The authors thank Dr.&#160;Brian Armstrong at City of Hope, and Mindy Rodriguez at University of California, Riverside for technical assistance. This study was funded in part by grants from the NIH (R01 HL145170 to ZBC), Ella Fitzgerald Foundation (to ZBC), City of Hope (Arthur Riggs Diabetes Metabolism and Research Institute Innovation Award), and California Institute of Regenerative Medicine grant EDU4-12772 (to AT). Research reported in this publication included work performed in the Light Microscopy and Digital Imaging supported by the National Cancer Institute of the NIH under award number P30CA033572. Figure 1 and Figure 2 were made with BioRender.

Tissue isolation was performed under the approved study protocol #17010 by the Institutional Animal Care and Use Committee (IACUC) of Beckman Research Institute, City of Hope (Duarte, California, USA). Here, we use Tie-2CreERT2;Rosa26-TdTomato mouse line in C57BL/6 background at 8 - 12 weeks of age. In this line, ECs are labeled with TdTomato when induced with tamoxifen as previously described34. However, this protocol can be adapted for all ages of adult mice with different genotypes and genetic backgrounds.
1. Tissue collection (estimated time: 1-2 h)
NOTE: The time estimate is 15 min/animal, recommended maximum 3 animals pooled per dissociation samples.
<ol>
	<li>Euthanize animals by carbon dioxide (CO2) overdose, followed by secondary confirmation of death. Before dissection, spray the whole body with 70% ethanol (EtOH), completely disinfecting the operating area.</li>
	<li>Stretch out and secure limbs using pins. Using surgical scissors, make a small midline incision through the skin and peritoneum starting from the lower abdominal area and extending toward the thoracic region.</li>
	<li>Expose the ribcage by cutting through the diaphragm and lift the ribcage to expose the heart.</li>
	<li>Insert a needle (25G-30G) connected to a syringe containing ice-cold sterile PBS, into the left ventricle of the heart.</li>
	<li>Start the perfusion by injecting the PBS through the heart at a rate of 5 - 10 mL/min. Stop after injecting 10 mL, or until the liver and kidneys become discolored.</li>
	<li>After perfusion, locate the pancreas (below the stomach and attached to the duodenum)35 (Figure 3A) and carefully remove it using dissecting scissors and forceps.</li>
	<li>Once isolated, transfer pancreas to a 50 mL tube containing 10 mL of ice-cold PBS + 0.2 mg/mL trypsin inhibitor, keep on ice (Figure 3B). 
	NOTE: Pancreas from a maximum of 3 mice can be pooled at this step and transferred into 1 tube. Samples can be kept on ice for a maximum time of 2 h.</li>
</ol>
2. Collagenase preparation (estimated time: 15-30 min)
<ol>
	<li>Prepare solutions and buffers as described below.
	<ol>
		<li>Dissociation solution: Add collagenase Type I into 50 mL tube to a final concentration of 1 mg/mL in Dulbecco&#39;s phosphate buffered saline (DPBS 1x (Ca2+, Mg2+; see Table of Materials) and 0.001 U/mL DNase I + 0.2 mg/mL Trypsin inhibitor.</li>
		<li>Dissociation stop solution: Add phosphate buffered saline (PBS 1x, without Ca2+, Mg2+; same for all the rest PBS in this protocol; see Table of Materials), 5% Bovine Serum Albumin (BSA), 0.001 U/mL DNase I or DMEM + 10% FBS + 0.001 MU/mL DNase I.</li>
		<li>Wash buffer: Add PBS 1x, 0.5% Bovine Serum Albumin (BSA), 0.001 U/mL DNase I + 0.05&#160;mg/mL Trypsin Inhibitor.</li>
	</ol>
	</li>
	<li>Dissolve buffers completely and filter through a 0.22 &#181;m filter. Set aside and keep on ice.</li>
</ol>
3. Digestion (estimated time: 40 min-1 h)
<ol>
	<li>Remove pancreas from ice-cold PBS and place on Petri dish on top of ice. Carefully remove excess tissue (e.g., spleen, fat, debris) with surgical scissors and tweezers (Figure 3C). 
	NOTE: It is crucial to remove fat, as excess of lipids can interfere with tissue digestion.</li>
	<li>Transfer the trimmed mouse pancreas to a 5 mL tube containing 1 mL of dissociation solution.</li>
	<li>Keep tube on ice and mince the pancreatic tissues with dissecting scissors into fine pipettable pieces, e.g. 0.5 mm or 1 mm. Transfer lysate into a 50 mL tube and keep on ice.</li>
	<li>Add additional pancreas to the 5 mL tube used to initially mince the pancreatic tissue and add additional 1 mL of collagenase. Repeat as necessary for multiple pancreas preparations.</li>
	<li>Add 2 mL of collagenase solution to the 5 mL tube to remove any residual pancreas tissue and transfer to 50 mL tube. Total collagenase volume should be 5 mL for 3 pancreas or 3 mL for a single pancreas.</li>
	<li>Once all samples have undergone mechanical dissociation, transfer the 50 mL tubes containing the homogenized tissue lysates to a 37 &#176;C water bath and incubate for 10 min. 
	NOTE: Do not vigorously agitate or vortex the tissue mixture during this process as this can cause rupture of acinar tissues and the release of abundant endogenous enzymes and DNA.</li>
	<li>Remove the tubes from water bath and gently swirl to mix well, and leave in water bath for another 10 min. (Total time: 20 min). 
	NOTE: Do not exceed 30 min in 37 &#176;C water bath to avoid over-digestion.</li>
	<li>Place tubes on ice, and let the homogenate settle by gravity. Once settled, transfer supernatant through a 70 &#181;m filter, and add 5 mL of dissociation stop solution.</li>
	<li>Add an additional 1 mL of dissociation solution to the remaining pellet and triturate with a 18G needle.</li>
	<li>Pass the remaining homogenate through the filter and wash with an additional 5 mL of dissociation stop solution.</li>
	<li>Spin cell suspension at 300 x g for 10 min, at 4 &#176;C. Remove supernatant completely by aspiration and keep cell pellet on ice.</li>
	<li>Resuspend cell pellet with 1 mL of wash buffer and transfer to a 1.5 mL microcentrifuge tube.</li>
	<li>Take a small aliquot from the resuspended cell pellet (10 &#181;L) and mix with trypan blue at a 1:1 ratio to count cells using a cell counter and measure viability.</li>
</ol>
4. Endothelial cell (EC) enrichment (estimated time: 2-3 h)
<ol>
	<li>Add 1 &#181;L of anti-CD31-biotin antibody for every 1 x 107 cells counted and incubate for 30 min at 4 &#176;C on a rotator (about 5 &#181;L per 3 pancreas).</li>
	<li>Add 20 &#181;L of anti-biotin microbeads and incubate for 40 min at 4 &#176;C on a tube rotator.</li>
	<li>Set up a magnetic stand with the column separator holder and apply the column. Equilibrate column with 3 mL of wash buffer.</li>
	<li>Add sample to the column and wash with a total of 9 mL wash buffer. 
	NOTE: If cell concentration is high, dilute cells with an additional 2 mL of wash buffer in a separate tube. Add 1 mL of sample at a time into the column to prevent the column from clogging.</li>
	<li>Remove column from column holder and place in a 15 mL tube. Add 5 mL of wash buffer, to the column. Use plunger to push down cells in the column and collect elution (which contains enriched EC).</li>
	<li>Spin down flow-through and elution/EC fraction at 300 x g for 10 min at 4 &#176;C. Count cells and measure viability as in step 3.13.</li>
	<li>Validate EC-enrichment via qPCR of flow-through and EC-fractions. Use NK6 Homeobox 1 (Nkx6.1) as a general marker for endocrine cells and platelet and endothelial cell adhesion molecule (Pecam1) as a marker for EC33. Use 36B4 (Rplp0, acidic ribosomal phosphoprotein p0) as an internal control for gene expression normalization. 
	NOTE: Collected samples can be used for protein or RNA analyses at this step.</li>
</ol>
5. Culturing pECs
<ol>
	<li>Prepare M199 medium. Supplement M199 medium to a final concentration of 20% fetal bovine serum (FBS) and 0.1% Penicillin-Streptomycin.</li>
	<li>Coat a 60 mm cell culture plate with collagen Type I (1 mg/mL in 0.1 M acetic acid) and allow to sit for 30 min at room temperature.</li>
	<li>Remove collagen Type I and rinse the plate with 1X PBS, twice. Add 2 mL of prepared M199 Media and place cell culture plate in standard cell culture incubator (5% CO2, 37 &#176;C) for 5 min.</li>
	<li>Once cells have been isolated, add isolated cells to pre-warmed M199 cell culture plate. Keep cells in culture conditions for approximately 14 days and change media every 2-3 days.</li>
</ol>

Streamlining Mouse Pancreatic Endothelial Cell Extraction for Disease Studies

The authors have nothing to disclose.

In this article, we present a protocol for enrichment and isolation of the pECs. Similar to previous EC isolation protocols from other tissues or organs, this protocol consists of three major processes, namely, physical dissociation, enzymatic digestion, and antibody-based EC enrichment. To address the unique challenges in processing the pancreas, we introduced several key adaptations and critical steps within our protocol: 1) a gentle one-step collagenase digestion with a short incubation time, 2) supplementation of higher concentration of DNase and a trypsin inhibitor to minimize DNA contamination and endogenous enzyme digestion, which can interfere with antibody binding and thus diminish EC enrichment and viability and 3) cell counting after the digestion step to adjust how much antibody is added to the sample to optimize EC enrichment. In the process of optimizing this protocol, we tested other enzymes used in previous studies, e.g., trypsin28, collagenase Type IV31, and other digestion temperatures, e.g. 4&#176;C, as well as different incubation times (Table 1). We found collagenase Type I, 20 min, at 37 &#176;C to be the optimal condition for the mouse pEC isolation and used this here. While the addition of an anticoagulant during the perfusion may improve overall cell viability, typical anticoagulating agent, e.g., EDTA or Heparin may interfere with the activity of certain enzymes, e.g., collagenase for cell dissociation and reverse transcriptase used in qPCR. To prevent the unexpected/undesirable effect of these anticoagulants, PBS (without Ca2+ and Mg2+) for perfusion is used.
We focused on developing a protocol for enriching EC population from whole mouse pancreases, which would include both intra-islet ECs and ECs in the exocrine tissues, resulting in a higher yield. In the current protocol, we pooled together 3 animals during the dissociation step and on average achieved a single-cell suspension with approximately 2.0 x 106 viable cells. We have also tested samples from single mouse pancreas and about 750,000 cells can be obtained. It is worth noting that when adjusting to process a single animal, less dissociation solution (3 mL dissociation per pancreas) should be used. A crucial step in the protocol is to completely trim and remove any residual fat that is attached to the pancreas (Figure 3B). Adipose tissue contamination in the collagenase digestion will interfere with the pancreatic single cell dissociation step diminishing cell viability in the subsequent enrichment steps38. Moreover, to enrich pECs we used a pan-EC surface marker, PECAM1/CD31. Using PECAM1/CD31 antibody, we were able to significantly enrich EC fractions, evident by the gene expression analysis. In the development of this protocol, we had also tested the utility of CD144 antibody, which has also been commonly used to isolate ECs13. However, we were not able to enrich pECs (data not shown). Intriguingly, immunofluorescent staining revealed that whereas CD31 is expressed in all ECs in the pancreas tissue, CD144 antibody appears to stain only intra-islet ECs (Figure 5A). Additionally, we analyzed publicly available single cell RNA-seq data from islets isolated from C57BL/6 mice (GSE128565)37 and found that approximately 50% of the islet ECs show expression of both Cdh5 (VE-Cad) and Pecam1, but the rest of islet ECs express only Cdh5 or Pecam1 (Figure 5B). Thus, we speculate that CD31 antibodies is more appropriate for pEC isolation and the utility of CD144 antibody for this purpose warrants future investigation. Moreover, there are commercially available anti-CD31 conjugated with magnetic beads which can simplify the two-step antibody binding step to a singular step.
As demonstrated, we performed qPCR, immunoblotting, flow cytometry, and immunofluorescent staining to validate the isolated EC fraction. It is conceivable that these fractions can be subjected to other assays, such as (sc)RNA-seq and mass spectrometry. A limitation of this protocol is that we have not been able to achieve robust subculture and perform functional assays. Given that subculture of isolated mouse ECs has been shown to be challenging, this is an area warranting future efforts. One way to address this may be the introduction of large T antigen, which has been used to immortalize primary cells39.
The recent advances and application of scRNA sequencing have enabled high-resolution profiling of pancreatic cells40 and especially islet cells41. However, most of the existing studies have focused on endocrine cell populations and used tissue dissociation protocols that does not efficiently retain ECs. As a result, EC fractions often end up scarce, constituting only 3%-5% in the entire captured cell populations42,43,44. A recent protocol uses two-step enzymatic digestion and deactivation and a fluorescently activated cell sorting step and retrieves ECs at 12% of the entire pancreatic cell population45. Complementary to this protocol, our protocol provides a simplified workflow, which may be more cost-effective and less technically demanding should ECs be the focus of the study. Although this protocol has only been tested in mouse pancreas, it can be scaled up and adapted to isolate ECs from other organisms, including human pancreas.

The pancreas, key to metabolic control and homeostasis, is a highly vascularized organ. The pancreas has both endocrine and exocrine functions, controlling the regulation of blood glucose and digestive enzymes, respectively. These two compartments are linked together by the extensive network of pancreatic blood vessels, facilitating the exchange and transport of oxygen, hormones, and enzymes. Critically, this dense capillary network penetrates the Islet of Langerhans, a cluster of hormone-regulating cells within the pancreas responsible for its endocrine function, consisting of the glucagon-secreting alpha (&#945;) cells, the insulin-secreting beta (&#946;) cells and the somatostatin-secreting delta (&#948;) cells1,2. Although the islets only make up 1-2% of the pancreatic mass, they receive 20% of total blood flow3, highlighting the importance of islet vasculature. The pancreatic capillaries are primarily made up of highly fenestrated endothelial cells (ECs), which are surrounded by mural pericytes. These capillary ECs play a vital role in the islet development, maturation, and (dys)function and form intimate crosstalks with various endo- and exocrine cells4 (Figure 1).
Endothelial dysfunction has been observed in both Type 1 and Type 2 diabetes, the most common conditions caused by pancreatic islet dysfunction5,6. Both islet microvascular density and morphology can be altered in diabetes7. Moreover, pancreatic cancer, a highly aggressive tumor that can also be manifested as diabetes, is characterized by high microvascular density with poor perfusion8. Given the pivotal structural and functional roles of ECs in both normal and diseased pancreatic tissue, there is a pertinent need to study the pECs in development, physiology, and pathology to unveil the mechanisms that drive health or diseases.
Numerous protocols have been developed for the isolation of ECs from different murine (e.g., brain9,10, lung11, heart12, liver13, skeletal muscles14, and adipose tissues15) and human (e.g., brain16, visceral adipose tissue17,18, peripheral nerves19, lung20,21,22, and mesenteric artery23) tissues. These protocols typically involve the use of enzymatic digestions (e.g., by collagenase, trypsin24, dispase24,25, and liberase26), followed by an antibody-based enrichment step. Moreover, these protocols tend to rely on extended durations of digestions in high concentrations of enzymes with vigorous agitation at 37 &#176;C (Table 1). Due to the unique features of the pancreas, including that it houses a plethora of endogenous digestive enzymes, these existing protocols cannot be directly applied to isolate pECs. First, the extracellular matrix (ECM) composition of the pancreas is different from other tissues. While collagenase is commonly used for EC isolation, there are multiple subtypes with different tissue-specific dissociation capabilities, thus requiring optimization. Second, and crucial to pEC isolation, the release and activation of pancreatic endogenous enzymes can significantly hinder the isolation process. To this end, caution needs to be taken to minimize the rupture of the exocrine acinar cells (the primary source of zymogens, proteases, and RNase27), which can induce further cell damage and result in low cell viability and overall affect recovery27,28,29.
To address these challenges, we have adapted methods from existing EC isolation protocols and established a new protocol&#160;suitable for EC isolation from mouse pancreases. Specifically, we describe here a workflow (Figure 2) using collagenase Type I (typically implemented for lung EC isolation), lower digestion temperatures and no agitation (to prevent activation of pancreatic zymogens), and DNase30,31,32 supplementation (to prevent DNA-induced apoptosis and improve cell viability, and an antibody for CD3133 (PECAM1, a pan-EC marker). The described protocol produces EC populations isolated from mouse pancreas that can be used for gene expression profiling and protein assays.

<table><tbody><tr><td>1.5 mL eppendorf</td><td>USA Scientific</td><td>1615-5500</td><td></td></tr><tr><td>10 cm dish</td><td>Genesee Scientific</td><td>25-202</td><td></td></tr><tr><td>25G needles</td><td>BD</td><td>305145</td><td></td></tr><tr><td>2X Taq Pro Universal SYBR qPCR Master Mix</td><td>Vazyme</td><td>Q712-03-AA</td><td></td></tr><tr><td>5 mL eppendorf</td><td>Thermo Fisher&amp;nbsp;</td><td>14282300</td><td></td></tr><tr><td>6-well plate</td><td>Greiner Bio-One</td><td>07-000-208</td><td></td></tr><tr><td>70 &amp;micro;m strainer</td><td>Fisher</td><td>22-363-548</td><td></td></tr><tr><td>Anti-CD31-biotin</td><td>Miltenyi Biotech</td><td>REA784</td><td></td></tr><tr><td>Bovine serum albumin heat shock treated</td><td>Fisher</td><td>BP1600-100</td><td></td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Fisher</td><td>BP510</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>Collagen Type 1, from calf skin</td><td>Sigma Aldrich&amp;nbsp;</td><td>C9791</td><td>Attachment reagent in the protocol</td></tr><tr><td>Collagenase Type 1&amp;nbsp;</td><td>Worthington Bio</td><td>LS004197</td><td></td></tr><tr><td>Countess Automatic Cell Counter</td><td>Thermo Fisher&amp;nbsp;</td><td></td><td></td></tr><tr><td>DAPI</td><td>Thermo Fisher&amp;nbsp;</td><td>D1306</td><td>immunofluorescence</td></tr><tr><td>Disposable Safety Scalpels</td><td>Myco Instrumentation</td><td>6008TR-10</td><td></td></tr><tr><td>DNAse I&amp;nbsp;</td><td>Roche</td><td>260913&amp;nbsp;</td><td></td></tr><tr><td>D-PBS (Ca2+,Mg2+)</td><td>Thermo Fisher&amp;nbsp;</td><td>14080055</td><td></td></tr><tr><td>Ethanol</td><td>Fisher</td><td>BP2818-4</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Fisher</td><td>10437028</td><td></td></tr><tr><td>Incubator</td><td></td><td></td><td>Kept at 37 &amp;deg;C 5% CO&lt;sub&gt;2&lt;/sub&gt;</td></tr><tr><td>LS Columns</td><td>Miltenyi Biotech</td><td>130-042-401</td><td></td></tr><tr><td>M199</td><td>Sigma</td><td>M2520-1L</td><td></td></tr><tr><td>MACS MultiStand with the QuadroMACS Separator&amp;nbsp;</td><td>Miltenyi Biotech</td><td>130-042-303</td><td></td></tr><tr><td>Medium 199</td><td>Sigma Aldrich&amp;nbsp;</td><td>M2520-10X</td><td></td></tr><tr><td>Microbeads anti-biotin</td><td>Miltenyi Biotech</td><td>130-090-485</td><td></td></tr><tr><td>Microscope</td><td>Leica</td><td></td><td>To assess cell morphology</td></tr><tr><td>Molecular Grade Water</td><td>Corning</td><td>46-000-CM</td><td></td></tr><tr><td>NaCl</td><td>Fisher</td><td>S271-1</td><td></td></tr><tr><td>New Brunswick Innova 44/44R Orbital shaker&amp;nbsp;</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>PECAM1 (CD31) Antibody</td><td>Abcam</td><td>ab56299</td><td>immunofluorescence</td></tr><tr><td>PECAM1 (CD31) Antibody</td><td>R&amp;amp;D Systems</td><td>AF3628</td><td></td></tr><tr><td>Phosphate Buffered Saline (10X) (no Ca2+,no Mg2+)</td><td>Genesee Scientific</td><td>25-507-XB</td><td></td></tr><tr><td>Primer 36B4 Forward mouse</td><td>IDT</td><td></td><td>AGATTCGGGATATGCTGTTGGC</td></tr><tr><td>Primer 36B4 Revese mouse&amp;nbsp;</td><td>IDT</td><td></td><td>TCGGGTCCTAGACCAGTGTTC</td></tr><tr><td>Primer Kdr Forward mouse&amp;nbsp;</td><td>IDT</td><td></td><td>TCCAGAATCCTCTTCCATGC</td></tr><tr><td>Primer Kdr Reverse mouse</td><td>IDT</td><td></td><td>AAACCTCCTGCAAGCAAATG</td></tr><tr><td>Primer Nkx6.1 Reverse mouse&amp;nbsp;</td><td>IDT</td><td></td><td>CACGGCGGACTCTGCATCACTC</td></tr><tr><td>Primer Nxk6.1 Forward mouse</td><td>IDT</td><td></td><td>CTCTACTTTAGCCCCAGCG</td></tr><tr><td>Primer PECAM1 Forward mouse</td><td>IDT</td><td></td><td>ACGCTGGTGCTCTATGCAAG</td></tr><tr><td>Primer PECAM1 Reverse mouse</td><td>IDT</td><td></td><td>TCAGTTGCTGCCCATTCATCA</td></tr><tr><td>RNase ZAP</td><td>Thermo Fisher&amp;nbsp;</td><td>AM9780</td><td></td></tr><tr><td>RNase-free water</td><td>Takara</td><td>RR036B</td><td></td></tr><tr><td>Sterile 12&quot; long forceps</td><td>F.S.T</td><td>91100-16</td><td></td></tr><tr><td>Sterile fine forceps</td><td>F.S.T</td><td>11050-10</td><td></td></tr><tr><td>Sterile fine scissors</td><td>F.S.T</td><td>14061-11</td><td></td></tr><tr><td>Tissue Culture Dishes 2cm</td><td>Genesee Scientific</td><td>25-260</td><td></td></tr><tr><td>TRIzol reagent</td><td>Fisher</td><td>15596018</td><td></td></tr><tr><td>Trypan Blue</td><td>Corning</td><td>MT25900CI</td><td></td></tr><tr><td>Trypsin Inhibitor&amp;nbsp;</td><td>Roche</td><td>10109886001</td><td></td></tr><tr><td>Tween-20</td><td></td><td></td><td></td></tr><tr><td>VE-Cadherin Antibody</td><td>Abcam</td><td>ab33168</td><td>immunofluorescence</td></tr><tr><td>Waterbath</td><td></td><td></td><td></td></tr></tbody></table>

isolation of mouse pancreatic endothelial cells

The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and glucagon, as well as digestive enzymes. The pancreas is also a highly vascularized organ, a feature facilitated by the intricate network of pancreatic capillaries. This extensive capillary network is made up of highly fenestrated endothelial cells (ECs) important for pancreas development and function. Accordingly, the dysfunction of ECs can contribute to that of the pancreas in diseases like diabetes and cancer. Thus, researching the function of pancreatic ECs (pECs) is important not only for understanding pancreas biology but also for developing its pathologies. Mouse models are valuable tools to study metabolic and cardiovascular diseases. However, there has not been an established protocol with sufficient details described for the isolation of mouse pECs due to the relatively small population of ECs and the abundant digestive enzymes potentially released from the acinar tissue that can lead to cell damage and, thus, low yield. To address these challenges, we devised a protocol to enrich and recover mouse pECs, combining gentle physical and chemical dissociation and antibody-mediated selection. The protocol presented here provides a robust method to extract intact and viable ECs from the whole mouse pancreas. This protocol is suitable for multiple downstream assays and may be applied to various mouse models.

Following this protocol, approximately 2 x 106 live cells can be obtained when pooling 3 mouse pancreases, and 750,000 cells from a single mouse pancreas. To validate the enrichment of EC, we performed the following analyses: 1) quantitative PCR: compared to the flow-through (FT) samples (i.e., the non-CD31 antibody-bound fractions), the EC fractions had significantly higher levels of Pecam1 (encoding CD31) and Kdr (encoding VEGFR2), two EC marker genes33, and lower levels of NK6 homeobox 1 (Nkx6.1), a transcription factor in the pancreatic endocrine cells (Figure 4A); 2) western blotting: EC-enriched samples from three preparations (pEC-1-3) showed strong signals of CD31 at the expected size (~130 kDa). In comparison, the input and FT samples showed minimal CD31 signal. As a positive control, lysates of MS1 cells, a pEC cell line, also showed strong CD31 signal (Figure 4B); 3) trypan blue staining: we found the viability of isolated cells was around 50% (Figure 4C); 4) flow cytometry following a published protocol15 : through gating on the live cell population (Figure 4D), we found the CD31+ cells were at 88% and the TdTomato+ cells were at 76%. Of note, the majority of isolated cells co-express CD31 and TdTomato (Figure 4E). As negative controls, the unstained MS1 cells and MS1 incubated with IgG showed no live cells as marked by CD31. As the positive control, i.e., MS1 cells stained for CD31 showed close to 100% live CD31+ cells (Figure 4F). We also cultured the isolated cells, performed immunofluorescence staining of PECAM1 following a published protocol36, and imaged TdTomato, which showed robust signals of both markers in the isolated cells, suggesting the presence of ECs (Figure 4G).
<img alt="Pancreas endothelium cells diagram highlighting intra-islet ECs structure and distribution." class="xfigimg" src="/files/ftp_upload/66690/66690fig01.jpg" data-altupdatedat="1747911167000" data-alt="Figure 1"> 
Figure 1: Illustration of vascularization of pancreas and pancreatic islets. A pictorial depiction of the pancreatic endothelial cells (ECs) and intra-islet ECs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66690/66690fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Single-cell preparation diagram; centrifuge, CD31-biotin, flow-through; RNA, protein analysis." class="xfigimg" src="/files/ftp_upload/66690/66690fig02.jpg" data-altupdatedat="1747911167000" data-alt="Figure 2"> 
Figure 2: Overview of workflow. 1) Pancreas dissection, 2) mechanical digestion, 3) enzyme incubation, 4) centrifugation, 5a) supernatant removal and 5b) secondary Collagenase digestion of the cell pellets with trituration for filtering in 6), 7), and 8) pellet reconstitution and antibody binding, 9) microbeads incubation, 10) MACS column enrichment, 11) cell counting for viability, and 12) downstream analysis. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66690/66690fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Tissue harvest and pancreas isolation in dissection experiment; sequential processing shown in images." class="xfigimg" src="/files/ftp_upload/66690/66690fig03.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3: Tissue processing steps. Images of (A) the abdominal cavity, (B) the isolated mouse pancreas, and (C) the trimmed mouse pancreas. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66690/66690fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Cell analysis process with graphs of gene expression, CD31 protein, and flow cytometry charts." class="xfigimg" src="/files/ftp_upload/66690/66690fig04.jpg" data-altupdatedat="1747911167000" data-alt="Figure 4"> 
Figure 4: Validation of isolated EC fractions from mouse pancreas. (A) qPCR of FT samples and enriched EC fraction with CD31 for enrichment. Pecam1 (CD31), Kdr (VEGFR2), and Nkx6.1 (pancreatic β-cell specific transcription factor)33. * denotes p &lt;0.05 compared to FT based on t tests. n = 3-4 pooled samples, consisting of 3 mice each. (B) Western blotting of CD31. pEC-1-3 indicate enriched ECs from 3 separate pooled mouse samples. Cell lysates of 30 mg was loaded onto each lane, followed by Ponceau S staining. (C) Cell counting and trypan blue staining of enriched pECs for viability assay. (D) Flow cytometry gating strategy for mouse pECs stained by 4', 6-diamidino-2-phenylindole (DAPI) and CD31 antibody. (E) Flow cytometry histograms of unstained MS1 (top left), MS1 stained with AlexaFluor-488 secondary antibody (IgG control; top right), MS1 stained with CD31 (bottom left), and the isolated mouse pECs stained with CD31 (bottom right). (F) Percentage of live cells quantified using flow cytometry. (G) Immunofluorescence of CD31 expression (green) with DAPI (blue) counterstain and endogenous TdTomato fluorescent reporter (red). Scale bar = 100 µm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66690/66690fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Immunofluorescence microscopy of CD31/CD144/DAPI; UMAP analysis of Cdh5 and Pecam1 expression." class="xfigimg" src="/files/ftp_upload/66690/66690fig05.jpg" data-altupdatedat="1747911167000" data-alt="Figure 5"> 
Figure 5: CD31 and CD144 specificity in mouse pancreas. (A) Immunofluorescence of mouse pancreas with CD31 (Magenta) and CD144 (Cyan), with DAPI counterstain. Image captured using a 10x lens under a widefield fluorescent inverted microscope. Scale bar = 100 µm. Dashed lines demarcate islet area. (B) Uniform Manifold Approximation and Projection (UMAP) showing Cdh5 and Pecam1 expression in the islet ECs from C57BL6 mice detected by scRNA-seq (GSE128565)37. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66690/66690fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Enzyme</td>
			<td>Use</td>
			<td>Temperature and Time</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>Collagenase I</td>
			<td>Single cell dissociation, whole pancreas EC enrichment</td>
			<td>37 °C, 20 min</td>
			<td>This protocol</td>
		</tr>
		<tr>
			<td>Collagenase IV</td>
			<td>Islet Isolation and and non-enzymatic dissociation</td>
			<td>37 °C, 20 min</td>
			<td>46</td>
		</tr>
		<tr>
			<td>Collagenase + Trypsin</td>
			<td>Examining ductal cells in mouse pancreas</td>
			<td>37 °C, 30 min</td>
			<td>47</td>
		</tr>
		<tr>
			<td>Collagenase B</td>
			<td>Single cell suspension of pancreas</td>
			<td>37 °C, 30 min</td>
			<td>48</td>
		</tr>
		<tr>
			<td>Collagenase NBI</td>
			<td>Islet Isolation</td>
			<td>37 °C, 30 min</td>
			<td>49</td>
		</tr>
		<tr>
			<td>Collagenase P</td>
			<td>Acinar viable suspension</td>
			<td>37 °C, 15 min</td>
			<td>45</td>
		</tr>
		<tr>
			<td>Collagenase XI</td>
			<td>Islet Isolation</td>
			<td>37 °C, 15 min</td>
			<td>35</td>
		</tr>
		<tr>
			<td>Dispase</td>
			<td>Single cell suspension</td>
			<td>37 °C, 45 min</td>
			<td>24</td>
		</tr>
		<tr>
			<td>Liberase</td>
			<td>Single cell suspension</td>
			<td>37 °C, 10 min</td>
			<td>25, 48</td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Single cell dissociation, whole pancreas</td>
			<td>4 °C, O/N</td>
			<td>28</td>
		</tr>
	</tbody>
</table>
Table 1: Summary of various protocols used to process mouse pancreas samples.

Isolation of Mouse Pancreatic Endothelial Cells

This protocol describes the isolation of mouse endothelial cells from whole pancreas.

The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and ...

isolation-of-mouse-pancreatic-endothelial-cells

Nanyang Technological University

Research

JoVE Journal

Biology

906 Views.  City of Hope. Het doel van dit onderzoek is om ons begrip van de rol van pancreasvasculatuur in zowel de normale pancreasbiologie als de ontwikkeling van ziekten te verdiepen. Door de endotheelfractie met succes te verrijken, proberen we specifieke routes binnen het vaatstelsel te identificeren die de pancreasfuncties regelen, die mogelijk kunnen worden gericht op het herstellen en verbeteren van pancreasfuncties in ziektesituaties. De laatste tijd wordt steeds meer nadruk...

Video: Isolatie van endotheelcellen van de pancreas van muizen

Leprdb Mouse Model of Type 2 Diabetes: Pancreatic Islet Isolation and Live-cell 2-Photon Imaging Of Intact Islets

Type 2 diabetes is a chronic disease affecting 382 million people in 2013, and is expected to rise to 592 million by 2035 1. During the past 2 decades, the role of beta-cell dysfunction in type 2 diabetes has been clearly established 2. Research progress has required methods for the isolation of pancreatic islets. The protocol of the islet isolation presented here shares many common steps with protocols from other groups, with some modifications to improve the yield and quality of isolated islets from both the wild type and diabetic Leprdb (db/db) mice. A live-cell 2-photon imaging method is then presented that can be used to investigate the control of insulin secretion within islets.

Leprdb Mouse Model of Type 2 Diabetes: Pancreatic Islet Isolation and Live-cell 2-Photon Imaging Of Intact Islets

We present here a protocol for the isolation of islets from the mouse model of type 2 diabetes, Leprdb and details of a live-cell assay for measurement of insulin secretion from intact islets that utilizes 2 photon microscopy.

Type 2 diabetes is a chronic disease affecting 382 million people in 2013, and is expected to rise to 592 million by 2035 1. During the past 2 decades, ...

Medicine

A Murine Pancreatic Islet Cell-based Screening for Diabetogenic Environmental Chemicals

Exposure to certain environmental chemicals in human and animals has been found to cause cellular damage of the pancreatic &#946; cells which will lead to the development of type 2 diabetes mellitus (T2DM). Although the mechanisms for the chemical-induced &#946; cell damage were unclear and likely to be complex, one recurring finding is that these chemicals induce oxidative stress leading to the generation of excessive reactive oxygen species (ROS) which induce damage to the &#946; cell. To identify potential diabetogenic environmental chemicals, we isolated pancreatic islet cells from C57BL/6 mice and cultured islet cells in 96-well cell culture plates; then, the islet cells were dosed with chemicals and the ROS generation was detected by 2',7'-dichlorofluorescein (DCFH-DA) fluorescent dye. Using this method, we found that bisphenol A (BPA), Benzo[a]pyrene (BaP), and polychlorinated biphenyls (PCBs), could induce high levels of ROS, suggesting that they may potentially induce damage in islet cells. This method should be useful for screening diabetogenic xenobiotics. In addition, the cultured islet cells may also be adapted for in vitro analysis of chemical-induced toxicity in pancreatic cells.

Here we present a protocol to isolate mouse pancreatic islet cells for screening the ROS inductions by the xenobiotics in order to identify the potential diabetogenic xenobiotic chemicals.

Exposure to certain environmental chemicals in human and animals has been found to cause cellular damage of the pancreatic &#946; cells which will lead to ...

Immunology and Infection

Isolation of Primary Murine Skeletal Muscle Microvascular Endothelial Cells

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal muscles regulating the exchange of fluids and nutrients as well as the immune response against infectious agents by controlling immune cell migration. For these functions, MMEC form a functional &#34;myovascular unit&#34; (MVU), with further cell types, such as fibroblasts, pericytes and skeletal muscle cells. Consequently, a dysfunction of MMEC and therefore the MVU contributes to a vast variety of myopathies. However, regulatory mechanisms of MMEC in health and disease remain insufficiently understood and their elucidation precedes more specific treatments for myopathies. The isolation and in-depth investigation of primary MMEC functions in the context of the MVU might facilitate a better understanding of these processes.
This article provides a protocol to isolate primary murine MMEC of the skeletal muscle by mechanical and enzymatic dissociation including purification and culture maintenance steps.

Microvascular endothelial cells of skeletal muscles (MMEC) shape the inner wall of muscle capillaries and regulate both, exchange of fluids/molecules and migration of (immune) cells between muscle tissue and blood. Isolation of primary murine MMEC, as described here, enables comprehensive in vitro investigations of the &#34;myovascular unit&#34;.

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal ...

Neuroscience

A Method for Mouse Pancreatic Islet Isolation and Intracellular cAMP Determination

Uncontrolled glycemia is a hallmark of diabetes mellitus and promotes morbidities like neuropathy, nephropathy, and retinopathy. With the increasing prevalence of diabetes, both immune-mediated type 1 and obesity-linked type 2, studies aimed at delineating diabetes pathophysiology and therapeutic mechanisms are of critical importance. The &#946;-cells of the pancreatic islets of Langerhans are responsible for appropriately secreting insulin in response to elevated blood glucose concentrations. In addition to glucose and other nutrients, the &#946;-cells are also stimulated by specific hormones, termed incretins, which are secreted from the gut in response to a meal and act on &#946;-cell receptors that increase the production of intracellular cyclic adenosine monophosphate (cAMP). Decreased &#946;-cell function, mass, and incretin responsiveness are well-understood to contribute to the pathophysiology of type 2 diabetes, and are also being increasingly linked with type 1 diabetes. The present mouse islet isolation and cAMP determination protocol can be a tool to help delineate mechanisms promoting disease progression and therapeutic interventions, particularly those that are mediated by the incretin receptors or related receptors that act through modulation of intracellular cAMP production. While only cAMP measurements will be described, the described islet isolation protocol creates a clean preparation that also allows for many other downstream applications, including glucose stimulated insulin secretion, [3H]-thymidine incorporation, protein abundance, and mRNA expression.

Assaying in vitro &#946;-cell function using isolated mouse islets of Langerhans is an important component in the study of diabetes pathophysiology and therapeutics. While many&#160;downstream applications are available, this protocol specifically describes the measurement of intracellular cyclic adenosine monophosphate (cAMP) as an essential parameter determining &#946;-cell function.

Uncontrolled glycemia is a hallmark of diabetes mellitus and promotes morbidities like neuropathy, nephropathy, and retinopathy. With the increasing ...

Isolation and Culture of Mouse Primary Pancreatic Acinar Cells

This protocol permits rapid isolation (in less than 1 hr) of murine pancreatic acini, making it possible to maintain them in culture for more than one week. More than 20 x 106 acinar cells can be obtained from a single murine pancreas. This protocol offers the possibility to independently process as many as 10 pancreases in parallel. Because it preserves acinar architecture, this model is well suited for studying the physiology of the exocrine pancreas in vitro in contrast to cell lines established from pancreatic tumors, which display many genetic alterations resulting in partial or total loss of their acinar differentiation.

In this publication, we describe a rapid and convenient procedure for isolating and culturing primary pancreatic acinar cells from the murine pancreas. This method constitutes a valuable approach to study the physiology of fresh primary normal/untransformed exocrine pancreatic cells.

This protocol permits rapid isolation (in less than 1 hr) of murine pancreatic acini, making it possible to maintain them in culture for more than one ...

Isolation of Primary Mouse Lung Endothelial Cells

Endothelial cells play critical roles in the regulation of vascular tone, immunity, coagulation, and permeability. Endothelial dysfunction occurs in medical conditions including diabetes, atherosclerosis, sepsis, and acute lung injury. A reliable and reproducible method to isolate pure endothelial cells from mice is needed to investigate the role of endothelial cells in the pathogenesis of these and other conditions. In this protocol, lung microvascular endothelial cells were prepared from 5-7 day old neonatal mouse pups. Lungs are harvested, minced, and enzymatically digested with collagenase I, and released cells are cultured overnight. Endothelial cells are then selected using anti-PECAM1 (CD-31) IgG conjugated to magnetic beads, and cells again are cultured to confluence. A secondary cell selection then occurs with anti-ICAM2 (CD-102) IgG conjugated to magnetic beads to increase the purity of the endothelial cells, and the cells again are cultured to confluence. The entire process takes approximately 7-10 days before the cells can be used for experimentation. This simple protocol yields highly pure (purity &#62;92%) endothelial cells that can be immediately used for in vitro studies, including the studies focused on endothelial cytokine and chemokine production, leukocyte-endothelial interactions, endothelial coagulation pathways, and endothelial permeability. With many knockouts and transgenic mouse lines available, this procedure also lends itself to understanding the function of specific genes expressed by endothelial cells in healthy and pathologic responses to injury, infection, and inflammation.

In this article, primary lung endothelial cells were isolated and cultured from neonatal mice.

Endothelial cells play critical roles in the regulation of vascular tone, immunity, coagulation, and permeability. Endothelial dysfunction occurs in ...

Isolation of Mouse Coronary Endothelial Cells

Endothelial cells line the inner wall of blood vessels and play an important role in the regulation of vascular tone, vascular permeability, and new vascular formation. Endothelial cell dysfunction is implicated in the development and progression of many cardiovascular diseases including ischemic heart disease. To examine the function and characterization of coronary endothelial cells, cell isolation is the first step and it requires high purity and quantity to conduct subsequent experiments. This protocol describes an efficient method to isolate adult mouse coronary endothelial cells. The mouse heart is dissected and minced into small pieces. After the digestion of the heart using dispase and collagenase II, cells are washed&#160;and incubated with magnetic beads which are conjugated with anti-CD31 antibody. The beads with endothelial cells are washed several times and are ready to use in various applications, including imaging and molecular biological experiments. Efficient isolation yields approximately 104 cells per one heart with over 90% purity.

This protocol is prepared to share our method of isolating mouse coronary endothelial cells for the purpose of imaging or to conduct molecular biological experiments.

Endothelial cells line the inner wall of blood vessels and play an important role in the regulation of vascular tone, vascular permeability, and new ...

A Simple High Efficiency Protocol for Pancreatic Islet Isolation from Mice

Pancreatic islets, also called the Islets of Langerhans, are a cluster of endocrine cells which produces hormones for glucose regulation and other important biological functions. The islets primarily consist of five types of hormone-secreting cells: &#945; cells secrete glucagon, &#946; cells secrete insulin, &#948; cells secrete somatostatin, &#949; cells secrete ghrelin, and PP cells secrete pancreatic polypeptide. Sixty to 80% of the cells in the islets are &#946; cells, which are the most important cell population to study insulin secretion. Pancreatic islets are a crucial model system to study ex vivo insulin secretion. Acquiring high quality islets is of great importance for diabetes research. Most islet isolation procedures require technically difficult to access site of collagenase injection, harsh and complex digestion procedures, and multiple density gradient purification steps. This paper features a simple high yield mouse islet isolation method with detailed descriptions and realistic demonstrations, showing the following specific steps: 1) injection of collagenase P at the ampulla of Vater, a small area joining the pancreatic duct and the common bile duct, 2) enzymatic digestion and mechanical separation of the exocrine pancreas, and 3) a single gradient purification step. The advantages of this method are the injection of digestive enzyme using the more accessible ampulla of Vater, more complete digestion using combination of enzymatic and mechanical approaches, and a simpler single gradient purification step. This protocol produces approximately 250&#8212;350 islets per mouse; and islets are suitable for various ex vivo studies. Possible caveats of this procedure are potentially damaged islets due to enzymatic digestion and/or prolonged gradient incubation, all of which can be largely avoided by careful ad justification of incubation time.

This islet isolation protocol described a novel route of collagenase injection to digest the exocrine tissue and a simplified gradient procedure to purify the islets from mice. It involves enzymatic digestion, gradient separation/purification, and islet hand-picking. Successful isolation can yield 250&#8211;350 high quality and fully functional islets per mouse.

Pancreatic islets, also called the Islets of Langerhans, are a cluster of endocrine cells which produces hormones for glucose regulation and other ...

Imaging Calcium Dynamics in Subpopulations of Mouse Pancreatic Islet Cells

Pancreatic islet hormones regulate blood glucose homeostasis. Changes in blood glucose induce oscillations of cytosolic calcium in pancreatic islet cells that trigger secretion of three main hormones: insulin (from &#946;-cells), glucagon (&#945;-cells) and somatostatin (&#948;-cells). &#946;-Cells, which make up the majority of islet cells and are electrically coupled to each other, respond to the glucose stimulus as one single entity. The excitability of the minor subpopulations, &#945;-cells and &#948;-cells (making up around 20% (30%) and 4% (10%) of the total rodent1 (human2) islet cell numbers, respectively) is less predictable and is therefore of special interest.
Calcium sensors are delivered into the peripheral layer of cells within the isolated islet. The islet or a group of islets is then immobilized and imaged using a fluorescence microscope. The choice of the imaging mode is between higher throughput (wide-field) and better spatial resolution (confocal). Conventionally, laser scanning confocal microscopy is used for imaging tissue, as it provides the best separation of the signal between the neighboring cells. A wide-field system can be utilized too, if the contaminating signal from the dominating population of &#946;-cells is minimized.
Once calcium dynamics in response to specific stimuli have been recorded, data are expressed in numerical form as fluorescence intensity vs. time, normalized to the initial fluorescence and baseline-corrected, to remove the effects linked to bleaching of the fluorophore. Changes in the spike frequency or partial area under the curve (pAUC) are computed vs. time, to quantify the observed effects. pAUC is more sensitive and quite robust whereas spiking frequency provides more information on the mechanism of calcium increase.
Minor cell subpopulations can be identified using functional responses to marker compounds, such as adrenaline and ghrelin, that induce changes in cytosolic calcium in a specific populations of islet cells.

Here, we present a protocol for imaging and quantifying calcium dynamics in heterogeneous cell populations, such as pancreatic islet cells. Fluorescent reporters are delivered into the peripheral layer of cells within the islet, which is then immobilized and imaged, and per-cell analysis of the dynamics of fluorescence intensity is performed.

Pancreatic islet hormones regulate blood glucose homeostasis. Changes in blood glucose induce oscillations of cytosolic calcium in pancreatic islet cells ...

Isolation and Characterization of Mouse Primary Liver Sinusoidal Endothelial Cells

Liver sinusoidal endothelial cells (LSECs) are specialized endothelial cells located at the interface between the circulation and the liver parenchyma. LSECs have a distinct morphology characterized by the presence of fenestrae and the absence of basement membrane. LSECs play essential roles in many pathological disorders in the liver, including metabolic dysregulation, inflammation, fibrosis, angiogenesis, and carcinogenesis. However, little has been published about the isolation and characterization of the LSECs. Here, this protocol discusses the isolation of LSEC from both healthy and nonalcoholic fatty liver disease (NAFLD) mice. The protocol is based on collagenase perfusion of the mouse liver and magnetic beads positive selection of nonparenchymal cells to purify LSECs. This study characterizes LSECs using specific markers by flow cytometry and identifies the characteristic phenotypic features by scanning electron microscopy. LSECs isolated following this protocol can be used for functional studies, including adhesion and permeability assays, as well as downstream studies for a particular pathway of interest. In addition, these LSECs can be pooled or used individually, allowing multi-omics data generation including RNA-seq bulk or single cell, proteomic or phospho-proteomics, and Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq), among others. This protocol will be useful for investigators studying LSECs&#39; communication with other liver cells in health and disease and allow an in-depth understanding of the role of LSECs in the pathogenic mechanisms of acute and chronic liver injury.

Here we outline and demonstrate a protocol for primary mouse liver sinusoidal endothelial cell (LSEC) isolation. The protocol is based on liver collagenase perfusion, nonparenchymal cell purification by low-speed centrifugation, and CD146 magnetic bead selection. We also phenotype and characterize these isolated LSECs using flow cytometry and scanning electron microscopy.

Liver sinusoidal endothelial cells (LSECs) are specialized endothelial cells located at the interface between the circulation and the liver parenchyma. ...

Isolation of Mouse Pancreatic Endothelial Cells

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video