Extending the deepest gratitude for funding support provided by the National Institutes of Health (R01AR078551 and T32AR007411), the Dystrophic Epidermolysis Bullosa Research Association (DEBRA) Austria, the Gates Grubstake Fund and the Gates Frontiers Fund.

Detecting Off-Target CRISPR-Cas9 Cleavage Events with CIRCLE-Seq

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Frangoul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+gene+editing+for+sickle+cell+disease+and+beta-thalassemia.">CRISPR-Cas9 gene editing for sickle cell disease and beta-thalassemia.</a> N Engl J Med. 384 (3), 252-260 (2021).</li><li>Ledford, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+treatment+inserted+directly+into+the+body+for+first+time.">CRISPR treatment inserted directly into the body for first time.</a> Nature. 579 (7798), 185 (2020).</li><li>Gillmore, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+in+vivo+gene+editing+for+transthyretin+amyloidosis.">CRISPR-Cas9 in vivo gene editing for transthyretin amyloidosis.</a> N Engl J Med. 385 (6), 493-502 (2021).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat Biotechnol. 31 (9), 822-826 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat Biotechnol. 31 (9), 827-832 (2013).</li><li>Anzalone, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Search-and-replace+genome+editing+without+double-strand+breaks+or+donor+DNA.">Search-and-replace genome editing without double-strand breaks or donor DNA.</a> Nature. 576 (7785), 149-157 (2019).</li><li>Hong, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+base+editing+and+prime+editing+of+COL7A1+mutations+in+recessive+dystrophic+epidermolysis+bullosa.">Therapeutic base editing and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosa.</a> Mol Ther. 30 (8), 2664-2679 (2022).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+prime+editing+via+xrRNA+motif-joined+pegRNA.">Enhancement of prime editing via xrRNA motif-joined pegRNA.</a> Nat Commun. 13 (1), 1856 (2022).</li><li>Lee, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prime+editing+with+genuine+Cas9+nickases+minimizes+unwanted+indels.">Prime editing with genuine Cas9 nickases minimizes unwanted indels.</a> Nat Commun. 14 (1), 1786 (2023).</li><li>Howe, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertional+mutagenesis+combined+with+acquired+somatic+mutations+causes+leukemogenesis+following+gene+therapy+of+SCID-X1+patients.">Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.</a> J Clin Invest. 118 (9), 3143-3150 (2008).</li><li>Hacein-Bey-Abina, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertional+oncogenesis+in+4+patients+after+retrovirus-mediated+gene+therapy+of+SCID-X1.">Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1.</a> J Clin Invest. 118 (9), 3132-3142 (2008).</li><li>Has, C., Kiritsi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapies+for+inherited+skin+fragility+disorders.">Therapies for inherited skin fragility disorders.</a> Exp Dermatol. 24 (5), 325-331 (2015).</li><li>Murnane, J. P., Yezzi, M. J., Young, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+events+during+integration+of+transfected+DNA+into+normal+human+cells.">Recombination events during integration of transfected DNA into normal human cells.</a> Nucleic Acids Res. 18 (9), 2733-2738 (1990).</li><li>Hsieh, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myelodysplastic+syndrome+unrelated+to+lentiviral+vector+in+a+patient+treated+with+gene+therapy+for+sickle+cell+disease.">Myelodysplastic syndrome unrelated to lentiviral vector in a patient treated with gene therapy for sickle cell disease.</a> Blood Advances. 4 (9), 2058-2063 (2020).</li><li>Tsai, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GUIDE-seq+enables+genome-wide+profiling+of+off-target+cleavage+by+CRISPR-Cas+nucleases.">GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.</a> Nat Biotechnol. 33 (2), 187-197 (2015).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbiased+detection+of+off-target+cleavage+by+CRISPR-Cas9+and+TALENs+using+integrase-defective+lentiviral+vectors.">Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.</a> Nat Biotechnol. 33 (2), 175-178 (2015).</li><li>Lensing, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DSBCapture:+In+situ+capture+and+sequencing+of+DNA+breaks.">DSBCapture: In situ capture and sequencing of DNA breaks.</a> Nat Methods. 13 (10), 855-857 (2016).</li><li>Crosetto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide-resolution+DNA+double-strand+break+mapping+by+next-generation+sequencing.">Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing.</a> Nat Methods. 10 (4), 361-365 (2013).</li><li>Yan, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLISS+is+a+versatile+and+quantitative+method+for+genome-wide+profiling+of+DNA+double-strand+breaks.">BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks.</a> Nat Commun. 8, 15058 (2017).</li><li>Kim, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digenome-seq:+Genome-wide+profiling+of+CRISPR-Cas9+off-target+effects+in+human+cells.">Digenome-seq: Genome-wide profiling of CRISPR-Cas9 off-target effects in human cells.</a> Nat Methods. 12 (3), 237-243 (2015).</li><li>Cameron, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+the+genomic+landscape+of+CRISPR-Cas9+cleavage.">Mapping the genomic landscape of CRISPR-Cas9 cleavage.</a> Nat Methods. 14 (6), 600-606 (2017).</li><li>Wienert, B., Wyman, S. K., Yeh, C. D., Conklin, B. R., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+off-target+detection+with+DISCOVER-seq.">CRISPR off-target detection with DISCOVER-seq.</a> Nat Protoc. 15 (5), 1775-1799 (2020).</li><li>Guo, C., Ma, X., Gao, F., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+effects+in+CRISPR/Cas9+gene+editing.">Off-target effects in CRISPR/Cas9 gene editing.</a> Front Bioeng Biotechnol. 11, 1143157 (2023).</li><li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inference+of+CRISPR+edits+from+Sanger+trace+data.">Inference of CRISPR edits from Sanger trace data.</a> CRISPR J. 5 (1), 123-130 (2022).</li><li>Lazzarotto, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+CRISPR-Cas9+genome-wide+nuclease+activities+with+CIRCLE-seq.">Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq.</a> Nat Protoc. 13 (11), 2615-2642 (2018).</li><li>Butterfield, K. T., McGrath, P. S., Han, C. M., Kogut, I., Bilousova, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+an+induced+pluripotent+stem+cell+line+with+the+constitutive+EGFP+reporter.">Generation of an induced pluripotent stem cell line with the constitutive EGFP reporter.</a> Methods Mol Biol. 2155, 11-21 (2020).</li><li>Hayashi, H., Kubo, Y., Izumida, M., Matsuyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+viral+delivery+of+Cas9+into+human+safe+harbor.">Efficient viral delivery of Cas9 into human safe harbor.</a> Sci Rep. 10 (1), 21474 (2020).</li><li>Kogut, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+RNA-based+reprogramming+of+human+primary+fibroblasts.">High-efficiency RNA-based reprogramming of human primary fibroblasts.</a> Nat Commun. 9 (1), 745 (2018).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+The+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: The impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Bao, X. R., Pan, Y., Lee, C. M., Davis, T. H., Bao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+experimental+and+computational+analyses+of+off-target+editing+by+programmable+nucleases.">Tools for experimental and computational analyses of off-target editing by programmable nucleases.</a> Nat Protoc. 16 (1), 10-26 (2021).</li><li>Cromer, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+CRISPR+off-target+discovery+tools+following+ex+vivo+editing+of+CD34(+)+hematopoietic+stem+and+progenitor+cells.">Comparative analysis of CRISPR off-target discovery tools following ex vivo editing of CD34(+) hematopoietic stem and progenitor cells.</a> Mol Ther. 31 (4), 1074-1087 (2023).</li></ol>

The authors have nothing to disclose.

Here, CIRCLE-seq is demonstrated to be an unbiased and highly sensitive technique for identifying nuclease-induced DSBs across the genome resulting from targeting the AAVS1 locus in gDNA derived from iPSCs. The AAVS1 site within iPSCs is well-known as a safe harbor locus that is often used as an integration site of exogenous genes using CRISPR-Cas928. Our recent report studied the potential of EGFP-labeled iPSCs by performing CRISPR-mediated integration of a constitutively expressed EGFP reporter into the AAVS1 site, which enables labeling and tracking of both iPSCs and differentiated iPSCs due to the persistence of EGFP throughout the cell&#39;s lineage27. This iPSC line can be used in vivo to evaluate the organismal distribution of iPSC-derived cells after transplantation. As this cell line has been CRISPR-modified and is also being used to test the clinical application of iPSCs, it is imperative that the potential AAVS1 off-target sites are known and interrogated to ensure safety and efficacy, making it an ideal locus to test CIRCLE-seq.
A notable difference between Butterfield et al., previously published&#160;study27 and this one was the use of a modified gRNA to target the AAVS1 locus. A gRNA can be designed to improve genome editing accuracy24. The guide sequence is the most critical factor that influences on- and off-target efficiencies. Therefore, the chosen gRNA was tested against several other guides and found to have superior fidelity. In addition, a methods article on reprogramming human fibroblasts substantiated the finding that synthetic capped mRNAs containing modified nucleobases benefit from low activation of antiviral responses29,30. While low immunogenicity might not be relevant in an in vitro assay, it becomes crucial when the ultimate goal is to develop a clinically relevant therapy that can be used in living cells.
CIRCLE-seq holds many advantages over similar methods. For instance, Digenome-seq sequences both nuclease-cleaved and uncleaved gDNA, using ~400 million reads21. This results in a high background, making it challenging to filter out low-frequency bona fide cut sites. CIRCLE-seq only uses ~3-5 million reads due to the enrichment of nuclease-cleaved gDNA, resulting in low background. Additionally, Digenome-seq and a similar method, SITE-seq, rely on sequencing a single nuclease-cleaved DNA end. In contrast, CIRCLE-seq reads include both ends of the cut site, enabling the identification of off-target sites without the need for a reference21,22,26.
An advantage of CIRCLE-seq is its greater sensitivity compared to the methods that rely on cell culture, such as GUIDE-seq. When the two methods were compared, CIRCLE-seq was able to capture all off-target sites detected by GUIDE-seq and uncovered additional unintended cleavage sites that GUIDE-seq had missed. However, a notable difference is that GUIDE-seq may be hindered by the epigenetic landscape, whereas CIRCLE-seq can access the entire genome.
As an in vitro assay, CIRCLE-seq presents several limitations, the first of which is the detection of false positives. Whereas epigenetics will impede nuclease activity at certain sites in vivo, ultrasonication removes these obstacles in vitro, allowing off-target activity at locations that may not normally be accessible in a cellular context. Furthermore, Cas9 is present at high concentrations in this in vitro assay, permitting cleavage that would not otherwise be possible in vivo. This assay also requires a relatively large amount of starting gDNA, which, depending on available resources, can negate the use of this protocol. Lastly, it is possible for some off-target sites to be undetectable due to the limitations of current next-gen sequencing technologies.
A recent study used an in silico approach whose algorithm identified a number of relevant parameters with which to compare different nuclease characterization methods, including CIRCLE-seq and GUIDE-seq31. Two of the relevant parameters were &#39;cut-site enrichment&#39; and &#39;% false positives&#39;. Interestingly, CIRCLE-seq&#39;s false-positive rate was calculated at 88%, but its cut-site enrichment was folds higher than the other in vitro methods. Comparative analyses of every method revealed that GUIDE-seq was the best performer, as it demonstrated the greatest on-target specificity with only a moderate false-positive rate32. This does not invalidate CIRCLE-seq, but rather hints at the possibility of utilizing CIRCLE-seq and GUIDE-seq in tandem, validating CIRCLE-seq&#39;s findings with GUIDE-seq since the former has higher sensitivity, while the latter is a cell-based method with high cut-site enrichment. Data also indicate that amplicon-based next-generation sequencing (NGS) should be the preferred method for identifying genuine off-target modifications at potential candidate sites31. This data suggests a potential strategy of using CIRCLE-seq, followed by GUIDE-seq, and then amplicon-based NGS to examine off-target effects.

Genome engineering has seen significant advancements over the past twenty years, with a major milestone being the discovery of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 in 20121. Leveraging the programmable nature of bacterial DNA endonucleases, CRISPR-Cas9 technology enables precise targeting and modification of almost any DNA sequence. Since its inception, the system has been optimized to rely only on the Cas9 endonuclease and a guide RNA (gRNA) to edit specific genomic regions. CRISPR-Cas9&#39;s potential as a curative therapy has been demonstrated in clinical trials for various conditions such as Leber&#39;s congenital amaurosis, transthyretin amyloidosis, and sickle cell anemia, among others2,3,4.
CRISPR-Cas9 induces double-stranded breaks (DSBs), which are typically resolved by one of two mechanisms: the error-prone non-homologous end joining (NHEJ) or the more precise homology-directed repair (HDR), provided a template DNA is available. The tendency of CRISPR-Cas9 to cause NHEJ-associated insertions and deletions (indels), along with cleavage at unintended genomic sites, limits its application in clinical settings5,6,7,8,9,10. Additionally, unintended genomic modifications can create cryptic splice sites, nonsense or missense mutations, induce chromothripsis, or confer oncogenic potential to cells-outcomes that have been observed in several genome editing trials11,12,13,14,15. In conclusion, accurately identifying the off-target activity of CRISPR-Cas9 is crucial for its clinical applications, particularly in systemic gene therapies that may alter billions of cells.
Various methods can be employed to identify CRISPR-Cas9 off-target cleavage sites, including Genome-wide Unbiased Identification of Double-stranded breaks (GUIDE)-seq16, which uses double-stranded oligodeoxynucleotides to tag DSBs in living cells. Nevertheless, a criticism of this method is that false positives can arise from random DSBs or from PCR artifacts, which must be discarded by excluding captured sites that show poor similarity to the on-target sites. The method based on the use of Integrase-Defective Lentiviral Vector (IDLV) is less sensitive and likely to miss many off-target sites17. Other in situ methods like DSBCapture, BLESS, and BLISS18,19,20 involve fixed cells and label DSBs directly, however they are constrained by their dependency on immediate DSB capture and the absence of exogenous DNA. Digenome-seq21, an in vitro method, and Selective enrichment and Identification of Tagged genomic DNA Ends by sequencing (SITE-seq)22 both provide sequencing solutions but have their limitations in background noise and single-end analysis, respectively. Discovery of in situ Cas off-targets and verification by sequencing (Discover-Seq)23 offers in vivo and in situ identification of Cas9 activity via MRE11 binding, but only detects DSBs that exist at the time of sample preparation24. Lastly, Inference of CRISPR Edits (ICE) uses a bioinformatics approach to robustly analyze CRISPR edits using Sanger data25.
This article describes a detailed procedure for Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq): an in vitro&#160;technique that sensitively and impartially maps the genome-wide off-target activity of Cas9 nuclease in a complex with the gRNA of interest26. This approach begins with culturing the cells of interest and isolating DNA, followed by random shearing through focused ultrasonication, then exonuclease and ligase treatment. This process ultimately produces circular double-stranded DNA molecules, which are then purified through plasmid-safe DNase treatment. This circular DNA is then exposed to the Cas9-gRNA complex, which cleaves at both intended and unintended cleavage sites, leaving behind exposed DNA ends that act as substrates for Illumina adapter ligation. This process produces a diverse library of genomic DNA (gDNA) containing both ends of each nuclease-induced DSB, ensuring that each read has all the information necessary for each cleavage site. This allows for the use of Illumina sequencing with lower sequencing coverage requirements, setting CIRCLE-seq apart from other similar methods mentioned above. It is important to note that while CIRCLE-seq does have higher off-target sensitivity than other protocols as an in vitro method, this comes at the cost of higher false-positives due to the absence of the epigenetic landscape that is present in other methods such as GUIDE-seq16. Additionally, DSB DNA repair and its associated machinery are not present in CIRCLE-seq, abrogating indels or proper repair that would otherwise be observed.
In addition to describing the step-by-step protocol to perform CIRCLE-seq, the protocol is validated by identifying genome-wide unintended cleavage sites of CRISPR-Cas9 that occur during the modification of the AAVS1 locus, as an example. This easy-to-follow protocol provides detailed instructions, from the culture of induced pluripotent stem cells (iPSCs) and gDNA isolation to gDNA circularization, Cas9-gRNA cleavage, library preparation, sequencing, and pipeline analysis. Given the low sequencing coverage requirements, CIRCLE-seq is available to any lab with access to next-generation sequencing.

<table><tbody><tr><td>0.2-mL Thin-walled Tubes and Flat Caps</td><td>ThermoFisher Scientific</td><td>AB1114</td><td></td></tr><tr><td>1.5% PippinHT cassette</td><td>Sage Science</td><td>HTC1510</td><td></td></tr><tr><td>10 mL Serological Pipettes&amp;nbsp;</td><td>FisherScientific</td><td>12567603</td><td></td></tr><tr><td>15 mL Conical Tube</td><td>FisherScientific</td><td>339651</td><td></td></tr><tr><td>150 x 25 mm Tissue Culture Dish&amp;nbsp;</td><td>FisherScientific</td><td>877224</td><td></td></tr><tr><td>25 mL Reagent Reservoir&amp;nbsp;</td><td>FisherScientific</td><td>2138127C</td><td></td></tr><tr><td>2x Kapa KiFi HotStart Ready Mix&amp;nbsp;</td><td>Kapa Biosystems</td><td>KK2602</td><td></td></tr><tr><td>5 mL Serological Pipettes&amp;nbsp;</td><td>FisherScientific</td><td>170355</td><td></td></tr><tr><td>50 mL Conical Tube</td><td>FisherScientific</td><td>339653</td><td></td></tr><tr><td>50x TAE Electrophoresis Buffer&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>B49</td><td></td></tr><tr><td>6 Well Cell Culture Plate</td><td>Corning</td><td>3516</td><td></td></tr><tr><td>Agencourt AMPure XP Reagent, 60 mL</td><td>Beckman Coulter</td><td>A63881</td><td></td></tr><tr><td>Benchtop Microcentrifuge&amp;nbsp;</td><td>Eppendorf</td><td>5400002</td><td></td></tr><tr><td>BsaI-HF&amp;nbsp;</td><td>New England BioLabs</td><td></td><td></td></tr><tr><td>Buffer QX1</td><td>Qiagen</td><td>20912</td><td></td></tr><tr><td>Cas9 nuclease, &lt;em&gt;Streptococcus Pyogenes&amp;nbsp;&lt;/em&gt;</td><td>New England BioLabs</td><td>M0386M</td><td></td></tr><tr><td>CIRCLE-seq Library Preparation and NGS</td><td></td><td></td><td></td></tr><tr><td>Corning Matrigel hESC-Qualified Matrix</td><td>Corning</td><td>354277</td><td>Extracellular matrix (ECM) for culturing iPSCs</td></tr><tr><td>ddPCR SuperMix for Probes&amp;nbsp;</td><td>Bio-Rad</td><td>1863010</td><td></td></tr><tr><td>DG8 Cartridge Holder&amp;nbsp;</td><td>Bio-Rad</td><td>1863051</td><td></td></tr><tr><td>DG8 Cartridges&amp;nbsp;</td><td>Bio-Rad</td><td>1864008</td><td></td></tr><tr><td>DG8 Gaskets&amp;nbsp;</td><td>Bio-Rad</td><td>1863009</td><td></td></tr><tr><td>DPBS, no calcium, no magnesium</td><td>ThermoFisher Scientific</td><td>14190144</td><td>Made by Invitrogen</td></tr><tr><td>Droplet Generation Oil for Probes&amp;nbsp;</td><td>Bio-Rad</td><td>1863005</td><td></td></tr><tr><td>Droplet Reader Oil&amp;nbsp;</td><td>Bio-Rad</td><td>1863004</td><td></td></tr><tr><td>EDTA (0.5 M)</td><td>ThermoFisher Scientific</td><td>15575020</td><td></td></tr><tr><td>EDTA (0.5 M), pH 8.0, RNase-free</td><td>ThermoFisher Scientific</td><td>AM9260G</td><td>Made by Invitrogen</td></tr><tr><td>Eppendorf&amp;nbsp; ThermoMixer&amp;nbsp;</td><td>Eppendorf</td><td>5384000020</td><td></td></tr><tr><td>Equipment</td><td></td><td></td><td></td></tr><tr><td>Ethyl Alcohol, Pure</td><td>Sigma-Aldrich</td><td>E7023</td><td></td></tr><tr><td>Exonuclease I&amp;nbsp;</td><td>New England BioLabs</td><td>M0293L</td><td>&lt;em&gt;E. coli&lt;/em&gt;</td></tr><tr><td>Filter Unit&amp;nbsp;</td><td>FisherScientific</td><td>FB0875713</td><td></td></tr><tr><td>Filtered Sterile Pipette Tips</td><td></td><td></td><td></td></tr><tr><td>Focused Ultrasonicator&amp;nbsp;</td><td>Covaris</td><td>ME220</td><td></td></tr><tr><td>Genomic DNA Isolation</td><td></td><td></td><td></td></tr><tr><td>Genomic DNA Shearing</td><td></td><td></td><td></td></tr><tr><td>Gentra Puregene Cell Core Kit&amp;nbsp;</td><td>Qiagen</td><td>158043</td><td></td></tr><tr><td>gRNAs</td><td>Synthego</td><td></td><td></td></tr><tr><td>HCl</td><td>ThermoFisher Scientific</td><td>A144500</td><td></td></tr><tr><td>Heracell VIOS Tri-gas Humidified Tissue Culture Incubator</td><td>ThermoFisher Scientific</td><td>51030411</td><td>Need for culturing and expanding iPSCs (37 &amp;deg;C/5% CO2/5% O2)</td></tr><tr><td>High Sensitivity D1000 DNA ScreenTape</td><td>Agilent</td><td>5067-5584</td><td></td></tr><tr><td>High Sensitivity D1000 Reagents</td><td>Agilent</td><td>5067-5585</td><td></td></tr><tr><td>HTP Library Preparation Kit&amp;nbsp;</td><td>Kapa Biosystems</td><td>KK8235</td><td></td></tr><tr><td>HyClone Antibiotic Antimycotic Solution</td><td>Cytiva</td><td>SV30079.01</td><td></td></tr><tr><td>IDTE pH 8.0 (1x TE Solution)</td><td>Integrated DNA Technologies</td><td>11050204</td><td></td></tr><tr><td>Inverted Microscope</td><td></td><td></td><td>Need for imaging iPS colonies in bright-field and fluorescent channels</td></tr><tr><td>iPSC Culture</td><td></td><td></td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>190764</td><td></td></tr><tr><td>Lambda Exonuclease&amp;nbsp;</td><td>New England BioLabs</td><td>M0262L</td><td></td></tr><tr><td>Loading Tips, 10 pack</td><td>Agilent</td><td>5067-5599</td><td></td></tr><tr><td>Magnum FLX Enhanced Universal Magnet Plate&amp;nbsp;</td><td>Alpaqua</td><td>A00400</td><td></td></tr><tr><td>Microcentrifuge Tube</td><td>Axygen</td><td>31104051</td><td></td></tr><tr><td>Microtube AFA Fiber Pre-Slit Snap-Cap&amp;nbsp;</td><td>Covaris</td><td>520045</td><td></td></tr><tr><td>mTeSR-1 5x Supplement</td><td>StemCell Technology</td><td>85852</td><td></td></tr><tr><td>mTeSR-1 Basal Medium (400 mL)</td><td>StemCell Technology</td><td>85851</td><td>Media for maintaining iPSC in culture</td></tr><tr><td>Nanodrop 8000 Spectrophotometer&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>ND-8000-GL</td><td></td></tr><tr><td>NEBNext Multiplex Oligos for Illumina&amp;nbsp;</td><td>New England BioLabs</td><td>E7600S</td><td>Dual Index Primers Set 1</td></tr><tr><td>Optical tube strip caps, 8x strip</td><td>Agilent</td><td>401425</td><td></td></tr><tr><td>Optical tube strips, 8x strip</td><td>Agilent</td><td>401428</td><td></td></tr><tr><td>Other Reagents</td><td></td><td></td><td></td></tr><tr><td>PCR Plate Sealer&amp;nbsp;</td><td>Bio-Rad</td><td>PX1</td><td>Model Number PX1</td></tr><tr><td>PEG/NaCl SPRI Solution&amp;nbsp;</td><td>Kapa Biosystems</td><td></td><td></td></tr><tr><td>Phusion Hot Start Flex 2x Master Mix&amp;nbsp;</td><td>New England BioLabs</td><td>M0536L</td><td></td></tr><tr><td>Pierceable Foil Heat Seal&amp;nbsp;</td><td>Bio-Rad</td><td>1814040</td><td></td></tr><tr><td>Plasmid-Safe ATP-dependent DNase&amp;nbsp;</td><td>Epicentre</td><td>E3110K</td><td></td></tr><tr><td>Primers, Adapters and Probes</td><td>IDT</td><td></td><td>Sequences are listed in Table 1</td></tr><tr><td>Proteinase K&amp;nbsp;</td><td>Qiagen</td><td>19131</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit&amp;nbsp;</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>QIAxcel Gel Analysis System&amp;nbsp;</td><td>Qiagen</td><td>9001941</td><td></td></tr><tr><td>Qubit Assay Tubes</td><td>ThermoFisher Scientific</td><td>Q32856</td><td></td></tr><tr><td>Qubit dsDNA BR Assay Kit&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q32853</td><td></td></tr><tr><td>Qubit dsDNA BR Assay Kit&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q32853</td><td></td></tr><tr><td>Qubit dsDNA HS Assay Kit&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q32854</td><td></td></tr><tr><td>Qubit Fluorometer&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q33226</td><td></td></tr><tr><td>QX200 Droplet Digital PCR System</td><td>Bio-Rad</td><td>1864001</td><td>Contain a QX200 droplet generator and a QX200 droplet reader</td></tr><tr><td>RNase A</td><td>Qiagen</td><td>19101</td><td></td></tr><tr><td>Semi-skirted PCR Plate&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>14230244</td><td></td></tr><tr><td>SeqPlaque GTG Agarose&amp;nbsp;</td><td>Lonza</td><td>50110</td><td></td></tr><tr><td>SYBR Safe DNA Gel Stain&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>S33102</td><td></td></tr><tr><td>T4 DNA Ligase&amp;nbsp;</td><td>New England BioLabs</td><td>M0202L</td><td></td></tr><tr><td>T4 Polynucleotide Kinase (PNK)</td><td>New England BioLabs</td><td>M0201L</td><td></td></tr><tr><td>T-75 Flasks&amp;nbsp;</td><td>FisherScientific</td><td>7202000</td><td></td></tr><tr><td>Tapestation 4150</td><td>Agilent</td><td>G2992AA</td><td></td></tr><tr><td>Thermocycler with programmable temperature-stepping functionality</td><td>Bio-Rad C1000 Touch</td><td></td><td></td></tr><tr><td>Tris base</td><td>ThermoFisher Scientific</td><td>BP1521</td><td></td></tr><tr><td>Twin.tec PCR Plate&amp;nbsp;</td><td>Eppendorf</td><td>E951020346</td><td>96 wells, semi-skirted, green</td></tr><tr><td>UltraPure DNase/RNase-Free Distilled Water&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>10977015</td><td></td></tr><tr><td>USER Enzyme&amp;nbsp;</td><td>New England BioLabs</td><td>M5505L</td><td></td></tr></tbody></table>

circle-seq for interrogation of off-target gene editing

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of unintended cleavage sites of CRISPR-Cas9 through targeted sequencing of CRISPR-Cas9 cleaved DNA. The protocol involves circularizing genomic DNA (gDNA), which is subsequently treated with the Cas9 protein and a guide RNA (gRNA) of interest. Following treatment, the cleaved DNA is purified and prepared as a library for Illumina sequencing. The sequencing process generates paired-end reads, offering comprehensive data on each cleavage site. CIRCLE-seq provides several advantages over other in vitro methods, including minimal sequencing depth requirements, low background, and high enrichment for Cas9-cleaved gDNA. These advantages enhance sensitivity in identifying both intended and unintended cleavage events. This study provides a comprehensive, step-by-step procedure for examining the off-target activity of CRISPR-Cas9 using CIRCLE-seq. As an example, this protocol is validated by mapping genome-wide unintended cleavage sites of CRISPR-Cas9 during the modification of the AAVS1 locus. The entire CIRCLE-seq process can be completed in two weeks, allowing sufficient time for cell growth, DNA purification, library preparation, and Illumina sequencing. The input of sequencing data into the CIRCLE-seq pipeline facilitates streamlined interpretation and analysis of cleavage sites.

Here, CIRCLE-seq is utilized to investigate the nuclease-induced cleavage sites of Cas9 in a complex with the gRNA designed to target the adeno-associated virus integration site 1 (AAVS1) using DNA isolated from induced pluripotent stem cells (iPSCs). This gRNA was previously described in our publication27. Approximately 25 &#956;g of gDNA was isolated from iPSCs, sheared through focused ultrasonication, and size selected using AMPure XP bead purification to yield fragments of approx. 300 bps. From this 25 &#956;g of DNA, approx. 2-5 ng of DNA was successfully circularized for in vitro Cas9:gRNA cleavage. The entire procedure is depicted in Figure 1.
Following a CIRCLE-seq procedure and analysis using our computation workflow, a visualization of all detected on- and off-target cleavage sites is presented in Figure 2A. The CIRCLE-seq pipeline also provided &#39;merged reads&#39;, analyzed via R statistical software to yield a Manhattan plot showing the detected nuclease-induced cleavage sites mapped along each chromosome (Figure 2B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/67069/67069fig01.jpg" /> 
Figure 1: CIRCLE-seq workflow schematics. Major steps of the protocol are indicated. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/67069/67069fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/67069/67069fig02.jpg" /> 
Figure 2: CIRCLE-seq visualization and Manhattan Plot. (A) Alignment of off-target sites against the intended target for the AAVS1 locus. The target sequence is displayed at the top, where off-targets are ranked by read count in descending order. Differences in the original target sequences are shown by colored nucleotides. A sample of the top unintended cleavage sites for the AAVS1 locus is shown. (B) Manhattan plot illustrating the detected unintended cleavage sites for the AAVS1 locus. Bar heights represent read counts for each chromosomal position. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/67069/67069fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence (5&#39;-3&#39;)</td>
			<td>Comments/Description</td>
		</tr>
		<tr>
			<td>AAVS1 Single guide RNA (sgRNA)</td>
			<td>GGGGCCACUAGGGACAGGAU</td>
			<td>For AAVS1 Locus&#39; Fluorescent Protein Knock-In</td>
		</tr>
		<tr>
			<td>AAVS1 Forward Primer</td>
			<td>GCTCTGGGCGGAGGAATATG</td>
			<td>For gRNA in vitro cleavage test</td>
		</tr>
		<tr>
			<td>AAVS1 Reverse Primer</td>
			<td>ATTCCCAGGGCCGGTTAATG</td>
			<td>For gRNA in vitro cleavage test</td>
		</tr>
		<tr>
			<td>oSQT1288</td>
			<td>/5Phos/CGGTGGACCGATGATC /ideoxyU/ATCGGTCCACCGaT</td>
			<td>CIRCLE-seq hairpin adapter</td>
		</tr>
		<tr>
			<td>oSQT1274</td>
			<td>AATGATACGGCGACCACCGAG</td>
			<td>TruSeq F1</td>
		</tr>
		<tr>
			<td>oSQT1275</td>
			<td>CAAGCAGAAGACGGCATACGAGAT</td>
			<td>TruSeqF2</td>
		</tr>
		<tr>
			<td>oSQT1310</td>
			<td>/56-FAM/CCTACACGA/ZEN/CGCTCTTCCGATCT/3IABkFQ/</td>
			<td>TruSeq probe</td>
		</tr>
		<tr>
			<td>oSQT1311</td>
			<td>/5HEX/TCGGAAGAG/ZEN/CACACGTCTGAACT/3IABkFQ/</td>
			<td>TruSeq probe</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of gRNA and primers used for CIRCLE-seq analysis of AAVS1 locus.

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

A significant barrier to technologies like CRISPR is the off-target events that can disrupt vital genes. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is a technique designed to identify unintended cleavage sites. This method maps the genome-wide activity of CRISPR-Cas9 with high sensitivity and without bias.

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of ...

circle-seq-for-interrogation-of-off-target-gene-editing

Nanyang Technological University

Research

JoVE Journal

Genetics

487 Views.  University of Colorado School of Medicine, Anschutz Medical Campus. Ons team is toegewijd aan het ontwikkelen van geïnduceerde pluripotente stamceltherapieën, iPSC-therapieën, voor ernstige, momenteel ongeneeslijke huidziekten zoals recessieve dystrofische epidermolysis bullosa. We willen bepalen of nauwkeurige genbewerking in combinatie met de differentiatie van iPSC in huidcellen een levensvatbare behandelingsoptie kan bieden voor deze aandoeningen. Genbewerking in somatische cellen en iPSC's met behulp van CRISPR-Cas9-t...

Video: CIRCLE-Seq voor ondervraging van off-target genbewerking

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human cells has been low, which prevents the generation of human cell lines at a desired rate. The past two years have witnessed a rapid progression on improving efficiency of genetic manipulation by genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system. This manuscript describes a protocol for generating lineage specific human induced pluripotent stem cell (hiPSC) reporters using CRISPR/Cas system assisted homologous recombination. Procedures for obtaining necessary components for making neural lineage reporter lines using the CRISPR/Cas system, focusing on construction of targeting vectors and single guide RNAs, are described. This protocol can be extended to platform establishment and mutation correction in hiPSCs.

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human ...

Developmental Biology

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Cancer Research

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has quickly become a commonplace amongst researchers pursuing a wide variety of biological questions. Users most often employ the Cas9 protein derived from Streptococcus pyogenes in a complex with an easily reprogrammed guide RNA (gRNA). These components are introduced into cells, and through a base pairing with a complementary region of the double-stranded DNA (dsDNA) genome, the enzyme cleaves both strands to generate a double-strand break (DSB). Subsequent repair leads to either random insertion or deletion events (indels) or the incorporation of experimenter-provided DNA at the site of the break.
The use of a purified single-guide RNA and Cas9 protein, preassembled to form an RNP and delivered directly to cells, is a potent approach for achieving highly efficient gene editing. RNP editing particularly enhances the rate of gene insertion, an outcome that is often challenging to achieve. Compared to the delivery via a plasmid, the shorter persistence of the Cas9 RNP within the cell leads to fewer off-target events. 
Despite its advantages, many casual users of CRISPR gene editing are less familiar with this technique. To lower the barrier to entry, we outline detailed protocols for implementing the RNP strategy in a range of contexts, highlighting its distinct benefits and diverse applications. We cover editing in two types of primary human cells, T cells and hematopoietic stem/progenitor cells (HSPCs). We also show how Cas9 RNP editing enables the facile genetic manipulation of entire organisms, including the classic model roundworm Caenorhabditis elegans and the more recently introduced model crustacean, Parhyale hawaiensis.

Utilizing a preassembled Cas9 ribonucleoprotein complex (RNP) is a powerful method for precise, efficient genome editing. Here, we highlight its utility across a broad range of cells and organisms, including primary human cells and both classic and emerging model organisms.

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and effect sizes of regulatory elements to a target gene. Some progress has been made with the bioinformatic prediction of the existence and function of proximal epigenetic modifications associated with activated gene expression using conserved transcription factor binding sites. Chromatin conformation capture studies have revolutionized our ability to discover physical chromatin contacts between sequences and even within an entire genome. Circular chromatin conformation capture coupled with next-generation sequencing (4C-seq), in particular, is designed to discover all possible physical chromatin interactions for a given sequence of interest (viewpoint), such as a target gene or a regulatory enhancer. Current 4C-seq strategies directly sequence from within the viewpoint but require numerous and diverse viewpoints to be simultaneously sequenced to avoid the technical challenges of uniform base calling (imaging) with next generation sequencing platforms. This volume of experiments may not be practical for many laboratories. Here, we report a modified approach to the 4C-seq protocol that incorporates both an additional restriction enzyme digest and qPCR-based amplification steps that are designed to facilitate a greater capture of diverse sequence reads and mitigate the potential for PCR bias, respectively. Our modified 4C method is amenable to the standard molecular biology lab for assessing chromatin architecture.

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

The identification of physical interactions between genes and regulatory elements is challenging but has been facilitated by chromosome conformation capture methods. This modification to the 4C-seq protocol mitigates PCR bias by minimizing over-amplification of PCR templates and maximizes the mappability of reads by incorporating an addition restriction enzyme digest step.

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Using Sniper-Cas9 to Minimize Off-target Effects of CRISPR-Cas9 Without the Loss of On-target Activity Via Directed Evolution

The development of clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) into therapeutic modalities requires the avoidance of its potentially deleterious off-target effects. Several methods have been devised to reduce such effects. Here, we present an Escherichia coli-based directed evolution method called Sniper-screen to obtain a Cas9 variant with optimized specificity and retained on-target activity, called Sniper-Cas9. Using Sniper-screen, positive and negative selection can be performed simultaneously. The screen can also be repeated with other single-guide RNA (sgRNA) sequences to enrich for the true positive hits. By using the CMV-PltetO1 dual promoter to express Cas9 variants, the performance of the pooled library can be quickly checked in mammalian cells. Methods to increase the specificity of Sniper-Cas9 are also described. First, the use of truncated sgRNAs has previously been shown to increase Cas9 specificity. Unlike other engineered Cas9s, Sniper-Cas9 retains a wild-type (WT) level of on-target activity when combined with truncated sgRNAs. Second, the delivery of Sniper-Cas9 in a ribonucleoprotein (RNP) format instead of a plasmid format is possible without affecting its on-target activity.

Here, we present a protocol to optimize CRISPR-Cas9 to achieve a higher specificity without the loss of on-target activity. We use a directed evolution approach called Sniper-screen to find a mutant Cas9 with the desired characteristics. Sniper-Cas9 is compatible with truncated single-guide RNAs and delivery in a ribonucleoprotein format, well-known strategies for achieving higher specificities.

The development of clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) into therapeutic modalities requires the ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements that are located in neighboring TADs. CTCF plays an important role in regulating the spatial and temporal expression of HOX genes that control embryonic development, body patterning, hematopoiesis, and leukemogenesis. However, it remains largely unknown whether and how HOX loci associated CTCF boundaries regulate chromatin organization and HOX gene expression. In the current protocol, a specific sgRNA pooled library targeting all CTCF binding sites in the HOXA/B/C/D loci has been generated to examine the effects of disrupting CTCF-associated chromatin boundaries on TAD formation and HOX gene expression. Through CRISPR-Cas9 genetic screening, the CTCF binding site located between HOXA7/HOXA9 genes (CBS7/9) has been identified as a critical regulator of oncogenic chromatin domain, as well as being important for maintaining ectopic HOX gene expression patterns in MLL-rearranged acute myeloid leukemia (AML). Thus, this sgRNA library screening approach provides novel insights into CTCF mediated genome organization in specific gene loci and also provides a basis for the functional characterization of the annotated genetic regulatory elements, both coding and noncoding, during normal biological processes in the post-human genome project era.

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

A CRISPR/sgRNA library has been applied to interrogating protein-coding genes.However, the feasibility of a sgRNA library to uncover the function of a CTCF boundary in gene regulation remains unexplored. Here, we describe a HOX loci specific sgRNA library to elucidate the function of CTCF boundaries in HOX loci.

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements ...

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

Bioengineering

Genome-wide Purification of Extrachromosomal Circular DNA from Eukaryotic Cells

Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs contribute to genetic variation among somatic cells in multicellular organisms and to evolution of unicellular eukaryotes. Sensitive methods for detecting eccDNA are needed to clarify how these elements affect genome stability and how environmental and biological factors&#160;induce their formation in eukaryotic cells. This video presents a sensitive eccDNA-purification method called Circle-Seq. The method encompasses column purification of circular DNA, removal of remaining linear chromosomal DNA, rolling-circle amplification of eccDNA, deep sequencing, and mapping. Extensive exonuclease treatment&#160;was&#160;required for sufficient linear chromosomal DNA degradation. The rolling-circle amplification step by &#966;29 polymerase enriched for circular DNA over linear DNA. Validation of the Circle-Seq method on three S. cerevisiae CEN.PK populations of 1010 cells detected hundreds of eccDNA profiles in sizes larger than 1 kilobase. Repeated findings of ASP3-1, COS111, CUP1, RSC30,&#160;HXT6, HXT7 genes on circular DNA in both S288c and CEN.PK suggests that DNA circularization is conserved between strains at these loci. In sum, the Circle-Seq method has broad applicability for genome-scale screening for eccDNA in eukaryotes as well as for detecting specific eccDNA types.

This paper presents a sensitive method called Circle-Seq for purifying extrachromosomal circular DNA (eccDNA). The method encompasses column purification, removal of remaining linear chromosomal DNA, rolling-circle amplification and high-throughput sequencing. Circle-Seq is applicable to genome-scale screening of eukaryotic eccDNA and studying genome instability and copy-number variation.

Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs ...

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video