Name: preparation of nucleosome core particles complexed with dna repair factors for cryo-electron microscopy structural determination
Uploaded: 2022-08-17T13:30:00.000+00:00
Duration: 7 min 59 s
Description: Watch this Scientific Journal Video about Preparation of Nucleosome Core Particles Complexed with DNA Repair Factors for Cryo-Electron Microscopy Structural Determination at JoVE.com

We thank Dr. Mario Borgnia from the cryo-EM core at the National Institute of Environmental Health Sciences and Dr. Joshua Strauss from the University of North Carolina at Chapel Hill for their mentorship and training in the cryo-EM grid preparation. We also thank Dr. Juliana Mello Da Fonseca Rezende for technical assistance in the initial stages of this project. We appreciate the key contribution and support of the late Dr. Samuel H. Wilson and his lab members, especially Dr. Rajendra Prasad and Dr. Joonas Jamsen for the purification of the genetically fused APE1-Pol&#946; complex. Research has been supported by the Intramural Research Program of the National Institutes of Health, National Institute of Environmental Health Sciences [grant numbers Z01ES050158, Z01ES050159, and K99ES031662-01].

1. Assemble nucleosome core particles via salt-gardient dialysis
NOTE: The preparation of nucleosome core particles using recombinant histone proteins for structural studies has been extensively described in detail by others14,15,16. Follow the purification of recombinant X. laevis histones and histone octamer assembly described by others14,15, and assemble the nucleosomal substrate as described below.
<ol>
	<li>Purchase three oligonucleotides (listed in Table 1) at the indicated scale: UND-197mer, 161mer, 35mer.
	<ol>
		<li>PAGE purify ultramers (197mer and 161mer) as described17.
		<ol>
			<li>Anneal equimolar amounts of oligonucleotides in 1x annealing buffer (10 mM Tris-Cl, pH 8.0, 50 mM NaCl). For example, mix 40 &#181;L of 161-mer [166.7 &#181;M]; 8 &#181;L of 35-mer [292.4 &#181;M]; 16.8 &#181;L of 197-mer comp strand [408.2 &#181;M]; 10 &#181;L of 10x anneal buffer and 10.9 &#181;L of dH2O. 
			NOTE: It is critical to control the annealing reaction with a temperature gradient. See Table 2 for the details on the temperature gradient.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Perform small-scale reconstitutions (scale by a factor of 1/57 of the example shown below for a final volume of 50 &#181;L) to determine the ratio of DNA to histone octamer (typical starting ratios of DNA:octamer are as follows: 1:0.9, 1:1.1, 1:1.2, 1:2; shown in Figure 2A); it is critical to determine this ratio empirically with small-scale reconstitutions.
	<ol>
		<li>After this ratio is determined, prepare a large-scale reconstitution. For example, mix 32.9 &#181;L of DNA-197 bp [99.4 &#181;M]; 1647.1 &#181;L of TE (1x); 1120 &#181;L of 5 M NaCl, and 62.3 &#181;L of WT histone octamer [2.56 &#181;M].</li>
	</ol>
	</li>
	<li>Make dialysis buffers: RBlow and RBhigh as described in Table 3 and Table 4, respectively; set up the reconstitutions as previously described14.
	<ol>
		<li>Transfer the dialysis tube into the beaker containing RBhigh, and allow for dialysis to proceed, with gentle stirring, for 16 h or until 2 L RBlow has been transferred into the waste beaker.</li>
	</ol>
	</li>
	<li>Transfer the dialysis tube into a 1 L beaker containing RB50mM buffer (Table 5) and allow the sample to dialyze for at least 3 h or overnight.
	<ol>
		<li>Evaluate reconstitution efficiency on a 6% polyacrylamide nondenaturing gel, ensuring there is less than 10% free DNA and a single NCP band; store NCPs at 4 &#176;C. See Figure 2A (lane 5) and Figure 2B for representative optimal reconstitution results.</li>
	</ol>
	</li>
</ol>
2. Prepare NCP-DNA repair factor complex (NCP-DRF)
<ol>
	<li>Purification by preparative-gel electrophoresis 
	NOTE: This method is the most labor-intensive (of the two described), and while it is effective at removing high molecular weight (HMW) species (Figure 6A) because of the high dilution factor, it can lead to some disassembly as shown in Figure 7A (NCP prep cell out lane), releasing DNA. However, up to 25% free DNA is still compatible with cryo-EM studies. Because of the high dilution, use this method to purify the NCP only, rather than the whole complex.
	<ol>
		<li>Prepare 70 mL of 6% nondenaturing polyacrylamide gel solution in 0.2x TBE, using polyacrylamide gel solution 37.5:1, acrylamide:bisacrylamide. Pour a cylindrical gel with outer radius of 28 mm and polymerize overnight.</li>
		<li>Assemble the preparative gel running apparatus, using a dialysis membrane with a 6-8 kDa MW cutoff. Use 0.25x TBE as the running buffer and 1x elution buffer (50 mM KCl, 10 mM HEPES, pH 7.5). Pre-run the cylindrical gel at a constant 12 W for 1 h, and collect fractions running the peristaltic pump at a flow rate of approximately 1 mL/min. 
		NOTE: If a UV detector is not available to identify fractions containing DNA, a screening experiment with 32P-NCP can be performed to identify the fractions of interest. Keeping all conditions the same, unlabeled NCPs can then be purified without a UV detector.</li>
		<li>Concentrate the 2.8 mL of NCP to 250 &#181;L using a centrifugal filter (MW cutoff 30 kDa), and load onto the preparative gel and electrophorese for a total of 6 h. At 2 h, when the xylene cyanol has ran out of the gel, start collecting 1.5 mL fractions. 
		NOTE: At 2.5 h, fractions will be clear of xylene cyanol; the DNA (197mer) elutes at approximately 3-3.5 h, and the NCP is expected to elute at 4.5-5 h mark.</li>
		<li>Analyze fractions of interest on a 6% nondenaturing polyacrylamide gel. Pool fractions containing the NCP, and immediately concentrate with a centrifugal filter (MW cutoff 30 kDa) to 1 mg/mL. The next day, evaluate the quality of the NCP on a 6% polyacrylamide nondenaturing gel before complexing with the DNA repair factor (DRF) of interest.</li>
		<li>Incubate the NCP and the DRF of interest on ice for 15 min using an optimal buffer for the specific complex. For example, mix 1,000 &#181;L of NCP [1.2 &#181;M]; 260 &#181;L of 5x binding buffer (250 mM HEPES, pH 8, 500 mM KCl, 25 mM MgCl2), 22 &#181;L of 3 M KCl, and 18 &#181;L of MBP- Pol &#946;-APE1 [338 &#181;M]. 
		NOTE: The temperature and ionic strength at which the complex is made may need optimization&#160;for different complexes.</li>
		<li>Add glutaraldehyde (freshly opened; EM grade) to a final concentration of 0.005%. Therefore, to this reaction, add 26.8 &#181;L&#160;of 0.25% glutaraldehyde with 13.2 &#181;L of dH2O. Mix well, and incubate at room temperature for 13 min.</li>
		<li>Quench with 1 M Tris-Cl, pH 7.5, to a final concentration of 20 mM Tris-Cl, pH 7.5. Concentrate to ~50 &#181;L and exchange the buffer with 1x freezing buffer: 50 mM KCl, 10 mM HEPES, pH 7.5 using a desalting column. 
		CAUTION: Glutaraldehyde can cause severe skin burns and eye damage; it is harmful if swallowed, and it is toxic if inhaled. Wear a lab coat, goggles, gloves, and handle glutaraldehyde in a fume hood and&#160;wear a mask. 
		NOTE: It is critical to perform the crosslinking reaction in a large volume with the NCP at this lower concentration. Previous attempts of crosslinking, even at this concentration of glutaraldehyde, but at a 10x higher concentrated NCP led to aggregation of the sample and over-crosslinking as indicated by SDS PAGE and size exclusion chromatography. These grids had no discernable particles with just clumps (Figure 5D,E).</li>
		<li>Determine the absorbances at OD280 and OD260 and concentrate further if needed to reach 1.3-3 mg/mL, based on OD280 (typical ratio of OD260/ OD280= 1.7-2 yields good particles). For this small volume of 50 &#181;L, the best method to reduce sample loss is to make a dialysis button with a lid of a 1.7 mL tube covered by a dialysis membrane (6-8 kDa MW cutoff), cutting the bottom of the tube and using the rim of the tube to seal the membrane on top of the lid.</li>
		<li>Place the dialysis button containing the sample on top of a polyethylene glycol bed, with the membrane facing down (check progress every 2 min). This method is preferred where the concentration needed is less than or equal to 2.5-fold to avoid diluting or losing the sample in the concentrator. It is critical to immediately prepare cryo-EM grids of the complex after this step.</li>
	</ol>
	</li>
	<li>Purification by size exclusion chromatography
	<ol>
		<li>The day before freezing, wash and equilibrate a size exclusion column with 60 mL of dH2O, followed by 80 mL of freezing buffer (50 mM KCl, 10 mM HEPES, pH 8) overnight at a rate of 0.4 mL/min. Using NCPs straight after reconstitution, prepare the same complex using 2.5x greater amounts as follows: mix 2,500 &#181;L of NCP [1.2 &#181;M]; 650 &#181;L of 5x binding buffer; 45 &#181;L of MBP-Pol &#946;-APE1 [338 &#181;M] and 55 &#181;L of 3M KCl.</li>
		<li>Incubate the mixture on ice without crosslinker for 15 min. Then, add glutaraldehyde to a final concentration of 0.005% as described in the preparative gel method. In this case, however, concentrate the complex in a pre-equilibrated (with freezing buffer) centrifugal filter to approximately 120 &#181;L.</li>
		<li>Immediately analyze the peak fractions and concentrate those fractions containing the histones and MBP-Pol &#946;-APE1 as indicated previously. See Figure 5A,B,C for successful results using the size exclusion method&#160;and Figure 7&#160;using both methods.</li>
	</ol>
	</li>
</ol>
3. Freeze nucleosomal complex
<ol>
	<li>After turning on the plunge freezer and filling the humidifier with 50 mL of dH2O, set the chamber temperature to 22 &#176;C and HR (humidity) to 98%. Place the ethane cup and liquid nitrogen cup (containing a labeled grid box) in their respective space holders.</li>
	<li>Cover the ethane cup with the ethane lid dispenser, and carefully pour liquid nitrogen (LN2) over it, while also filling the LN2 cup with LN2. When the LN2 level has stabilized and reaches 100%&#160;and a temperature of -180 &#176;C, carefully open the ethane valve and fill the ethane cup until it forms a bubble on the clear lid. Remove the ethane dispenser.</li>
	<li>Place two filter papers onto the blotting device and secure them with a metal ring. Go to the set up and use the following parameters for blotting: 0 pre-blot, 3 s blot, 0 post-blot; select A-plunge and click on OK.</li>
	<li>On the main screen, click on Load Forceps, and load them with a grid with the carbon/application side facing toward the left (prepared as before). Calibrate the forceps adjusting the Z-axis to ensure a solid blot. Click on Lower Chamber and apply 3 &#181;L of the complex (1.3-3 mg/mL; OD280). Click on Blot/A-plunge. This will rotate the grid to blot from the front and will plunge freeze it.</li>
	<li>Transfer and store the grid in the grid box in the LN2 chamber. When all four grids have been frozen and placed in the grid box, rotate the lid to neutral position, where all the grids are covered by the lid, and tighten the screw. Grids can be stored in LN2 until screening is initiated.</li>
</ol>
4. Screen grids
<ol>
	<li>Before loading the samples in the microscope, place the vitrified grids on a ring and secure them using a C-clip. Perform this clipping process under LN2 in a humidity-controlled room, to avoid ice contamination.</li>
	<li>When loading the microscope, insert the grids in a 12-slot cassette. Shuttle the cassette into a nanocab capsule and load it into the autoloader. The autoloader robotic mechanism initiates the process.</li>
	<li>Transfer the grid from the cassette to the microscope stage. Adjust the stage to eucentric height by wobbling the stage 10&#176; and simultaneously moving the Z-height until minimal planar shift is observed in the images.</li>
	<li>Once the eucentric height is reached, start imaging. First, obtain the atlas by taking a 3 x 3 montage image of the grid, in which each montage is taken at 62x magnification. Pick three squares of varying sizes; take the eucentric height, and then image at 210x magnification.</li>
	<li>Once a square is imaged, pick one hole each from the edge, center, and in between within the squares. Image each hole at 2600x magnification.</li>
	<li>Before taking this high magnification image, the autofocusing occurs at an offset of the imaging area. Take the high magnification image from the center of the hole at 36,000x magnification and at 7.1 s exposure time, 60 frames, 1.18-pixel size, and 3 &#181;m defocus. See representative images of screening in Figure 5, Figure 6, and&#160;Figure 7.</li>
</ol>

<ol>
	<li>Ehrenhofer-Murray, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+dynamics+at+DNA+replication,+transcription+and+repair.">Chromatin dynamics at DNA replication, transcription and repair.</a> European Journal of Biochemistry. 271 (12), 2335-2349 (2004).</li><li>Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389 (6648), 251-260 (1997).</li><li>Davey, C. A., Sargent, D. F., Luger, K., Maeder, A. W., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solvent+mediated+interactions+in+the+structure+of+the+nucleosome+core+particle+at+1.9+a+resolution.">Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution.</a> Journal of Molecular Biology. 319 (5), 1097-1113 (2002).</li><li>Suto, R. K., Clarkson, M. J., Tremethick, D. J., Luger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+a+nucleosome+core+particle+containing+the+variant+histone+H2A.Z.">Crystal structure of a nucleosome core particle containing the variant histone H2A.Z.</a> Nature Structural Biology. 7 (12), 1121-1124 (2000).</li><li>Tachiwana, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+human+centromeric+nucleosome+containing+CENP-A.">Crystal structure of the human centromeric nucleosome containing CENP-A.</a> Nature. 476 (7359), 232-235 (2011).</li><li>McGinty, R. K., Tan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleosome+structure+and+function.">Nucleosome structure and function.</a> Chemical Reviews. 115 (6), 2255-2273 (2015).</li><li>Rodriguez, Y., Hinz, J. M., Laughery, M. F., Wyrick, J. J., Smerdon, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+acetylation+of+histone+H3+decreases+polymerase+beta+activity+on+nucleosome+core+particles+in+vitro.">Site-specific acetylation of histone H3 decreases polymerase beta activity on nucleosome core particles in vitro.</a> The Journal of Biological Chemistry. 291 (21), 11434-11445 (2016).</li><li>Rodriguez, Y., Hinz, J. M., Smerdon, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+DNA+damage+in+chromatin:+Preparing+the+chromatin+landscape+for+base+excision+repair.">Accessing DNA damage in chromatin: Preparing the chromatin landscape for base excision repair.</a> DNA Repair (Amst). 32, 113-119 (2015).</li><li>Rodriguez, Y., Horton, J. K., Wilson, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3+lysine+56+acetylation+enhances+AP+endonuclease+1-mediated+repair+of+AP+sites+in+nucleosome+core+particles.">Histone H3 lysine 56 acetylation enhances AP endonuclease 1-mediated repair of AP sites in nucleosome core particles.</a> Biochemistry. 58 (35), 3646-3655 (2019).</li><li>Rodriguez, Y., Howard, M. J., Cuneo, M. J., Prasad, R., Wilson, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unencumbered+Pol+beta+lyase+activity+in+nucleosome+core+particles.">Unencumbered Pol beta lyase activity in nucleosome core particles.</a> Nucleic Acids Research. 45 (15), 8901-8915 (2017).</li><li>Rodriguez, Y., Smerdon, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+structural+location+of+DNA+lesions+in+nucleosome+core+particles+determines+accessibility+by+base+excision+repair+enzymes.">The structural location of DNA lesions in nucleosome core particles determines accessibility by base excision repair enzymes.</a> The Journal of Biological Chemistry. 288 (19), 13863-13875 (2013).</li><li>Olmon, E. D., Delaney, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+ability+of+five+DNA+glycosylases+to+recognize+and+repair+damage+on+nucleosomal+DNA.">Differential ability of five DNA glycosylases to recognize and repair damage on nucleosomal DNA.</a> ACS Chemical Biology. 12 (3), 692-701 (2017).</li><li>Odell, I. D., Wallace, S. S., Pederson, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rules+of+engagement+for+base+excision+repair+in+chromatin.">Rules of engagement for base excision repair in chromatin.</a> Journal of Cellular Physiology. 228 (2), 258-266 (2013).</li><li>Dyer, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reconstitution+of+nucleosome+core+particles+from+recombinant+histones+and+DNA.">Reconstitution of nucleosome core particles from recombinant histones and DNA.</a> Methods in Enzymology. 375, 23-44 (2004).</li><li>Luger, K., Rechsteiner, T. J., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+nucleosome+core+particle+from+recombinant+histones.">Preparation of nucleosome core particle from recombinant histones.</a> Methods in Enzymology. 304, 3-19 (1999).</li><li>McGinty, R. K., Makde, R. D., Tan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation,+crystallization,+and+structure+determination+of+chromatin+enzyme/nucleosome+complexes.">Preparation, crystallization, and structure determination of chromatin enzyme/nucleosome complexes.</a> Methods in Enzymology. 573, 43-65 (2016).</li><li>Lopez-Gomollon, S., Nicolas, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+DNA+oligos+by+denaturing+polyacrylamide+gel+electrophoresis+(PAGE).">Purification of DNA oligos by denaturing polyacrylamide gel electrophoresis (PAGE).</a> Methods in Enzymology. 529, 65-83 (2013).</li><li>Burgess, R. R. D., Murray, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide to Protein Purification. 463, (2009).</li><li>Coscia, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+to+a+homo-oligomeric+scaffold+allows+cryo-EM+analysis+of+a+small+protein.">Fusion to a homo-oligomeric scaffold allows cryo-EM analysis of a small protein.</a> Scientific Reports. 6, 30909 (2016).</li><li>Wu, X., Rapoport, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structure+determination+of+small+proteins+by+nanobody-binding+scaffolds+(Legobodies).">Cryo-EM structure determination of small proteins by nanobody-binding scaffolds (Legobodies).</a> Proceedings of the Nationall Academy of Sciences of the United States of America. 118 (41), 2115001118 (2021).</li><li>Herzik, M. A., Wu, M., Lander, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+structure+determination+of+sub-100+kDa+complexes+using+conventional+cryo-EM.">High-resolution structure determination of sub-100 kDa complexes using conventional cryo-EM.</a> Nature Communications. 10 (1), 1032 (2019).</li><li>Takizawa, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structure+of+the+nucleosome+containing+the+ALB1+enhancer+DNA+sequence.">Cryo-EM structure of the nucleosome containing the ALB1 enhancer DNA sequence.</a> Open Biology. 8 (3), 170255 (2018).</li><li>Anderson, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+recognition+of+ubiquitylated+nucleosome+by+Dot1L+methyltransferase.">Structural basis for recognition of ubiquitylated nucleosome by Dot1L methyltransferase.</a> Cell Reports. 26 (7), 1681-1690 (2019).</li></ol>

The authors declare no competing interests.

A specific protocol for purifying the DNA repair factor will be dependent on the enzyme of interest. However, there are some general recommendations, including the use of recombinant methods for protein expression and purification18; if the protein of interest is too small (&#60;50 kDa), structure determination by cryo-EM had been nearly impossible until more recently through the use of fusion systems19, nanobody-binding scaffolds20, and optimizing imaging strategies21.
It is quite common to obtain poor quality grids in the initial stages. Initial attempts to determine NCP homogeneity and stability without any crosslinker, using uranyl acetate and carbon-coated copper grids for negative staining, showed stable, nicely dispersed NCPs with minimal aggregation. However, once this sample was vitrified (at 20x higher concentration) in cryo-EM grids, no particles were detected. Sample optimization to keep the NCPs from falling apart or aggregating was the biggest hurdle. Additionally, two methods of preparation are described separately; however, they are not mutually exclusive and can be used back-to-back by first purifying the NCP via a preparative gel, complexing it with the repair factor, and purifying the complex with a size exclusion column. This requires twice as much material for the initial step, and it is also more time-consuming, but helpful for difficult samples (Figure 6).
Finding a starting point for the concentration of crosslinker was difficult due to the lack of consistency in methods of crosslinking and the amounts of crosslinker used by others22,23. Attempts to replicate the less-controlled crosslinking reaction on the bench top described by Anderson et al. failed to give positive results, and the complex was overly crosslinked. This is likely due to the source of glutaraldehyde (freshly opened ampule compared to long-term stored glutaraldehyde). Because this level of detail is often omitted in non-methods, research articles, it is difficult to replicate the exact conditions as a starting point. Optimal results were obtained when the complex was crosslinked at a concentration of 1.2 &#181;M in 150 mM KCl ionic strength compared to crosslinking the complex at 10 &#181;M NCP, at the same glutaraldehyde concentration of 0.005% for 13 min at room temperature. The crosslinking efficiency is also likely dependent on the complex that is being formed as some chromatin-interacting factors may induce/require greater destabilization influencing where the crosslinking will occur and the overall effect on NCP stability. Therefore, while optimization of these conditions is inevitable, finding critical steps such as optimal NCP and salt concentration during the crosslinking reactions will be critical.
Another important parameter was the ratio of NCP:DRF that yielded enough molecules on the grid containing the DRF bound to the NCP. Indeed, this parameter has also been identified by others as one that is critical to optimize for structural studies16 given that even for cryo-EM homogeneity of the way the DRF binds to the NCP is important for the 3D map. Not optimizing this may yield unbound or heterogenous, non-specific binding. When a 1:1 molar ratio was used, yielding only 50% the NCP bound by the DRF (Figure 6), the 3D map did not show any additional density corresponding to the DRF. Therefore, it is important to determine the ratio that yields a single band at the same location on an EMSA and shows a single peak on the chromatogram of a sizing column, corresponding to the complex. Several parameters for freezing of the grids, including the blot time, added several rounds of optimization.
Taken together, this protocol provides detailed instructions for the first time on two different methods to prepare nucleosomal complexes for cryo-EM structural determination. The baseline parameters for the grid preparation provided can be used as a starting point. And while not a single method works equally well for all macromolecular complexes, focusing on optimizing the parameters described in this protocol will narrow down the strategy for tailored optimization of other nucleosomal complexes.

Eukaryotic DNA is organized and compacted by histone proteins, forming chromatin. The nucleosome core particle (NCP) constitutes the fundamental repeating unit of chromatin that regulates accessibility to DNA-binding proteins for DNA repair, transcription, and replication1. Although the first X-ray crystal structure of the NCP was first solved more than two decades ago2 and many more structures of the NCP have been published since3,4,5,6, DNA repair mechanisms in nucleosomal substrates have not yet been delineated. Uncovering the molecular details underlying DNA repair in chromatin will require structural characterization of the participating components to understand how local structural features of the NCP regulate DNA repair activities. This is particularly important in the context of base excision repair (BER) given that biochemical studies with BER enzymes suggest unique DNA repair mechanisms in nucleosomes that are dependent on enzyme-specific structural requirements for catalysis and the structural position of the DNA lesion within the nucleosome7,8,9,10,11,12,13. Given that BER is a vital DNA repair process, there is considerable interest to fill in these gaps while also establishing a starting point from which other technically feasible structural studies involving relevant nucleosomal complexes can be carried out.
Cryo-EM is rapidly becoming the method of choice for solving the three-dimensional (3D) structure of complexes whose large-scale preparation of homogeneous sample is challenging. Although, the design and purification of NCPs complexed with a DNA repair factor (NCP-DRF) will likely necessitate tailored optimization, the procedure presented here to generate and freeze a stable NCP-DRF complex provides details on how to optimize the sample and cryo-EM grid preparation. Two workflows (not mutually exclusive) shown in Figure 1, and the specific details in the protocol identify critical steps and provide strategies for optimizing these steps. This work will propel the chromatin and DNA repair field in a direction where complementing biochemical with structural studies becomes technically feasible to better understand the molecular mechanisms of nucleosomal DNA repair.

<table><tbody><tr><td>1 M HEPES; pH 7.5</td><td>Thermo Fisher Scientific</td><td>15630080</td><td></td></tr><tr><td>1 M MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Thermo Fisher Scientific</td><td>AM9530G</td><td></td></tr><tr><td>10x TBE</td><td>Bio-rad</td><td>1610733</td><td></td></tr><tr><td>25% glutaraldehyde</td><td>Fisher Scientific</td><td>50-262-23</td><td></td></tr><tr><td>3 M KCl</td><td>Thermo Fisher Scientific</td><td>043398.K2</td><td></td></tr><tr><td>491 prep cell</td><td>Bio-rad</td><td>1702926</td><td></td></tr><tr><td>Amicon Ultra 15 centrifugal filter (MW cutoff 30 kDa)</td><td>Millipore Sigma</td><td>Z717185</td><td></td></tr><tr><td>Amicon Ultra 4 centrifugal filter (MW cutoff 30 kDa)</td><td>Millipore Sigma</td><td>UFC8030</td><td></td></tr><tr><td>AutoGrid Tweezers</td><td>Ted Pella</td><td>47000-600</td><td></td></tr><tr><td>Automatic Plunge Freezer</td><td>Leica</td><td>Leica EM GP</td><td></td></tr><tr><td>C-1000 touch thermocycler</td><td>Bio-rad</td><td>1851148</td><td></td></tr><tr><td>C-clips and rings</td><td>Thermo Fisher</td><td>6640--6640</td><td></td></tr><tr><td>Clipping station</td><td>SubAngostrom</td><td>SCT08</td><td></td></tr><tr><td>Dialysis Membrane (MW cufoff 6-8 kDa)</td><td>Fisher Scientific</td><td>15370752</td><td></td></tr><tr><td>Diamond Tweezers</td><td>Techni-Pro</td><td>758TW0010</td><td></td></tr><tr><td>dsDNA</td><td>Integrated DNA techonologies</td><td>N/A</td><td></td></tr><tr><td>FEI Titan Krios</td><td>Thermo Fisher</td><td>KRIOSG4TEM</td><td></td></tr><tr><td>FPLC purification system</td><td>AKTA Pure</td><td>29018224</td><td></td></tr><tr><td>Fraction collector Model 2110</td><td>Bio-rad</td><td>7318122</td><td></td></tr><tr><td>Glow Discharge Cleaning System</td><td>Ted Pella</td><td>91000S</td><td></td></tr><tr><td>Grid Boxes</td><td>SubAngostrom</td><td>PB-E</td><td></td></tr><tr><td>Grid Storage Accessory Pack</td><td>SubAngostrom</td><td>GSAX</td><td></td></tr><tr><td>Liquid Ethane</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Liquid Nitrogen</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Minipuls 3 peristaltic two-head pump</td><td>Gilson</td><td>F155008</td><td></td></tr><tr><td>Nanodrop</td><td>Thermo Fisher Scientific</td><td>ND-2000</td><td></td></tr><tr><td>Novex 16%, Tricine, 1.0 mm, Mini Protein Gels</td><td>Thermo Fisher Scientific</td><td>EC6695BOX</td><td></td></tr><tr><td>Pipetman</td><td>Gilson</td><td>FA10002M</td><td></td></tr><tr><td>Pipette tips (VWR) Low Retention</td><td>VWR</td><td>76322-528</td><td></td></tr><tr><td>Polyacrylamide gel solution (37.5:1)</td><td>Bio-rad</td><td>1610158</td><td></td></tr><tr><td>polyethylene glycol (PEG)</td><td>Millipore Sigma</td><td>P4338-500G</td><td></td></tr><tr><td>Pur-A-lyzer Maxi 3500</td><td>Millipore Sigma</td><td>PURX35050</td><td></td></tr><tr><td>Purified recombinant DNA repair factor</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>R 1.2/1.3 Cu 300 mesh Grids</td><td>Quantifoil</td><td>N1-C14nCu30-01</td><td></td></tr><tr><td>Recombinant histone octamer</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Spring clipping tools</td><td>SubAngostrom</td><td>CSA-01</td><td></td></tr><tr><td>Superdex 200 column 10/300</td><td>Millipore Sigma</td><td>GE28-9909-44</td><td></td></tr><tr><td>Transmission Electron Microscope</td><td>Thermo Fisher</td><td>Talos Arctica 200 kV</td><td></td></tr><tr><td>Tweezers Assembly for FEI Vitrobot Mark IV-I</td><td>Ted Pella</td><td>47000-500</td><td></td></tr><tr><td>UltraPure Glycerol</td><td>Thermo Fisher Scientific</td><td>15514011</td><td></td></tr><tr><td>Vitrobot</td><td>Thermo Fisher</td><td>Mark IV System</td><td></td></tr><tr><td>Whatman Filter paper (55 mM)</td><td>Cytiva</td><td>1005-055</td><td></td></tr><tr><td>Xylene cyanol</td><td>Thermo Fisher Scientific</td><td>440700500</td><td></td></tr><tr><td>Zeba Micro Spin Desalting Columns, 7K MWCO, 75 &amp;micro;L</td><td>Thermo Fisher Scientific</td><td>89877</td><td></td></tr></tbody></table>

preparation of nucleosome core particles complexed with dna repair factors for cryo-electron microscopy structural determination

DNA repair in the context of chromatin is poorly understood. Biochemical studies using nucleosome core particles, the fundamental repeating unit of chromatin, show most DNA repair enzymes remove DNA damage at reduced rates as compared to free DNA. The molecular details on how base excision repair (BER) enzymes recognize and remove DNA damage in nucleosomes have not been elucidated. However, biochemical BER data of nucleosomal substrates suggest the nucleosome presents different structural barriers dependent on the location of the DNA lesion and the enzyme. This indicates the mechanisms employed by these enzymes to remove DNA damage in free DNA may be different than those employed in nucleosomes. Given that the majority of genomic DNA is assembled into nucleosomes, structural information of these complexes is needed. To date, the scientific community lacks detailed protocols to perform technically feasible structural studies of these complexes. Here, we provide two methods to prepare a complex of two genetically fused BER enzymes (Polymerase &#946; and AP Endonuclease1) bound to a single-nucleotide gap near the entry-exit of the nucleosome for cryo-electron microscopy (cryo-EM) structural determination. Both methods of sample preparation are compatible for vitrifying quality grids via plunge freezing. This protocol can be used as a starting point to prepare other nucleosomal complexes with different BER factors, pioneer transcription factors, and chromatin-modifying enzymes.

Properly assembled NCPs (Figure 2) were used to make a complex with a recombinant fusion protein of MBP-Pol&#946;-APE1 (Figure 3). To determine the ratio of NCP to MBP-Pol&#946;-APE1 to form a stable complex, we performed electrophoretic mobility shift assays (EMSA) (Figure 4), which showed a singly shifted band of the NCP with 5-fold molar excess of MBP-Pol&#946;-APE1. During the optimization of making this complex, crosslinking with glutaraldehyde was critical to prevent the NCP from falling apart. Initially, assembly of the complex of NCP-Pol&#946;-APE1 was performed in a smaller volume, at approximately 10 &#181;M NCP, using 0.005% final glutaraldehyde concentration. Under these conditions, the sample was overly crosslinked (Figure 5D-E) and resulted in aggregates without discernable individual complexes. Crosslinking at approximately 10-fold diluted NCPs (1.2 &#181;M NCP) resulted in significantly reduced aggregation and improved particle stability (Figure 5A-C). Figure 6 illustrates that both methods shown in Figure 1 can be combined with the preparative gel improving the quality of the NCPs when the NCP contains a significant amount of high molecular weight (HMW) aggregates (Figure 6A), followed by the purification of the complex via size exclusion. Although this showed great success in the preparation of the sample (Figure 5B-C) and grids, yielding stable particles (Figure 6D), the suboptimal formation of the complex (Figure 6A) yielded a 3D map of the NCP alone (data not shown). These results show that both methods (size exclusion and preparative gel) can be used independently to generate stable complexes (Figure 7A-C). Indeed, data have been collected from both grids and show almost identical 2D classes (Figure 7D) and 3D maps (Figure 7E) at approximately 3.2 &#197; resolution.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64061/64061fig01.jpg" /> 
Figure 1: Workflow of the two methods presented in this protocol to prepare and freeze an NCP-Pol&#946;-APE1 complex via 1) preparative gel and 2) size exclusion. Although not shown here, these methods can be combined (Figure 6), starting with (1) and purifying the concentrated complex from (1) using a sizing column. This will require doubling the starting material of NCPs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64061/64061fig02.jpg" /> 
Figure 2: Representative NCP reconstitutions. (A) DNA was titrated with increasing amounts of histone octamer at ratios of 1:0.9, 1:1.1, 1:1.2, 1:2, DNA:octamer. (B) Duplicate large-scale assembled NCPs (1:2, DNA:octamer). Reconstitutions were electrophoresed in a 6% nondenaturing polyacrylamide gel, followed with sybr green I staining. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64061/64061fig03.jpg" /> 
Figure 3: Schematic of genetically fused Pol&#946;-APE1 with MBP at its N-terminal. MBP-Pol&#946;-APE1 fusion protein was enzymatically characterized for both activities (data not shown). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/64061/64061fig04.jpg" /> 
Figure 4: MBP-Pol&#946;-APE1 binding to NCPs. Nucleosomal substrate (100 nM) was incubated with increasing amounts of MBP-Pol&#946;-APE1 for 15 min on ice. Bound and unbound NCP were separated in a 6% polyacrylamide nondenaturing gel, followed by sybr green I staining. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/64061/64061fig05.jpg" /> 
Figure 5: Analysis of successful and unsuccessful crosslinking results. The elution profile of the complex is shown in (A) with the peak of interest labeled. Fractions, denoted by &#34;F&#34;, collected from this elution were analyzed in a 16% tricine polyacrylamide gel and shown in (B). (C) Sample from (B) was frozen using holey carbon support grids and imaged using the 200 kV field emission cryo-transmission electron microscope. Corresponding unsuccessful experiments are shown in (D), (E), and (F). Note these unsuccessful experiments contain the fusion protein without MBP. HOc and HOD denote histone octamer concentrated and diluted, respectively; RT denotes room temperature; &#34;X&#34; corresponds to crosslinking with glutaraldehyde. Scale bars = 100 nm (C, F). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/64061/64061fig06.jpg" /> 
Figure 6: Preparation of NCP-Pol&#946;-APE1 complex using the two methods in tandem. (A) Unbound and bound (1:1, NCP- Pol&#946;-APE1) were analyzed in 6% polyacrylamide nondenaturing gel (note that at this ratio only 50% is bound). (B) Elution profile of NCP-Pol&#946;-APE1 complex from a sizing column. (C) Analysis of eluted fractions in a 16% tricine polyacrylamide gel; fractions were pooled and concentrated, as indicated. (D) Sample was frozen and imaged as described in Figure 5B. Data processing did not show an additional density corresponding to Pol&#946;-APE1 (not shown). &#34;X&#34; in lanes 5 and 6 denotes crosslinking with glutaraldehyde as indicated in the protocol. Scale bar = 100 nm (D). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/64061/64061fig07.jpg" /> 
Figure 7: Analysis of NCP-MBP-Pol&#946;-APE1 complex. (A) Samples from the different steps in the methods illustrated in Figure 1 were electrophoresed in a 6% polyacrylamide nondenaturing gel. Notice that complex formation is reproducible by the two methods. (B,C) Representative grid holey carbon support grid images taken using a 300 kV transmission electron microscope where the red boxes highlight different orientations of the complex (some of which correspond to the 2D classes shown in (D). (E) Data processed from (C) show a 3D map at 3.2 &#197; resolution of the NCP-MBP-Pol&#946;-APE1 complex.). Scale bars = 100 nm (B, C). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64061/64061fig07large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Oligonucleotide name</td>
			<td colspan="3">Sequence (5&#39;--&#62;3&#39;)</td>
			<td>Purification scale</td>
			<td>Method of purificaiton</td>
			<td>Number of vials ordered</td>
		</tr>
		<tr>
			<td>UND complementary strand</td>
			<td colspan="3">TGATGGACCCTATACGCGGCCGCCCTGGAGAAT 
			CCCGGTGCCGAGGCCGCTCAATTGGTCGTAGA 
			CAGCTCTAGCACCGCTTAAACGCACGTACGCGC 
			TGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC 
			TCCCTAGTCTCCAGGCACGTGTCAGATATCAAC 
			ATCCTGTGCATGTATTGAACAGCGACCTTGCCG</td>
			<td>&#160;20 nmole</td>
			<td>PAGE purified</td>
			<td>6</td>
		</tr>
		<tr>
			<td>161mer</td>
			<td colspan="3">/5Phos/GATATCTGACACGTGCCTGGAGACTAGG 
			GAGTAATCCCCTTGGCGGTTAAAACGCGGGGG 
			ACAGCGCGTACGTGCGTTTAAGCGGTGCTAGA 
			GCTGTCTACGACCAATTGAGCGGCCTCGGCA 
			CCGGGATTCTCCAGGGCGGCCGCGTATAGGG 
			TCCATCA</td>
			<td>20 nmole</td>
			<td>PAGE purified</td>
			<td>4</td>
		</tr>
		<tr>
			<td>35mer</td>
			<td colspan="3">CGGCAAGGTCGCTGTTCAATACATGCACAGG 
			ATGT</td>
			<td>250 nmole</td>
			<td>HPLC</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 1: DNA substrate. Three oligonucleotides were annealed to generate the dsDNA substrate. The underlined sections are 25 bp of linker DNA flanking the 147 bp 601 DNA positioning sequence containing a single nucleotide gap.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature (&#176;C)</td>
			<td>Time (min)/step</td>
		</tr>
		<tr>
			<td>1</td>
			<td>95</td>
			<td>10</td>
		</tr>
		<tr>
			<td>2-5</td>
			<td>90, 85, 80, 75</td>
			<td>5</td>
		</tr>
		<tr>
			<td>6-41</td>
			<td>69 decrease by 1</td>
			<td>3</td>
		</tr>
		<tr>
			<td>42</td>
			<td>4</td>
			<td>hold</td>
		</tr>
	</tbody>
</table>
Table 2: Annealing temperature gradient. Oligos were incubated in a thermocycler at these temperatures to generate the dsDNA substrate.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components (stock)</td>
			<td>Volume/amount</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>3M KCl</td>
			<td>167 mL</td>
			<td>0.250 M</td>
		</tr>
		<tr>
			<td>1 M HEPES, pH 8.0</td>
			<td>20 mL</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td>0.5 M EDTA</td>
			<td>4 mL</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>1 M DTT</td>
			<td>2 mL</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>CHAPS</td>
			<td>2 g</td>
			<td>1.6 mM</td>
		</tr>
		<tr>
			<td colspan="3">QS with dH2O to make 2L</td>
		</tr>
	</tbody>
</table>
Table 3: RBlow reconstitution buffer. Instructions to make 2 L as previously reported14, except 1.6 mM CHAPS was added.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components (stock)</td>
			<td>Volume/amount</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>3M KCl</td>
			<td>267 mL</td>
			<td>2 M</td>
		</tr>
		<tr>
			<td>1 M HEPES, pH 8.0</td>
			<td>4 mL</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td>0.5 M EDTA</td>
			<td>800 &#956;L</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>1 M DTT</td>
			<td>400 &#956;L</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>CHAPS</td>
			<td>0.4 g</td>
			<td>1.6 mM</td>
		</tr>
		<tr>
			<td colspan="3">QS with dH2O to make 400 mL</td>
		</tr>
	</tbody>
</table>
Table 4: RBhigh reconstitution buffer. Instructions to make 400 mL as previously reported14, except 1.6 mM CHAPS was added.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components (stock)</td>
			<td>Volume</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>3M KCl</td>
			<td>16.7 mL</td>
			<td>50 mM</td>
		</tr>
		<tr>
			<td>1 M HEPES, pH 8.0</td>
			<td>10 mL</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td>0.5 M EDTA</td>
			<td>2 mL</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>1 M DTT</td>
			<td>1 mL</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td colspan="3">QS with dH2O to make 1L</td>
		</tr>
	</tbody>
</table>
Table 5:&#160;RB50mM reconstitution buffer. Instructions to make 1 L of reconstitution buffer compatible for freezing.

Watch this Scientific Journal Video about Preparation of Nucleosome Core Particles Complexed with DNA Repair Factors for Cryo-Electron Microscopy Structural Determination at JoVE.com

Preparation of Nucleosome Core Particles Complexed with DNA Repair Factors for Cryo-Electron Microscopy Structural Determination

This protocol outlines in detail the preparation of nucleosomal complexes using two methods of sample preparation for freezing TEM grids.

DNA repair in the context of chromatin is poorly understood. Biochemical studies using nucleosome core particles, the fundamental repeating unit of ...

preparation-nucleosome-core-particles-complexed-with-dna-repair

Nanyang Technological University

Research

JoVE Journal

Biochemistry

1.7K Views.  National Institute of Environmental Health Sciences, National Institutes of Health. Structurele informatie over hoe base-excisieherstelenzymen DNA-laesies verwijderen in de context van chromatine is schaars. Dit vormt een belangrijke leemte in ons begrip van de mechanismen die betrokken zijn bij de etiologie van menselijke ziekten. Het grote voordeel van ons protocol is dat we de monstervoorbereiding hebben geoptimaliseerd met behulp van standaard laboratoriumapparatuur.Dit zal andere biochemici in het veld in staat stellen om hun biochemische werk aan te vullen met t...

Video: Preparation of Nucleosome Core Particles Complexed with DNA Repair Factors for Cryo-Electron Microscopy Structural Determination

Probing The Structure And Dynamics Of Nucleosomes Using Atomic Force Microscopy Imaging

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription to take place in eukaryotic cells. The dynamics of nucleosomes provides access to the DNA by replication and transcription machineries, and critically contributes to the molecular mechanisms underlying chromatin functions. Single-molecule studies such as atomic force microscopy (AFM) imaging have contributed significantly to our current understanding of the role of nucleosome structure and dynamics. The current protocol describes the steps enabling high-resolution AFM imaging techniques to study the structural and dynamic properties of nucleosomes. The protocol is illustrated by AFM data obtained for the centromere nucleosomes in which H3 histone is replaced with its counterpart centromere protein A (CENP-A). The protocol starts with the assembly of mono-nucleosomes using a continuous dilution method. The preparation of the mica substrate functionalized with aminopropyl silatrane (APS-mica) that is used for the nucleosome imaging is critical for the AFM visualization of nucleosomes described and the procedure to prepare the substrate is provided. Nucleosomes deposited on the APS-mica surface are first imaged using static AFM, which captures a snapshot of the nucleosome population. From analyses of these images, such parameters as the size of DNA wrapped around the nucleosomes can be measured and this process is also detailed. The time-lapse AFM imaging procedure in the liquid is described for the high-speed time-lapse AFM that can capture several frames of nucleosome dynamics per second. Finally, the analysis of nucleosome dynamics enabling the quantitative characterization of the dynamic processes is described and illustrated.

Here, we present a protocol to characterize nucleosome particles at the single-molecule level using static and time-lapse atomic force microscopy (AFM) imaging techniques. The surface functionalization method described allows for the capture of the structure and dynamics of nucleosomes in high-resolution at the nanoscale.

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription ...

Single Particle Cryo-Electron Microscopy: From Sample to Structure

Cryo-electron microscopy (cryoEM) is a powerful technique for structure determination of macromolecular complexes, via single particle analysis (SPA). The overall process involves i) vitrifying the specimen in a thin film supported on a cryoEM grid; ii) screening the specimen to assess particle distribution and ice quality; iii) if the grid is suitable, collecting a single particle dataset for analysis; and iv) image processing to yield an EM density map. In this protocol, an overview for each of these steps is provided, with a focus on the variables which a user can modify during the workflow and the troubleshooting of common issues. With remote microscope operation becoming standard in many facilities, variations on imaging protocols to assist users in efficient operation and imaging when physical access to the microscope is limited will be described.

Structure determination of macromolecular complexes using cryoEM has become routine for certain classes of proteins and complexes. Here, this pipeline is summarized (sample preparation, screening, data acquisition and processing) and readers are directed towards further detailed resources and variables that may be altered in the case of more challenging specimens.

Cryo-electron microscopy (cryoEM) is a powerful technique for structure determination of macromolecular complexes, via single particle analysis (SPA). The ...

A Robust Single-Particle Cryo-Electron Microscopy (cryo-EM) Processing Workflow with cryoSPARC, RELION, and Scipion

Recent advances in both instrumentation and image processing software have made single-particle cryo-electron microscopy (cryo-EM) the preferred method for structural biologists to determine high-resolution structures of a wide variety of macromolecules. Multiple software suites are available to new and expert users for image processing and structure calculation, which streamline the same basic workflow: movies acquired by the microscope detectors undergo correction for beam-induced motion and contrast transfer function (CTF) estimation. Next, particle images are selected and extracted from averaged movie frames for iterative 2D and 3D classification, followed by 3D reconstruction, refinement, and validation. Because various software packages employ different algorithms and require varying levels of expertise to operate, the 3D maps they generate often differ in quality and resolution. Thus, users regularly transfer data between a variety of programs for optimal results. This paper provides a guide for users to navigate a workflow across the popular software packages: cryoSPARC v3, RELION-3, and Scipion 3 to obtain a near-atomic resolution structure of the adeno-associated virus (AAV). We first detail an image processing pipeline with cryoSPARC v3, as its efficient algorithms and easy-to-use GUI allow users to quickly arrive at a 3D map. In the next step, we use PyEM and in-house scripts to convert and transfer particle coordinates from the best quality 3D reconstruction obtained in cryoSPARC v3 to RELION-3 and Scipion 3 and recalculate 3D maps. Finally, we outline steps for further refinement and validation of the resultant structures by integrating algorithms from RELION-3 and Scipion 3. In this article, we describe how to effectively utilize three processing platforms to create a single and robust workflow applicable to a variety of data sets for high-resolution structure determination.

A Robust Single-Particle Cryo-Electron Microscopy cryo-EM Processing Workflow with cryoSPARC, RELION, and Scipion

This article describes how to effectively utilize three cryo-EM processing platforms, i.e., cryoSPARC v3, RELION-3, and Scipion 3, to create a single and robust workflow applicable to a variety of single-particle data sets for high-resolution structure determination.

Recent advances in both instrumentation and image processing software have made single-particle cryo-electron microscopy (cryo-EM) the preferred method ...

In Situ Nucleosome Reconstitution for Single-Molecule Studies

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

Author Spotlight: Efficient Nucleosome Reconstitution for Single-Molecule Techniques

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

Optimizing Sample Preparation for Cryogenic Electron Microscopy

Cryogenic electron microscopy (cryo-EM) has revolutionized structural biology by enabling the study of macromolecular structures in near-native conditions, suspended in vitreous ice. This technique allows for the high-resolution visualization of proteins and other biomolecules without the need for crystallization, offering significant insights into their function and mechanism. Recent advancements in single-particle analysis, coupled with improved computational data processing, have made cryo-EM an indispensable tool in modern structural biology. Despite its growing adoption, cryo-EM faces persistent challenges that can limit its effectiveness, particularly uneven particle distribution. This issue often leads to poor resolution and reduced accuracy in reconstructed protein structures. This article outlines a simple, practical approach to address this challenge, using the small heat-shock protein from Methanocaldococcus jannaschii (MjsHSP16.5) as an example. The method optimizes sample preparation to minimize preferential adsorption, ensuring more homogeneous particle distribution and higher-quality protein cryo-EM structures. This technique offers valuable guidance for researchers aiming to overcome similar challenges in structural studies.

This protocol presents a practical method using Methanocaldococcus jannaschii (MjsHSP16.5) as an example to address uneven particle distribution through sample preparation optimization, providing a reference for researchers to efficiently elucidate macromolecular structures using cryogenic electron microscopy (cryo-EM).

Cryogenic electron microscopy (cryo-EM) has revolutionized structural biology by enabling the study of macromolecular structures in near-native ...

Assembly of Nucleosomal Arrays from Recombinant Core Histones and Nucleosome Positioning DNA

Core histone octamers that are repetitively spaced along a DNA molecule are called nucleosomal arrays. Nucleosomal arrays are obtained in one of two ways: purification from in vivo sources, or reconstitution in vitro from recombinant core histones and tandemly repeated nucleosome positioning DNA. The latter method has the benefit of allowing for the assembly of a more compositionally uniform and precisely positioned nucleosomal array. Sedimentation velocity experiments in the analytical ultracentrifuge yield information about the size and shape of macromolecules by analyzing the rate at which they migrate through solution under centrifugal force. This technique, along with atomic force microscopy, can be used for quality control, ensuring that the majority of DNA templates are saturated with nucleosomes after reconstitution. Here we describe the protocols necessary to reconstitute milligram quantities of length and compositionally defined nucleosomal arrays suitable for biochemical and biophysical studies of chromatin structure and function.

A method is presented for the reconstitution of model nucleosomal arrays from recombinant core histones and tandemly repeated nucleosome positioning DNA. We also describe how sedimentation velocity experiments in the analytical ultracentrifuge, and atomic force microscopy (AFM) are used to monitor the extent of nucleosomal array saturation after reconstitution.

Core histone octamers that are repetitively spaced along a DNA molecule  are called nucleosomal arrays. Nucleosomal arrays are obtained in one of two  ...

Biology

Do's and Don'ts of Cryo-electron Microscopy: A Primer on Sample Preparation and High Quality Data Collection for Macromolecular 3D Reconstruction

Cryo-electron microscopy (cryoEM) entails flash-freezing a thin layer of sample on a support, and then visualizing the sample in its frozen hydrated state by transmission electron microscopy (TEM). This can be achieved with very low quantity of protein and in the buffer of choice, without the use of any stain, which is very useful to determine structure-function correlations of macromolecules. When combined with single-particle image processing, the technique has found widespread usefulness for 3D structural determination of purified macromolecules. 
The protocol presented here explains how to perform cryoEM and examines the causes of most commonly encountered problems for rational troubleshooting; following all these steps should lead to acquisition of high quality cryoEM images. The technique requires access to the electron microscope instrument and to a vitrification device. Knowledge of the 3D reconstruction concepts and software is also needed for computerized image processing. Importantly, high quality results depend on finding the right purification conditions leading to a uniform population of structurally intact macromolecules. 
The ability of cryoEM to visualize macromolecules combined with the versatility of single particle image processing has proven very successful for structural determination of large proteins and macromolecular machines in their near-native state, identification of their multiple components by 3D difference mapping, and creation of pseudo-atomic structures by docking of x-ray structures. The relentless development of cryoEM instrumentation and image processing techniques for the last 30 years has resulted in the possibility to generate de novo 3D reconstructions at atomic resolution level.

This paper describes the cryo-electron microscopy methodology, which is used to obtain high quality microscopic images of macromolecules in their near-native state. The method yields images suitable for further computerized processing using the single particle approach, devised to generate the 3D reconstruction of a macromolecule.

Cryo-electron microscopy (cryoEM) entails flash-freezing a thin layer of sample on a support, and then visualizing the sample in its frozen hydrated state ...

Visualization of miniSOG Tagged DNA Repair Proteins in Combination with Electron Spectroscopic Imaging (ESI)

The limits to optical resolution and the challenge of identifying specific protein populations in transmission electron microscopy have been obstacles in cell biology. Many phenomena cannot be explained by in vitro analysis in simplified systems and need additional structural information in situ, particularly in the range between 1 nm and 0.1 &#181;m, in order to be fully understood. Here, electron spectroscopic imaging, a transmission electron microscopy technique that allows simultaneous mapping of the distribution of proteins and nucleic acids, and an expression tag, miniSOG, are combined to study the structure and organization of DNA double-strand break repair foci.

Visualization of miniSOG Tagged DNA Repair Proteins in Combination with Electron Spectroscopic Imaging ESI

Electron spectroscopic imaging can image and distinguish nucleic acid from protein at nanometer resolution. It can be combined with the miniSOG system, which is able to specifically label tagged proteins in transmission electron microscopy samples. We illustrate the use of these technologies using double-strand break repair foci as an example.

The limits to optical resolution and the challenge of identifying specific protein populations in transmission electron microscopy have been obstacles in ...

Imaging Replicative Domains in Ultrastructurally Preserved Chromatin by Electron Tomography

Principles of DNA folding in the cell nucleus and its dynamic transformations that occur during the fulfillment of basic genetic functions (transcription, replication, segregation, etc.) remain poorly understood, partially due to the lack of experimental approaches to high-resolution visualization of specific chromatin loci in structurally preserved nuclei. Here we present a protocol for the visualization of replicative domains in monolayer cell culture in situ,&#160;by combining EdU labeling of newly synthesized DNA with subsequent label detection with Ag-amplification of Nanogold particles and ChromEM staining of chromatin. This protocol allows for the high-contrast, high-efficiency pre-embedding labeling, compatible with traditional glutaraldehyde fixation that provides the best structural preservation of chromatin for room-temperature sample processing. Another advantage of pre-embedding labeling is the possibility to pre-select cells of interest for sectioning. This is especially important for the analysis of heterogeneous cell populations, as well as compatibility with electron tomography approaches to high-resolution 3D analysis of chromatin organization at sites of replication, and the analysis of post-replicative chromatin rearrangement and sister chromatid segregation in the interphase.

This protocol presents a technique for high-resolution mapping of replication sites in structurally preserved chromatin in situ that employs a combination of pre-embedding EdU-streptavidin-Nanogold labeling and ChromEMT.

Principles of DNA folding in the cell nucleus and its dynamic transformations that occur during the fulfillment of basic genetic functions (transcription, ...

High-Speed Time-Lapse Atomic Force Microscopy to Capture Nucleosome Dynamics

Source: Stumme-Diers, M. P., et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/58820">Probing The Structure And Dynamics Of Nucleosomes Using Atomic Force Microscopy Imaging.</a>&#160;J. Vis. Exp.&#160;(2019)
In this video, we demonstrate high-speed time-lapse atomic force microscopy, AFM, imaging techniques to study the dynamics of nucleosome complexes. As the AFM tip scans across the surface of the nucleosome, it detects alterations in the nucleosome height and records the DNA unwrapping over time.

Preparation of Nucleosome Core Particles Complexed with DNA Repair Factors for Cryo-Electron Microscopy Structural Determination

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video