of the definitive endoderm monolayer from hPSCs. Morphology of hPSCs is shown before (A, B) and after Activin A Day 1 (C) after Activin A Day 2 (D) and after Activin A Day 3 (E). Staining of DE with SOX17 (F), FOXA2 (G), and SOX17/FOXA2 merged with DAPI (H). Images were acquired using a 10x objective of an Olympus IX50 inverted microscope. Scale bars = 100 µm. Abbreviations: hPSCs = human pluripotent stem cells; DE = definitive endoderm; SOX17 = sex-determining region Y (SRY)-box transcription factor 17; FOXA2 = forkhead box A2 protein. Please click here to view a larger version of this figure.
Figure 3: Morphogenesis of mid/hindgut spheroids from the definitive endoderm. Photographs of the DE monolayer following treatment of DE with MHGI medium for 24 h (A), 48 h (B), 72 h (C), and 96 h (D).MHGI medium was changed daily. Yellow arrows point to areas of endoderm condensation. White arrows point to emerging mid-hindgut spheroids. Photographs of plated spheroids (E), Day 21 HCOs (F), and Day 35 HCOs (G). Images in A-D were acquired using a 10x objective of an Olympus IX50 inverted microscope. Scale bars = 100 µm. Images in E-F were acquired using a Leica S9D stereomicroscope using a 1x objective. Abbreviations: DE = definitive endoderm; MHGI = Mid-hindgut Induction. Please click here to view a larger version of this figure.
Figure 4: HOX gene expression in human intestinal and colonic organoids at day 21. RT-qPCR using standard methods to determine the relative expression of the anterior HOX gene HOXD3 and the posterior HOX genes HOXA13 and HOXD13. For NOG HIOs, n=3. For HCOs, n=4. Error bars depict the standard error of the mean while p values are from a two-tailed Student's t-test with equal variance. *: p < 0.05 *, **: p < 0.01,***: p < 0.001. Abbreviations: HOX = homeobox protein; NOG = noggin; HIOs = human intestinal organoids; HCOs = human colonic organoids. Please click here to view a larger version of this figure.
Figure 5: Immunofluorescence staining of human intestinal and colonic organoids. Day 35 HIOs (top panels) and HCOs (lower panels) were stained for CDX2 (green), CDH1 (white), SATB2 (red), and DAPI (blue). Images were acquired using a 25x objective on an LSM 880 confocal microscope. Scale bars = 50 µm. Abbreviations: HIOs = human intestinal organoids; HCOs = human colonic organoids; CDH1 = E-cadherin; SATB2 = special AT-rich sequence-binding protein 2; DAPI = 4′,6-diamidino-2-phenylindole. Please click here to view a larger version of this figure.
ECM (µL) | Spheroid suspension (µL) | |
6-Wells | 375 | 120 |
12-Wells | 750 | 240 |
Table 1: Volume of ECM/spheroids required for plating.
Gene | Primers | Notes: | ||
CPHA | Forward: CCCACCGTGTTCTTCGACATT | Housekeeping gene | ||
Reverse: GGACCCGTATGCTTTAGGATGA | ||||
HOXD3 | Forward: CACCTCCAATGTCTGCTGAA | Anterior HOX gene | ||
Reverse: CAAAATTCAAGAAAACACACACA | ||||
HOXA13 | Forward: GCACCTTGGTATAAGGCACG | Posterior HOX gene | ||
Reverse: CCTCTGGAAGTCCACTCTGC | ||||
HOXD13 | Forward: CCTCTTCGGTAGACGCACAT | Posterior HOX gene | ||
Reverse: CAGGTGTACTGCACCAAGGA | ||||
MSX2 | Forward: GGTCTTGTGTTTCCTCAGGG | Direct BMP target | ||
Reverse: AAATTCAGAAGATGGAGCGG |
Table 2: List of primers and sequences. Abbreviations: HOX = homeobox; CPHA = cyclophilin A; MSX2 = msh homeobox 2; BMP = bone morphogenetic protein.
The differentiation of hPSCs into HIOs and HCOs is a complex process requiring quality controls at each step. The starting hPSCs need to have minimal differentiation before initiating differentiation into DE. Optimizing the density of hPSCs plated for DE differentiation is critical for the success of the protocol. To ensure the quality of DE differentiation, perform IF for FOXA2 and SOX17 to determine the efficiency of DE differentiation. DE differentiation should result in over 80% of the treated cells staining positive for FOXA2 and SOX17. Once the optimal density is established, this same density can be used for multiple experiments with similar success. Following successful DE differentiation, mid/hindgut induction should be highly efficient. After plating in ECM, patterning of mid/hindgut spheroids with BMP2 lowers the efficiency of organoid formation from spheroids (~15%). Therefore, plate 2 to 3 times more spheroids per ECM bubble for HCO generation as compared to HIOs.
The optimal density for DE differentiation will vary from cell line to cell line. However, some cell lines are difficult to differentiate into DE with Activin A alone. If multiple experiments fail, add 5-15 ng/mL of BMP4 to the day 1 Activin A medium. The addition of BMP4 has been shown to improve DE differentiation through inhibition of the pluripotency factor SOX214. This modification does not affect mid/hindgut induction. If spheroid generation is unsuccessful, the DE monolayer should be checked for CDX2 expression to ensure proper patterning of the DE into mid/hindgut. If the DE is CDX2+ but does not yield any spheroids, the monolayer can be passaged as clumps and plated in ECM15,16,17,18. Clumps of mid/hindgut monolayer can self-organize, grow, mature, and differentiate similar to spheroid-derived HIOs.
Despite their cellular complexity, HIOs and HCOs lack an enteric nervous system (ENS). In addition, HIOs and HCOs are immature and lack expression of brush border enzymes, limiting their utility. The ENS is derived from vagal neural crest cells (NCCs). The hPSCs that have differentiated into vagal NCCs have been incorporated into HIOs and HCOs to establish an ENS5,19. Co-culture of HIOs with T lymphocytes (Jurkat cells) induces HIO maturation in vitro resulting in the expression of brush border enzymes, mature intestinal stem cell markers, and increased expression of enteroendocrine cell-expressed hormones20. Similar approaches will be needed to increase the cellular complexity of HIOs and HCOs by incorporating other immune cells such as tissue-resident macrophages.
Reprogramming of patient somatic cells into iPSCs has allowed the use HIOs and HCOs for modeling diseases such as dyskeratosis congenita21, familial adenomatous polyposis17,22, and ulcerative colitis10. Furthermore, clustered regularly interspaced palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9)-mediated gene editing of hPSCs has allowed functional studies of neurogenin323,24, paired-like homeobox 2B19, and CDX225 proteins. Further improvements in the incorporation of cell types and the induction of maturation in HIOs and HCOs will lead to better disease models. In addition, CRISPR-Cas9-mediated gene editing of genes involved in regional patterning should provide new insights into the regional specification of the intestines. HIOs and HCOs are an exciting model for studying human fetal intestine and will continue to provide insights into human intestinal development and disease.
The authors have no conflicts of interest to disclose.
The Múnera lab is funded by NIH/NCI 5U54CA210962-02 South Carolina Cancer Disparities Research Center (SC CADRE), NIH/NIGMS P20 GM130457-01A1 COBRE in Digestive and Liver Disease, and NIH/NIDDK 1P30 DK123704-01 MUSC Digestive Disease Research Core Center.
Name | Company | Catalog Number | Comments |
1% Bovine serum albumin (BSA) solution | N/A | N/A | N/A |
15 mL Corning tube | Falcon | 21008-918 | N/A |
30% Sucrose | N/A | N/A | Made in PBS. |
5% Normal donkey serum | Jackson ImmunoResearch Lab | 017-000-121 | N/A |
50 mL Corning tube | Falcon | 21008-951 | N/A |
Accutase | Thermo Scientific | A1110501 | Cell detachment solution; aliquot 5 mL of Accutase into 10 mL tubes totaling 20 tubes and store at -20 °C for up to 6 months. Place at 4 °C overnight before use. |
Activin A | Cell guidance Systems | GFH6-100x10 | Reconstitute the lyophilized powder at 100 µg/mL in sterile PBS containing 0.1% bovine serum albumin (BSA). Aliquot 38 µL of Activin A into prechilled microcentrifuge tubes and store at -80 °C (Tubes expire 12 months from date of receipt). |
Activin Day 1 medium (RPMI 1640) | Corning | MT10041CV | Use nonessential amino acids (NEAA, Corning 11140050) and store at 4 °C. Basic day 1 medium: 500 mL of RPMI 1640 and 500 mL of NEAA. When preparing Activin Day 1 medium, add 13 mL of basic day 1 medium, 13 µl of Activin A (100 µg/mL), and 2 µl of BMP4 (100 µg/mL). The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors. |
Activin Day 2 medium (RPMI 1640, 0.2% FBS vol/vol) | Hyclone | SH30070.03T | Use nonessential amino acids (Corning 11140050) and store at 4 °C. Basic day 2 medium: 500 mL of RPMI 1640, 500 mL of NEAA, and 1 mL of 0.2% serum. When preparing Activin Day 2 medium, add 12.5 mL of basic day 2 medium and 12.5 µL of Activin A (100 µg/mL). The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors. |
Activin Day 3 medium (RPMI 1640, 2% FBS vol/vol) | Hyclone | SH30070.03T | Use nonessential amino acids (Corning 11140050) and store at 4 °C. Basic day 3 medium: 500 mL of RPMI 1640, 500 mL NEAA, and 10 mL of 2% serum. When preparing Activin Day 3 medium, add 12.5 mL of basic day 3 and 12.5 µL of Activin A (100 µg/mL). The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors. |
Alexa Fluor 488 Donkey anti-Goat | Thermo Scientific | A11055 | 1:500 dilution (Secondary antibody) |
Alexa Fluor 488 Donkey anti-Rabbit | Thermo Scientific | A21206 | 1:500 dilution (Secondary antibody) |
Alexa Fluor 546 Donkey anti-Mouse | Thermo Scientific | A10036 | 1:500 dilution (Secondary antibody) |
Alexa Fluor 647 Donkey anti-Mouse | Thermo Scientific | A31571 | 1:500 dilution (Secondary antibody) |
Base mold | Fisher | 22-363-552 | N/A |
Basic gut medium (advanced DMEM) | Gibco | 12491015 | When preparing Basic gut medium, add 500 mL of DMEM, 500 mL of N2 (Gibco 17-502-048), 500 mL of B27 (Gibco), 500 mL of L-Glutamine to get 2 mM L-Glutamine (Corning A2916801), 5 mL of 100 U/mL Penicillin-Streptomycin (Gibco 15-140-122), and 7.5 mL of 1 M HEPES to get 15 mM HEPES. The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors. |
Biorad CFX96 Touch Real-Time PCR Detection System | Biorad | N/A | Other qRT-PCR systems can be used. |
Cell Recovery Solution | Corning | 354253 | ECM-degrading solution |
CHIR99021 | Reprocell | 4000410 | Reconstitute by adding 2.15 mL of DMSO at 10 mM. Prepare 50 µL aliquots and store at -20 °C. Store powder at 4 °C, protected from light. |
CTRL HIO patterning medium | N/A | N/A | Basic gut medium and 100 ng/mL EGF. |
DAPI | Sigma-Aldrich | D9542 | 1:100 dilution (Secondary antibody) |
DE monolayer | N/A | N/A | Monolayer was generated in prior steps (Section 4.4). |
Dispase | Gibco | 17105041 | Resuspend lyophilized powder in Advanced DMEM (Gibco MT15090CV) to a 1 mg/mL final concentration. Filter the solution for sterilization by vacuuming using a Millipore filter sterilization tube. Make 10 mL aliquots (1 mg/mL) and store at -20 °C for up to 6 months. Place at 4 °C overnight before use. |
EGF | Thermo Scientific | 236-EG-01M | When preparing 100 ng/mL EGF reconstitute 500 µg/mL in sterile PBS. Next add 2 mL of sterile PBS to 1 mg EGF and make 500 µg/mL EGF solution. Aliquot 100 µL of EGF in 20 tubes. |
Fisherbrand 6 cm Petri Dishes with Clear Lid | Fisher | FB0875713A | N/A |
Fisherbrand Cell Lifter | Fisher | 08-100-240 | N/A |
Fisherbrand Class B Clear Glass Threaded Vials with Closures Attached | Fisher | 03-338B | N/A |
Fisherbrand Disposable Borosilicate Glass Pasteur Pipette | Fisher | 13-678-2D0 | N/A |
Fluoromount G Slide Mounting Medium | VWR | 100241-874 | N/A |
Gibco advanced DMEM | Gibco | 12-491-023 | N/A |
Goat anti-E-Cadherin | R&D systems | AF648 | 1:400 dilution (Primary antibody) |
Goat anti-SOX17 | R&D systems | AF1924 | 1:500 dilution (Primary antibody) |
HCOs patterning medium | N/A | N/A | Basic gut medium, 100 ng/mL EGF and 100 ng/mL BMP2. When preparing BMP2, add 1 mL of sterile 4 mM HCl 0.1% BSA to BMP2 vials (100 µg). Aliquot 25 µL of BMP4 solution in 4 tubes. The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors. |
Hemocytometer | Sigma-Aldrich | Z359629 | N/A |
Human Pluripotent Stem Cells (hPSC) | Pluripotent Stem Cell Facility | N/A | Cells seeded in a Matrigel coated 24-well plate (Thermo Scientific 73520-906). |
Ice-cold 4% Paraformaldehyde solution (PFA) | N/A | N/A | N/A |
Ice-cold Phosphate Buffered Saline (PBS) | N/A | N/A | The pH must be 7.4. |
ImmEdge Hydrophobic Barrier Pen | Vector Laboratories | 101098-065 | N/A |
Induced Pluripotent Stem Cells (iPSCs) | Pluripotent Stem Cell Facility (Cincinnati Children's Hospital Medical Center) | N/A | Other hESC or iPSC lines can be used, but the protocol needs to be optimized for each cell line. |
Leica microtome | N/A | N/A | N/A |
LSM 880 | confocal microscope | ||
Matrigel Basement Membrane Matrix | Corning | 354234 | N/A |
Matrigel hESC-qualified Matrix | Corning | 354277 | Prepare 4 x Matrigel aliquots which corresponds to volumes sufficient to make enough diluted Matrigel for 4 x 6-well dishes. |
Mid-hindgut induction medium (RPMI 1640) | Corning | MT10041CV | Nonessential amino acids (Corning 11140050), 2% FBS vol/vol (Hyclone SH30070.03T), 3 µM CHIR99021 and 500 ng/mL FGF4. The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors. |
Mid-hindgut spheroids | N/A | N/A | N/A |
MilliporeSigma Steriflip Sterile Disposable Vacuum Filter Units | MilliporeSigma | SCGP00525 | N/A |
Mouse anti-CDX2 | BioGenex | MU392-UC | 1:300 dilution (Primary antibody) |
Mouse anti-FOXA2 | Abnova/Novus | H00003170-M01 | 1:500 dilution |
mTeSR1 complete growth medium | Stem Cell technologies | 85870 | Add 100-mL of mTeSR supplement (85870) into one 400-mL mTeSR medium (85870) and aliquot into 50-mL tubes while avoiding contamination. Store at 4°C until use. |
Murray's Clear solution (Also known as BABB) | Murray's | N/A | 1:2 benzyl benzoate and benzyl alcohol. |
NOG HIO patterning medium | N/A | N/A | Basic gut medium, 100 ng/mL EGF and 100 ng/mL NOGGIN (Dispense 25 µg of NOGGIN in 250 µl sterile PBS with 0.1% BSA). |
NucleoSpin RNA | Takara | 740955.25 | Other RNA isolation kits may be used. |
Nunclon delta surface tissue culture dish 24-wells (Nunc) | Thermo Scientific | 73521-004 | N/A |
Nunclon delta surface tissue culture dish 24-wells coated with Matrigel | Thermo Scientific | 73521-004 | N/A |
Nunclon delta surface tissue culture dish 6-wells (Nunc) | Thermo Scientific | 73520-906 | N/A |
Nunclon delta surface tissue culture dish 6-wells coated with Matrigel. | Thermo Scientific | 73520-906 | N/A |
Outgrowth medium for HIOs, CTRL HIOs, and HCOs | N/A | N/A | Basic gut medium and 100 ng/mL EGF (Final concentration) |
Phosphate Buffer Saline, 0.5% Triton X (PBS-T) | N/A | N/A | N/A |
Primers | Integrated DNA Technologies, Inc. (IDT) | N/A | The primers are listed in Table 2 on the protocol. |
Rabbit anti-CDX2 | Cell Marque | EPR22764Y | 1:100 dilution (Primary antibody) |
Rabbit anti-SATB2 | Cell Marque | EP281 | 1:100 dilution (Primary antibody) |
Recombinant Human BMP-4 Protein | R&D systems | 314-BP-010 | Reconstitute the lyophilized powder at 100 µg/mL in sterile 4 mM HCl containing 0.1% bovine serum albumin (BSA). Add 4.17 mL HCl solution to 45.83 mL molecular water totaling to 50 mL of 1 M HCl. Then add 200 µL of 1 M HCl to 49.8 mL of molecular grade water totaling to 50 mL of 4 mM HCl. Next add 0.05 g BSA to 50 mL of 4 mM HCl and filter to make sterile. Aliquot sterile 4 mM HCl 0.1% BSA to 33 microcentrifuge tube totaling and store at -20 °C. Add 100 µl of sterile 4 mM HCl 0.1% BSA to the BMP4 vials (10 µg) to make BMP4 solution at 100 µg/mL. |
Recombinant Human FGF-4 Protein | R&D systems | 235-F4-01M | Reconstitute at 100 µg/mL in sterile PBS containing 0.1% bovine serum albumin. Add 0.05 g of BSA in 50 mL of PBS to make 0.1% BSA. Filter 0.22 µM BSA to sterilize the BSA. Aliquot 10 mL of 0.1% BSA in 5 tubes. Add 1 mg FGF-4 in 10 mL of sterile 0.1% BSA. Aliquot 250 µL into prechilled 40 microcentrifuge tubes and store at -80 °C. |
ROCK inhibitor Y-27632 | Tocris | 1254 | The final concentration is 10 mM (10 mmol/L). Resuspend in DMSO at 10 mM and filter sterilize. Add 3 mL of sterile PBS to each vial. Aliqout 100 µL of ROCK inhibitor in 30 tubes and store at -20 °C. |
SuperScript VILO cDNA Synthesis Kit | Thermo Scientific | 11-754-250 | N/A |
SuperFrost Plus microscope slides | |||
Tissue Tek O.C.T Compound | VWR | 25608-930 | N/A |
Zapytaj o uprawnienia na użycie tekstu lub obrazów z tego artykułu JoVE
Zapytaj o uprawnieniaThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. Wszelkie prawa zastrzeżone