This research was completed with the financial support of Kindstar Global Corporation and the help of the leaders of the Molecular Biology Laboratory and related colleagues. Thanks to the company, leaders, and relevant colleagues for their support and help. This article is only used for scientific research and does not constitute any commercial activity.

This study was approved by the medical ethics review committee of Yongzhou Central Hospital (approval number: 2024022601). The participants provided informed consent.
1. Primer design
<ol>
	<li>Conventional primer design: Design primers according to the reported primer design rules20, primer design by NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). For the mutation site of RHOA G17V, all reference sequences for the design of conventional primers are the mutated base sequence. Ensure the designed reverse amplification primers contain the mutation site sequence and the annealing temperature of the primers is about 60 &#176;C.</li>
	<li>BDA primer design
	<ol>
		<li>Design the wild blocking primer with a length of about 20-30 base pairs (bp), containing 2-4 modified bases, and the modified bases composed of A and T. Ensure the blocking primer has 6-14 bp overlapping with the mutation amplification primer, used to compete with the mutation amplification primer.</li>
		<li>Design the primer with an annealing temperature for the final designed mutant amplification primers and wild blocking primers set at about 60 &#176;C, and the difference in Gibbs free energy between 0.8-5 kcal/mol. For detailed calculation rules, refer to literature15. 
		NOTE: When the designed primers do not meet the above conditions, bases can be added or subtracted manually for adjustment. The final designed primer list is shown in Table 1 and Table 2.</li>
	</ol>
	</li>
</ol>
2. Sample preparation and DNA extraction
NOTE: Experimental verification samples are all sourced from human lymphoma patients&#39; peripheral blood, bone marrow, or solid tumor samples. There were 10 positive samples: 3 were solid tumor samples, 4 were bone marrow samples, and 3 were peripheral blood samples. There are 30 negative samples from healthy people.
<ol>
	<li>Extraction of bone marrow and peripheral blood samples
	<ol>
		<li>Add 400 &#181;L of bone marrow or peripheral blood sample and reagents into the corresponding tubes according to the requirements and extract according to the manufacturer&#39;s extraction procedure.</li>
		<li>Prepare new sample tubes and 1.5 mL microcentrifuge tubes. Number the sample tubes from 1-24. Mark the 1.5 mL tube covers with the sample name and extraction date in the order of the names on the corresponding blood collection tubes. Mark 1-24 on the side of the microcentrifuge tube for one-to-one correspondence check.</li>
		<li>Add 40 &#181;L of proteinase K solution to the sample tube and add 400 &#181;L of whole blood sample (for volumes less than 400 &#181;L, fill to 400 &#181;L with PBS).</li>
		<li>Put the sample tube (1-24), pipette tip (including pipette cover), and collection tube in the corresponding positions. Extract DNA according to the manufacturer&#39;s procedure.</li>
	</ol>
	</li>
	<li>Extraction of Formalin-Fixed Paraffin-Embedded (FFPE) samples
	<ol>
		<li>Put the samples and reagents into the corresponding tubes according to the requirements and extract according to the manufacturer&#39;s extraction procedure.</li>
		<li>Add 1.1 mL of proteinase K storage buffer (PK solution) to the proteinase K dry powder, vortex, and mix well to obtain a proteinase K solution with a concentration of 10 mg/mL. Store at -20 &#176;C.</li>
		<li>Take out the proteinase K solution and melt it completely at room temperature. Run the dry thermostat and set the temperature at 55 &#176;C.</li>
		<li>Take a 1.5 mL microcentrifuge tube and write the sample name on it. Take less than 30 mg of tissue and put it into the microcentrifuge tube. Then, add 500 &#181;L of Deparaffin Buffer and 20 &#181;L proteinase K solution to the tube.</li>
		<li>After vortex mixing for at least 10 s, place the microcentrifuge tube in a dry thermostat and keep it warm at 55 &#176;C for 90 min.</li>
		<li>Make sure the spin column fits in the filter tube. After the incubation is completed, transfer the sample, including liquid and tissue, to the spin column. Centrifuge at 16,500 x g for 5 min to centrifuge all the liquid into the filter tube.</li>
		<li>Take 1 sample tube (without cap) included with the kit and write the sample name on it. Transfer the liquid from the 400 &#181;L filter tube to the sample tube.</li>
		<li>After the sample pretreatment and preparation are completed, place the corresponding consumables and reagents in the corresponding positions and perform DNA extraction according to the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>DNA quality control
	<ol>
		<li>Measure the concentration and purity of the extracted DNA and ensure DNA concentration is &#8805; 25 ng/&#181;L. Record each sample&#39;s DNA concentration and use immediately for subsequent detection or freeze at -20 &#176;C. 
		NOTE: OD260/OD280 values are generally used to test the purity of DNA samples. The normal OD260/OD280 value is about 1.7-1.9, indicating that the DNA purity is good; if the OD260/OD280 value is &#8804;1.7, it indicates that there may be protein contamination; if the OD260/OD280 value is &#8805;2.0, it indicates that there may be RNA contamination or DNA has been degraded.</li>
	</ol>
	</li>
</ol>
3. PCR amplification
<ol>
	<li>Preparation of primers
	<ol>
		<li>Preparation of primer stock solution
		<ol>
			<li>Take out the primer dry powder and centrifuge at 5400-8400 x g for 2-3 min. Check the nmol value of the primer and slowly open the lid. Using a pipette with the corresponding volume of Double distilled water (ddH2O), which is 10x of the nM value, slowly add it along the wall of the primer tube.</li>
			<li>Prepare primers at 0.1 nM/&#181;L or 100 &#181;M stock solution (e.g., the nM value is 21.1; correspondingly, the water to be added is 211 &#181;L). Vortex mix thoroughly, then centrifuge briefly to ensure the solution reaches the bottom of each well. Write the primer name, configuration data, and configuration person on the tube cap. Put it into the corresponding stock solution storage location.</li>
		</ol>
		</li>
		<li>Preparation of primer working solution
		<ol>
			<li>Pipette 5 &#181;L of forward primer, 5 &#181;L of reverse primer, 50 &#181;L of wildtype primer stock solution, and 40 &#181;L of ddH2O in a clean microcentrifuge tube. Pipette repeatedly 2x-3x, vortex to mix, and spin off instantly.</li>
			<li>Write the name of the primer, the date of configuration, and the person who configured it on the tube cap and put it into the corresponding storage location of the working solution.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>PCR amplification procedure
	<ol>
		<li>For each reaction, add 5 &#181;L of PCR amplification enzyme master mix, 1 &#181;L of primer working solution, and 1 &#181;L of DNA template (template input amount needs to reach 400 ng, if the DNA concentration is not sufficient; increase the volume of DNA and reduce the volume of ddH2O added) and 3 &#181;L of ddH2O. Vortex to mix and spin off instantly.</li>
		<li>Put the PCR reaction tube on the pre-set PCR instrument for PCR amplification. Set the thermal cycle program of the PCR instrument as follows and run: 
		&#8203;95 &#176;C for 3 min; 20 cycles of 95 &#176;C for 30 s, 68 &#176;C for 15 s (decrease 0.5 &#176;C per cycle), 72 &#176;C for 1 min; 16 cycles of 95 &#176;C for 30 s, 58 &#176;C for 15 s, 72 &#176;C for 1 min; and 72 &#176;C for 10 min.</li>
	</ol>
	</li>
	<li>Perform gel electrophoresis on the PCR product with 2% agarose to check whether the target fragment is amplified.</li>
	<li>Purification of PCR products
	<ol>
		<li>Bring purificase I and purificase II to room temperature and spin off instantly. Prepare the PCR product purification reaction as follows: 1 &#181;L of purificase I, 0.5 &#181;L of purificase II, 3 &#181;L of PCR product, and 3.5 &#181;L of ddH2O.</li>
		<li>Put the PCR reaction tube on the pre-set PCR instrument for PCR amplification. Set the thermal cycle program of the PCR instrument as follows and run the machine: 
		37 &#176;C for 30 min, 95 &#176;C for 15 min.</li>
	</ol>
	</li>
</ol>
4. Sequencing of PCR products after purification
<ol>
	<li>Sequencing
	<ol>
		<li>Bring the sequencing amplification enzyme master mix, buffer, and ddH2O to room temperature. After the reagent has liquified, spin off instantly.</li>
		<li>Prepare the sequencing reaction system as follows: 1.8 &#181;L of sequencing buffer, 0.4 &#181;L of sequencing amplification enzyme master mix, 1 &#181;L of sequencing primer, 0.8 &#181;L of purified PCR product, and 6 &#181;L of ddH2O.</li>
		<li>Put the PCR reaction tube on the pre-set PCR instrument for PCR amplification. Set the thermal cycle program of the PCR instrument as follows and run: 96 &#176;C for 3 min; 28 cycles of 96 &#176;C for 25 s, 56 &#176;C for 15 s, 60 &#176;C for 4 min.</li>
		<li>After the sequencing reaction is finished, remove the product from the PCR instrument. Store reaction products in the refrigerator, protected from light.</li>
	</ol>
	</li>
	<li>Purification of sequencing products
	<ol>
		<li>Vortex the magnetic beads thoroughly. Add 10 &#181;L of magnetic beads and 40 &#181;L of 80% alcohol to the 96-well plate and seal the plate with a film.</li>
		<li>Place the 96-well plate with magnetic beads and alcohol on the vortex shaker for 10 s to fully suspend and mix the magnetic beads (observing whether there is magnetic bead precipitation at the bottom and be careful not to get the liquid on the sealing film). Put it on a horizontal oscillator and tie it with a rubber band to vibrate for 3-5 min (maximum gear).</li>
		<li>After oscillating, put the PCR plate on the magnetic stand, pay attention to pressing it tightly. Keep the stand at 4 &#176;C for static adsorption for 3 min, and after the magnetic beads are all adsorbed on the wall, remove the sealing film and pour out the waste liquid.</li>
		<li>Add 40 &#181;L of 80% alcohol to the PCR plate, rinse the beads, and pour off the waste liquid. Place the plate on absorbent paper and pat it gently (Do not let the PCR plate separate from the disk). Repeat 1x.</li>
		<li>Put the absorbent paper upside down together with the magnetic plate into the centrifuge at 120 x g for a quick spin.</li>
		<li>Put the PCR plate containing the magnetic beads after removing the alcohol into the oven at 60 &#176;C for 3-5 min. Dry the beads completely. 
		NOTE: If there is no oven, place the plate at room temperature for 10 min.</li>
		<li>Add 40 &#181;L of pure water after drying. Place the sealing film on the plate and shake it on a vortex shaker for 3-5 s. Put the plate on a horizontal shaker, tie it firmly, and shake it for 3-5 min to dissolve the purified sequencing product.</li>
		<li>Spin the dissolved sequencing product at 180 x g and use the product for genomic analysis using capillary electrophoresis21 (Note that the supporting disk needs to be added to the sample board).</li>
	</ol>
	</li>
	<li>Analysis of sequencing results
	<ol>
		<li>Obtain the sequencing results from the software. Refer to the software manual for detailed operation procedures. Use the reference sequence from NCBI.</li>
	</ol>
	</li>
</ol>

Optimizing Low-Frequency Mutation Detection with Wild-Type Blocking PCR

<ol>
	<li>Penn Medicine. Testing for measurable/minimal residual disease (MRD) Available from: <a target="_blank" href="https://www.oncolink.org/cancer-treatment/procedures-diagnostic-tests/blood-tests-tumordiagnostic-tests/testing-for-measurable-minimal-residualdisease-mrd">https://www.oncolink.org/cancer-treatment/procedures-diagnostic-tests/blood-tests-tumordiagnostic-tests/testing-for-measurable-minimal-residualdisease-mrd</a> (2019)</li><li>Xie, Y., Elaine, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+I+diagnose+angioimmunoblastic+T-cell+lymphoma.">How I diagnose angioimmunoblastic T-cell lymphoma.</a> Am J Clin Pathol. 156, 1-14 (2021).</li><li>Mariko, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angioimmunoblastic+T-cell+lymphoma.">Angioimmunoblastic T-cell lymphoma.</a> Cancer Treat Res. 176, 99-126 (2019).</li><li>Daniel, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+2016+revision+to+the+World+Health+Organization+classification+of+myeloid+neoplasms+and+acute+lukemia.">The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute lukemia.</a> Blood. 127 (20), 2391-2405 (2016).</li><li>Rita, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+5th+edition+of+the+World+Health+Organization+Classification+of+Haematolymphoid+Tumours+:+Lymphoid+Neoplasms.">The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours : Lymphoid Neoplasms.</a> Leukemia. 36 (7), 1720-1748 (2022).</li><li>Hae, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recurrent+inactivating+mutation+in+RHOA+GTPase+in+angioimmunoblastic+T+cell+lymphoma.">A recurrent inactivating mutation in RHOA GTPase in angioimmunoblastic T cell lymphoma.</a> Nat Genet. 46 (4), 371-375 (2014).</li><li>Lee, P. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RHOA+G17V+mutation+in+angioimmunoblastic+T-cell+lymphoma:A+potential+biomarker+for+cytological+assessment.">RHOA G17V mutation in angioimmunoblastic T-cell lymphoma:A potential biomarker for cytological assessment.</a> Exp Mol Pathol. 110, 104294 (2019).</li><li>Mamiko, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+RHOA+mutation+in+angioimmunoblastic+T+cell+lymphoma.">Somatic RHOA mutation in angioimmunoblastic T cell lymphoma.</a> Nat Genet. 46 (2), 171-175 (2014).</li><li>Palomero, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recurrent+mutations+in+epigenetic+regulators,+RHOA+and+FYN+kinase+in+peripheral+T+cell+lymphomas.">Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas.</a> Nat Genet. 46 (2), 166-170 (2014).</li><li>Fujisawa, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+RHOA-VAV1+signaling+in+angioimmunoblastic+T-cell+lymphoma.">Activation of RHOA-VAV1 signaling in angioimmunoblastic T-cell lymphoma.</a> Leukemia. 32 (3), 694-702 (2018).</li><li>Voena, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RHO+family+GTPases+in+the+biology+of+lymphoma.">RHO family GTPases in the biology of lymphoma.</a> Cells. 8 (7), 646 (2019).</li><li>Shendure, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+an+40:+past,+present+and+future.">DNA sequencing an 40: past, present and future.</a> Nature. 550 (7676), 345-353 (2017).</li><li>Athanasios, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Sanger+sequencing,+pyrosequencing,+and+melting+curve+analysis+for+the+detection+of+KRAS+mutations:+diagnostic+and+clinical+implications.">Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications.</a> J Mol Diagn. 12 (4), 425-432 (2010).</li><li>Wu, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+enrichment+of+rare+DNA+variants+via+sequence-selective+and+temperature-robust+amplification.">Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification.</a> Nat Biomed Eng. 1, 714-723 (2017).</li><li>John, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thermodynamics+of+DNA+structural+motifs.">The thermodynamics of DNA structural motifs.</a> Annu Rev Biophys Biomol Struct. 33, 415-440 (2004).</li><li>Coren, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-based+methods+for+the+enrichment+of+minority+alleles+and+mutations.">PCR-based methods for the enrichment of minority alleles and mutations.</a> Clin Chem. 55 (4), 632-640 (2009).</li><li>Eliza, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+tumor+DNA+in+B-cell+lymphoma:+technical+advances,+clinical+applications,+and+perspectives+for+translational+research.">Circulating tumor DNA in B-cell lymphoma: technical advances, clinical applications, and perspectives for translational research.</a> Leukemia. 36 (9), 2151-2164 (2022).</li><li>Lee, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hot-spot-specific+probe+(HSSP)+for+rapid+and+accurate+detection+of+KRAS+mutations+in+colorectal+cancer.">Hot-spot-specific probe (HSSP) for rapid and accurate detection of KRAS mutations in colorectal cancer.</a> Biosensors. 12 (8), 597 (2022).</li><li>Matsubara, R. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+the+G17V+RHOA+mutation+in+angioimmunoblastic+T-cell+lymphoma+and+related+lymphomas+using+quantitative+allele-specific+PCR.">Detection of the G17V RHOA mutation in angioimmunoblastic T-cell lymphoma and related lymphomas using quantitative allele-specific PCR.</a> PLoS One. 9 (10), e109714 (2014).</li><li>Dieffenbach, C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3 (3), S30-S37 (1993).</li><li>Applied Biosystems. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=User+Guide+for+Applied+Biosystems.">User Guide for Applied Biosystems.</a> 3730/3730xl DNA Analyzer. , (2014).</li></ol>

The authors have nothing to disclose.

The WTB-PCR based on BDA technology, described in this article, introduces a mismatched primer complementary to the mutant type when designing conventional primers to compete with the wild type, suppress the wild type, and amplify the mutant product. Then, the WTB-PCR products were sequenced for mutation analysis. The utility of WTB-PCR/Sanger is its simplicity and high sensitivity. According to the detection scheme established in this paper, most existing Sanger-based assays can be added with suppressor primers via BDA, thereby increasing detection sensitivity. The RHOA G17V mutation introduced in this article was sequenced by Sanger sequencing after WTB-PCR based on BDA technology. When the input amount of DNA reaches 400 ng, the detection sensitivity can reach 0.5% or even 0.1%. The detection sensitivity of different genes needs to be confirmed by the amount of DNA input, gene sequence, etc.
The key to WTB-PCR is the design of primers, and this technology can only detect known mutations. This article describes an application of this technology in Sanger sequencing. This technology can also be applied to next-generation sequencing, quantitative PCR, etc., and it can also be used in multiplex PCR detection. This WTB-PCR can reduce the lower limit of these detection methods and can be better applied to MRD monitoring. Most methods based on PCR can only detect a small number of mutation sites, and NGS-based methods can detect multiple sites, but the cost is high, and the process is complicated14,15,16,17,18. WTB-PCR has the characteristics of high sensitivity, low cost, and strong flexibility, making it an ideal choice for low-frequency mutation detection, which can greatly improve the detection sensitivity of Sanger sequencing and its application in MRD detection.

Minimal residual disease (MRD) is the small number of cancer cells that are still present in the body after treatment. Due to their small number, they do not lead to any physical signs or symptoms. They often go undetected by traditional methods, such as microscopic visualization and/or tracking abnormal serum proteins in the blood. An MRD positive test result indicates the presence of residual diseased cells. A negative result means that residual diseased cells are absent. Post-cancer treatment, the remaining cancer cells in the body can become active and start to multiply, causing a disease relapse. Detecting MRD is indicative that either the treatment was not completely effective or that the treatment was incomplete. Another reason for MRD-positive results after treatment might be that not all the cancer cells responded to the therapy or because the cancer cells became resistant to the medications used1.
Angioimmunoblastic T-cell lymphoma (AITL) is a subtype of peripheral T-cell lymphoma (PTCL) derived from T follicular helper cells2; it is the most common type of T-cell lymphoma, accounting for about 15%-20% of PTCL3. It is a group of related malignancies that affect the lymphatic system. The cell of origin is the follicular T helper cell. The 2016 WHO classification categorizes it as Angioimmunoblastic T-cell Lymphoma4. In 2022, WHO renamed it as Nodal T-follicular helper cell lymphoma, angioimmunoblastic-type (nTFHL-AI), together with Nodal T-follicular helper cell lymphoma, follicular-type (nTFHL-F) and Nodal T-follicular helper cell lymphoma, not otherwise specified (nTFHL-NOS), collectively referred to as nodular follicular helper T cell lymphoma (nTFHL). This was done to identify its important clinical and immunophenotypic features and similar T follicular helper (TFH) gene expression signatures and mutants. Genetically, nTFHL-AI is characterized by the progressive acquisition of somatic mutations in early hematopoietic stem cells through TET2 and DNMT3A mutations, while RHOA and IDH2 mutations are also present in TFH tumor cells5. Several studies have shown that RHOA G17V mutation occurs in 50%-80% of AITL patients6,7,8,9. The RHOA protein encoded by the RHOA gene is activated by guanosine triphosphate (GTP) binding and inactivated by guanosine diphosphate (GDP) binding. When activated, it can bind to a variety of effector proteins and regulate a variety of biological processes. Physiologically, RHOA mediates T cell migration and polarity, plays a role in thymocyte development, and mediates activation of pre-T cell receptor (pre-TCR) signaling10. The RHOA G17V mutation is a loss-of-function mutation that plays a driving role in lymphoma pathogenesis11. The detection of its low-frequency mutation is helpful for the MRD monitoring of AITL.
Sanger sequencing has been used for more than 40 years as the gold standard for the detection of known and unknown mutations. However, its detection limit is only 5%-20%, which limits its application for low-frequency mutation detection12,13. In Sanger sequencing, the detection sensitivity can be decreased to 0.1% by replacing the traditional PCR with BDA, a wild-blocking technology14. BDA technology mainly adds a mismatched primer complementary to the mutant type when designing conventional primers to compete with the wild type so as to achieve the purpose of amplifying the mutant type. The key to primer design is the mismatch primer and the terminal modification. At the same time, according to the structural principle of DNA, the difference between the Gibbs free energy of the two primers is between 0.8 kcal/mol and 5 kcal/mol. Another key step in this technique is to suppress wild-type amplification by adjusting the ratio of wild-type and blocking primers14,15.
At present, common low-frequency somatic mutation detection techniques include PCR-based allele-specific PCR (allele-specific polymerase chain reaction, ASPCR), amplification-refractory mutation system PCR (amplification-refractory mutation system-PCR, ARMS-PCR) used for genotyping SNP with the help of refractory primers. Designing primers for the mutant and normal alleles allows selective amplification and digital PCR (Droplet Digital PCR, ddPCR), a method for performing digital PCR that is based on water-oil emulsion droplet technology16. A sample is fractionated into 20,000 droplets, and for each droplet, a PCR amplification of the template molecules is done with a sensitivity of 1 x 10-5; blocker displacement amplification (BDA) is also a PCR-based rare allele enrichment method used for accurate detection and quantitation of SNVs and indels down to 0.01% VAF in a highly multiplexed environment; locked nucleic acid technology (non-extendable locked nucleic acid, LNA), is a class of high-affinity RNA analogs in which the ribose ring is locked in the ideal conformation for Watson-Crick binding; hotspot-specific probes (Hot-Spot-Specific Probe, HSSP), overlap the target primer sequence, include a single mutation, and are modified with a C3 spacer at the C3&#39; end to prevent amplification by qPCR14,16,17,18. When a mutation in the sequence exists, the HSSP competitively attaches to the target mutation and prevents the primer from binding to the target mutant sequence which stops sequence amplification; NGS (next-generation sequencing) - based immunoglobulin high-throughput sequencing (igHTS) Cancer Personalized Profiling by Deep Sequencing (CAAP-seq), it is a next-generation sequencing-based method used to quantify circulating DNA in cancer cells (sensitivity is 1 x 10-4); etc. Among them, most methods are based on PCR and can only detect a small number of mutation sites, and the NGS-based methods can detect multiple sites, but the cost is high, and the process is complicated14,16,17,18. There have been reports on the detection of RHOA G17V low-frequency mutations based on the qPCR, but the detection limit can only reach about 2%19. There is no report on the detection of RHOA G17V low-frequency mutation based on Sanger sequencing. Here, we demonstrate the increase in sensitivity achieved by BDA, a wild-type block PCR combined with Sanger sequencing, to optimize the detection of RHOA G17V low-frequency somatic mutations, and the detection sensitivity can reach 0.5%. Additional data for IDH2 and JAK1 is also provided.
This article provides a detailed protocol of RHOA G17V low-frequency detection scheme by Sanger sequencing and provides a reference for the development of more low-frequency mutation detection based on the Sanger sequencing platform. This method can be used to detect and monitor possible drug-resistance mutations and minimal residues in tumors.

<table><tbody><tr><td>Automatic DNA extractor</td><td>9001301</td><td>Qiagen</td><td></td></tr><tr><td>DNA nucleic acid detector</td><td>Q32854</td><td>Thermo fisher</td><td></td></tr><tr><td>PCR amplification kit</td><td>P4600</td><td>merck</td><td></td></tr><tr><td>PCR instrument</td><td>C1000 Touch</td><td>Biorad</td><td></td></tr><tr><td>proteinase K solution</td><td>D3001-2-A</td><td>zymo research</td><td></td></tr><tr><td>proteinase K storage buffer</td><td>D3001-2-C</td><td>zymo research</td><td></td></tr><tr><td>Sequencing amplification enzyme kit</td><td>P7670-FIN</td><td>Qiagen</td><td></td></tr></tbody></table>

wild-type blocking pcr combined with sanger sequencing for detection of low-frequency somatic mutation

When monitoring minimal residual disease (MRD) after tumor treatment, there are higher requirements of the lower limit of detection than when detecting for drug resistance mutations and circulating tumor cell mutations during therapy. Traditional Sanger sequencing has 5%-20% wild-type mutation detection, so its limit of detection cannot meet the corresponding requirements. The wild-type blocking technologies that have been reported to overcome this include blocker displacement amplification (BDA), non-extendable locked nucleic acid (LNA), hot-spot-specific probes (HSSP), etc. These technologies use specific oligonucleotide sequences to block wild-type or recognize wild-type and then combine this with other methods to prevent wild-type amplification and amplify mutant amplification, leading to characteristics like high sensitivity, flexibility, and convenience. This protocol uses BDA, a wild-type blocking PCR combined with Sanger sequencing, to optimize the detection of RHOA G17V low-frequency somatic mutations, and the detection sensitivity can reach 0.5%, which can provide a basis for MRD monitoring of angioimmunoblastic T-cell lymphoma.

Compare the test sample's sequence with the reference sequence to obtain the test sample's mutation status. BDA-based WBT-PCR technology can detect the known RHOA G17V mutation and other low-frequency mutations in the amplification interval of upstream and downstream primers. See Figure 1. Two additional genes, namely IDH2 and JAK1, were also analyzed using this method, Figure 2 and Figure 3, respectively. The results show that this method is quite sensitive in detecting low-frequency mutations.
<img alt="DNA sequencing chromatogram; PCR method comparison, wild type vs. WBT-PCR mutations analysis." class="xfigimg" src="/files/ftp_upload/65647/65647fig01.jpg" data-altupdatedat="1747911167000" data-alt="Figure 1"> 
Figure 1: Sequencing result for RHOA. From top to bottom, the figure shows the base mutation of the RHOA G17 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type RHOA G17. The middle picture shows the sequencing results of the c.50G&gt;T mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. The bottom picture shows the sequencing results of the c.49-50delinsTT mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65647/65647fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="PCR sequencing results, WBT-PCR c.515G&gt;A mutation, traditional PCR IDH2 wild type, chromatogram comparison." class="xfigimg" src="/files/ftp_upload/65647/65647fig02v2.jpg" data-altupdatedat="1747911167000" data-alt="Figure 2"> 
Figure 2: Sequencing result for IDH2. From top to bottom, the figure above shows the base mutation of the IDH2 R172 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type IDH2 R172. The top picture shows the sequencing results of the c.515G&gt;A mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65647/65647fig02largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="DNA sequencing chromatogram, WBT-PCR vs. traditional PCR, highlighting mutation c.2108G&gt;T in JAK1." class="xfigimg" src="/files/ftp_upload/65647/65647fig03.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3: Sequencing result for JAK1. From top to bottom, the figure above shows the base mutation of the JAK1 S703 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type JAK1 S703. The top picture shows the sequencing results of the c.2108G&gt;T mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65647/65647fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td colspan="2">Primer sequence</td>
		</tr>
		<tr>
			<td>RHOA-VF</td>
			<td colspan="2">ATAACCTTTTGGTGCCAGGT</td>
		</tr>
		<tr>
			<td>RHOA-VR</td>
			<td colspan="2">GCTGAAGACTATGAGCAAGCA</td>
		</tr>
		<tr>
			<td>RHOA-WTB</td>
			<td colspan="2">AGCAAGCATGTCTTTCCACAGGCAAAA</td>
		</tr>
		<tr>
			<td>Sequencing primer </td>
			<td colspan="2">ATAACCTTTTGGTGCCAGGT</td>
		</tr>
	</tbody>
</table>
Table 1: The final designed primer list of RHOA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>IDH2 R172 primer</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer</td>
			<td>Primer sequence</td>
		</tr>
		<tr>
			<td>IDH2-VF</td>
			<td>CTGGTTGAAAGATGGCGGCT</td>
		</tr>
		<tr>
			<td>IDH2-VR</td>
			<td>TACCTGGTCGCCATGGGC</td>
		</tr>
		<tr>
			<td>IDH2-WTB</td>
			<td>GCCATGGGCGTGCCTGCCAAAAT</td>
		</tr>
		<tr>
			<td>Sequencing primer</td>
			<td>CTGGTTGAAAGATGGCGGCT</td>
		</tr>
		<tr>
			<td>JAK1 gene primer</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer</td>
			<td>Primer sequence</td>
		</tr>
		<tr>
			<td>JAK1-VF</td>
			<td>ACTCTGAGGCCGAGTAGTGT</td>
		</tr>
		<tr>
			<td>JAK1-VR</td>
			<td>CCATTATGGACATCAGGACATTC</td>
		</tr>
		<tr>
			<td>JAK1-WTB</td>
			<td>GGACATTCTCACCAAGTAGCTCAGAAAA</td>
		</tr>
		<tr>
			<td>Sequencing primer</td>
			<td>ACTCTGAGGCCGAGTAGTGT</td>
		</tr>
	</tbody>
</table>
Table 2: The final designed primer list of IDH2 and JAK1.

Author Spotlight: Advancing the Detection of Low-Frequency Mutations in Cancer Tissues

This article introduces the application of a low-frequency detection method based on Sanger sequencing in angioimmunoblastic lymphoma. Provide a basis for applying this method to other diseases.

Wild-type Blocking PCR Combined with Sanger Sequencing for Detection of Low-frequency Somatic Mutation

When monitoring minimal residual disease (MRD) after tumor treatment, there are higher requirements of the lower limit of detection than when detecting ...

wild-type-blocking-pcr-combined-with-sanger-sequencing-for-detection

Nanyang Technological University

Research

JoVE Journal

Genetics

994 Views.  Kindstar Global Technology Inc.. We zijn geïnteresseerd in het begrijpen van laagfrequente somatische mutaties in kankerweefsels. Dit artikel introduceert de toepassing voor de detectiemethode voor laagfrequente mutaties op basis van onze Sanger-sequencing in angioimmunoblastisch lymfoomtest, en biedt een basis voor het toepassen van deze methode op andere ziektetests. Momenteel zijn er detectiemethoden voor laagfrequente mutaties, zoals kwantitatieve PCR, digitale PCR en NGS.Maar er...

Video: Auteur in de schijnwerpers: het bevorderen van de detectie van laagfrequente mutaties in kankerweefsels

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Wild-type Blocking PCR Combined with Direct Sequencing as a Highly Sensitive Method for Detection of Low-Frequency Somatic Mutations

Accurate detection and identification of low frequency mutations can be problematic when assessing residual disease after therapy, screening for emerging resistance mutations during therapy, or when patients have few circulating tumor cells. Wild-type blocking PCR followed by sequencing analysis offers high sensitivity, flexibility, and simplicity as a methodology for detecting these low frequency mutations. By adding a custom designed locked nucleic acid oligonucleotide to a new or previously established conventional PCR based sequencing assay, sensitivities of approximately 1 mutant allele in a background of 1,000 WT alleles can be achieved (1:1,000). Sequencing artifacts associated with deamination events commonly found in formalin fixed paraffin embedded tissues can be partially remedied by the use of uracil DNA glycosylase during extraction steps. The optimized protocol here is specific for detecting MYD88 mutation, but can serve as a template to design any WTB-PCR assay. Advantages of the WTB-PCR assay over other commonly utilized assays for the detection of low frequency mutations including allele specific PCR and real-time quantitative PCR include fewer occurrences of false positives, greater flexibility and ease of implementation, and the ability to detect both known and unknown mutations.

Wild-type blocking PCR followed by direct sequencing offers a highly sensitive method of detection for low frequency somatic mutations in a variety of sample types.

Accurate detection and identification of low frequency mutations can be problematic when assessing residual disease after therapy, screening for emerging ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Detection of microRNA Expression in Peritoneal Membrane of Rats Using Quantitative Real-time PCR

MicroRNAs (miRNAs) are small noncoding RNAs that regulate messenger RNA expression post-transcriptionally. The miRNA expression profile has been investigated in various organs and tissues in rat. However, standard methods for the purification of miRNAs and detection of their expression in rat peritoneal membrane have not been well established. We have developed an effective and reliable method to purify and quantify miRNAs using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) in rat peritoneal membrane. This protocol consists of four steps: 1) purification of peritoneal membrane sample; 2) purification of total RNA including miRNA from peritoneal membrane sample; 3) reverse transcription of miRNA to produce cDNA; and 4) qRT-PCR to detect miRNA expression. Using this protocol, we successfully determined that the expression of six miRNAs (miRNA-142-3p, miRNA-21-5p, miRNA-221-3p, miRNA-223-3p, miRNA-327, and miRNA-34a-5p) increased significantly in the peritoneal membrane of a rat peritoneal fibrosis model compared with those in control groups. This protocol can be used to study the profile of miRNA expression in the peritoneal membrane of rats in many pathological conditions.

Here we present a protocol for the detection of microRNA expression in rat peritoneal membrane using quantitative real-time reverse-transcription polymerase chain reaction. This method is suitable for studying the microRNA expression profile in rat peritoneal membrane in several pathological conditions.

MicroRNAs (miRNAs) are small noncoding RNAs that regulate messenger RNA expression post-transcriptionally. The miRNA expression profile has been ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

Separating Bacteria by Capsule Amount Using a Discontinuous Density Gradient

Capsule is a key virulence factor in many bacterial species, mediating immune evasion and resistance to various physical stresses. While many methods are available to quantify and compare capsule production between different strains or mutants, there is no widely used method for sorting bacteria based on how much capsule they produce. We have developed a method to separate bacteria by capsule amount, using a discontinuous density gradient. This method is used to compare capsule amounts semi-quantitatively between cultures, to isolate mutants with altered capsule production, and to purify capsulated bacteria from complex samples. This method can also be coupled with transposon-insertion sequencing to identify genes involved in capsule regulation. Here, the method is demonstrated in detail, including how to optimize the gradient conditions for a new bacterial species or strain, and how to construct and run the density gradient.

We demonstrate the use of discontinuous density gradients to separate bacterial populations based on capsule production. This method is used to compare capsule amount between cultures, isolate mutants with a specific capsule phenotype, or to identify capsule regulators. Described here is the optimization and running of the assay.

Capsule is a key virulence factor in many bacterial species, mediating immune evasion and resistance to various physical stresses. While many methods are ...

Comparative Lesions Analysis Through a Targeted Sequencing Approach

Assessing intra-tumoral heterogeneity (ITH) is of paramount importance to anticipate failure of targeted therapies and design accordingly effective anti-tumor strategies. Although concerns are frequently raised due to differences in sample processing and depth of coverage, next-generation sequencing of solid tumors have unraveled a highly variable degree of ITH across tumor types. Capturing the genetic relatedness between primary and metastatic lesions through the identification of clonal and subclonal populations is critical to the design of therapies for advance-stage diseases. Here, we report a method for comparative lesions analysis that allows for the identification of clonal and subclonal populations among different specimens from the same patient. The experimental approach described here integrates three well-established approaches: histological analysis, high-coverage multi-lesion sequencing, and immunophenotypic analyses. In order to minimize the effects on the detection of subclonal events by inappropriate sample processing, we subjected tissues to careful pathological examination and neoplastic cell enrichment. Quality controlled DNA from neoplastic lesions and normal tissues was then subjected to high coverage sequencing, targeting the coding regions of 409 relevant cancer genes. While only looking at a limited genomic space, our approach enables evaluating the extent of heterogeneity among somatic alterations (single-nucleotide mutations and copy-number variations) in distinct lesions from a given patient. Through comparative analysis of sequencing data, we were able to distinguish clonal vs. subclonal alterations. The majority of ITH is often ascribed to passenger mutations; therefore, we also used immunohistochemistry to predict functional consequences of mutations. While this protocol has been applied to a specific tumor type, we anticipate that the methodology described here is broadly applicable to other solid tumor types.

This article describes a method to identify clonal and subclonal alterations among different specimens from a given patient. Although the experiments described here focus on a specific tumor type, the approach is broadly applicable to other solid tumors.

Assessing intra-tumoral heterogeneity (ITH) is of paramount importance to anticipate failure of targeted therapies and design accordingly effective ...

Behavior

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Biology

Wild-Type Blocking PCR to Detect Low-Frequency Somatic Mutations

The forward and reverse primers were designed with a 5&#39;-M13 sequence to allow for annealing of complementary sequencing primers. Design the blocking oligonucleotide to be approximately 10 to 15 bases in length and complementary to the wild-type template where mutant enrichment is desired.
A shorter oligo will improve mismatch discrimination. To achieve high target specificity, it&#39;s important not to use too much of the blocking nucleotides, as this will result in a very &#34;sticky&#34; oligonucleotide.
To design the blocking oligonucleotide, begin by navigating to the Oligo Tools website. Select the &#34;Oligo TM Prediction&#34; tool. A new window will open up. Paste the sequence of the wild-type template to be blocked into the &#34;Oligo Sequence&#34; box. Add a plus sign in front of the blocker bases to mark them. Click on the &#34;Calculate&#34; button to determine the approximate TM of the DNA blocker hybrid. The calculated melting temperatures will appear in the boxes below.
Design the blocking oligo to have a melting temperature 10 to 15 degrees Celsius above the extension temperature during thermocycling. Here, the extension temperature is 72 degrees Celsius. To adjust the melting temperature, add, remove, or substitute blocking bases. Avoid long stretches of three to four blocking C or G bases.
Next, to avoid secondary structure formation or self-dimerization, go back to the Oligo Tools website home screen and select the &#34;Oligo Optimizer&#34; tool. A new window will open. Paste the sequence of the wild-type template to be blocked into the box. Add a plus sign to indicate blocking bases. Select the two boxes for &#34;Secondary Structure&#34; and &#34;Self Only&#34; and press the &#34;Analyze&#34; button to see the scores for hybridization and secondary structure.
These scores represent very rough estimates of the melting temperatures of the self-dimers and secondary structures, respectively. Lower scores are optimal and can be achieved by limiting blocker-blocker pairing. Remove or reposition blocking nucleotides in order to achieve lower scores. The optimized blocking oligonucleotide for MyD88, shown here, strikes a balance between the DNA blocker hybrid melting temperature and low enough hybridization and secondary structure scores.
It was designed to cover amino acids Q262 to I266 and features a 3&#39;-inverted dT to inhibit both extension by DNA polymerase and degradation by 3&#39;-exonuclease. Once the primers have been designed, set up the wild-type blocking PCR and perform thermocycling, as described in the accompanying document.

Wild-type Blocking PCR Combined with Sanger Sequencing for Detection of Low-frequency Somatic Mutation

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video