This work was supported by research grants from the United Arab Emirates University (UAEU), grant # 31R170 (Zayed Center for Health Sciences) and # 12R010 (UAEU-AUA grant). We thank Prof Randall Morse (Wadsworth Center, Albany, NY) for helping us to edit the manuscript for style and grammar.
All data are available upon request.

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent
<ol>
	<li>Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2 until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).</li>
	<li>Seed 4 x 106 cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>For each transfection, dilute plasmid DNA (1 mg/mL stocks) in 1 mL of serum free DMEM media in 1.5 mL centrifuge tubes using the following ratio of entry and packaging plasmids: 
	Entry vector = 10 &#181;g 
	psPAX2.0 = 7.5 &#181;g 
	pMD2.G = 5 &#181;g</li>
	<li>Vortex for 10 s and spin the tube at 10,000 x g for 30 s at room temperature to collect.</li>
	<li>Add 70 &#181;L of (1 mg/mL stock solution) PEI to the tube, and vortex and spin briefly as described above to collect. The volume of PEI used is based on a 1:3 ratio of total DNA (&#181;g):PEI (&#181;g).</li>
	<li>For lipofectamine-based transfection, dilute the above vectors in 500 &#181;L of serum-free DMEM media containing 45 &#181;L of reagent P supplied in the kit and incubate at room temperature for 5 min.</li>
	<li>Dilute 70 &#181;L of reagent L supplied in the kit using 500 &#181;L of serum-free DMEM media and incubate at room temperature for 5 min.</li>
	<li>Combine the contents of both tubes and incubate the tubes at room temperature for 20 min to allow complex formation.</li>
	<li>Add dropwise 1 mL of DNA/PEI or 1 mL of DNA/lipofectamine complexes to the plate containing cells and incubate for 6 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>After 6 h, change to fresh complete growth media (10 mL) and return the cells back to the humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
</ol>
2. LVS collection and ultracentrifugation
<ol>
	<li>After 2 days of transfection, collect the virus-containing media and overlay the cells again with 10 mL of fresh complete growth media.</li>
	<li>After 3 days of transfection, collect the virus-containing media and combine it with the virus-containing media collected at the 2 day time point.</li>
	<li>Centrifuge the viral supernatant at 2,000 x g for 10 min at 4 &#176;C to pellet cellular debris.</li>
	<li>Filter the supernatant using a 0.45 &#181;m pore size low protein binding filter (either PES or SFCA) and store at 4 &#176;C until ready for ultracentrifugation. The filtered supernatant containing lentiviral particles can be stored at 4 &#176;C for 5 days without a significant loss in viral titers.</li>
	<li>Sterilize the ultracentrifuge tubes holding cups by washing them with 70% ethanol for 10 min, air dry, close, and keep at 4 &#176;C.</li>
	<li>Add 36 mL of filtered media containing lentiviral particles to a sterile ultracentrifuge tube.</li>
	<li>Fill 5 mL of a sterile stripette with 4 mL of sterile 20% sucrose solution (prepared in PBS) and dispense it right to the bottom of the ultracentrifuge tube (UC) containing LVS. It is important that the sucrose solution is not mixed with the media and makes a gradient at the bottom of the tube.</li>
	<li>Balance all the ultracentrifuge tubes using serum-free DMEM media, place in the cold ultracentrifuge tube holding cups, and close the lids.</li>
	<li>Spin the tubes at 125,000 x g for 2 h at 4 &#176;C.</li>
	<li>After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.</li>
	<li>Place the ultracentrifuge tube in a 50 mL sterile tube and add 200 &#181;L of sterile DPBS exactly at the top of the pellet. Keep at 4 &#176;C overnight undisturbed.</li>
	<li>The following day, gently mix by pipetting up and down 40x.</li>
	<li>Briefly spin at 13,000 x g in a tabletop centrifuge to pellet any debris.</li>
	<li>Transfer the supernatant to a new tube and aliquot the virus preparation as 20 &#181;L aliquots. Store at &#8722;80 &#176;C.</li>
	<li>Set aside 5 &#181;L of the preparation for viral titer measurements.</li>
</ol>
3. LVS titer measurement for pLKO.1-based vectors
<ol>
	<li>Determine the titer of lentiviral particles by using a qPCR following the manufacturer&#39;s recommendations.</li>
	<li>For a standard curve, prepare five 10-fold serial dilutions of Standard Control DNA (provided in the kit) by diluting 5 &#181;L of DNA into 45 &#181;L of nuclease-free H2O in each step. Use dilutions of 1:100 to 1:100,000 to generate a standard curve.</li>
	<li>Set up reactions on ice in duplicates in the following manner: 
	2x qPCR master mix&#160; &#160; &#160; &#160; 10 &#181;L 
	Primer mix&#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; 2 &#181;L 
	Sample or standard DNA&#160; &#160;2 &#181;L 
	Nuclease-free H2O&#160; &#160; &#160; &#160; &#160; &#160; 6 &#181;L</li>
	<li>Perform qPCR using the cycling conditions mentioned in the manual of the kit for a total of 35 cycles.</li>
	<li>Plot cycle threshold (Ct) values on the Y-axis vs. virus titer on the X-axis.</li>
	<li>Generate a logarithmic regression using four standard control DNA dilutions (1:100 to 1:100,000) to determine the unknown virus sample titer using a trendline equation.</li>
</ol>
4. LVS titer measurement for pll3.7-based vectors
<ol>
	<li>Seed 1 x 105 HEK293T cells in each well of a P12-well plate in 1 mL of complete growth media 24 h before infections.</li>
	<li>Supplement the media with 8 &#181;g/mL polybrene and add 1 mL into each sterile 1.5 mL tube.</li>
	<li>Dilute the viral particles by using 4 &#181;L, 2 &#181;L, 1 &#181;L, 0.5 &#181;L, and 0.1 &#181;L of concentrated lentiviral particles in each of the 1 mL of polybrene-containing media.</li>
	<li>Replace the media from HEK293T cells with the media containing indicated amounts of lentiviral particles along with 8 &#181;g/mL polybrene and incubate for 24 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>The next day, change to fresh media and continue the culture for 72 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>After 72 h, wash the cells with PBS, trypsinize at 37 &#176;C according to the manufacturer&#39;s protocol, and resuspend in 1 mL of PBS.</li>
	<li>Perform FACS cell sorting using a cell sorter, following the manufacturer&#39;s recommendations. Set the gate to 0% GFP positive cells using non-infected HEK293T cells and count 50,000 events for each sample to determine the percentage of positive cells for each viral dilution.</li>
	<li>Use only the volumes of lentiviral particles that give %GFP positive cells in the range of 2%-20% to calculate the titer of lentiviral particles.</li>
</ol>
5. Infection of hESCs and stable selection
<ol>
	<li>Wash the cells with 2 mL of PBS growing in each well of a 6-well cell culture multiwell plate.</li>
	<li>Detach the cells from the cell culture plate using 1 mL of 1x cell dissociation reagent by incubation at 37&#160;&#176;C for 5 min.</li>
	<li>Collect the cells in DMEM/F12 media and centrifuge at 1,500 x g for 5 min at room temperature to collect the cell pellet.</li>
	<li>Aspirate, resuspend the cells in 1 mL, and count using a hemocytometer.</li>
	<li>Make a cell suspension with 2 x 105 cells/mL of complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 &#181;M ROCK Inhibitor (RI).</li>
	<li>Seed 1 x 105 cells on 50x diluted complete basement membrane matrix-coated P24-well plates in 500 &#181;L of complete growth media and culture the cells at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>The following day, infect hESCs at a multiplicity of infection (MOI) of 10 with 8 &#181;g/mL polybrene and incubate at 37 &#176;C for 8 h.</li>
	<li>After 8 h, replace the virus-containing media with fresh growth media (-RI) and continue the culture until the cells are 90% confluent.</li>
	<li>Start puromycin selection (0.8 &#181;g/mL) when the cells reach 90% confluency, which is usually 48-72 h post infection.</li>
	<li>After selection is complete (usually 4-6 days), split the stable cells (1:4) and expand the cells for cryopreservation and further analysis.</li>
</ol>
6. Transduction of H9-derived neural progenitor cells (NPCs)
NOTE: NPCs were derived from H9 cells using a dual-Smad inhibition protocol, as described previously19.
<ol>
	<li>Briefly, treat H9 cells with cell dissociation reagent at 37 &#176;C for 5 min to generate single cells and resuspend in complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 &#181;M ROCK Inhibitor (RI). Seed on 1:50 diluted Matrigel-coated 6-well cell culture dishes at a density of 60,000 cells/cm2 (day 0).</li>
	<li>Initiate differentiation when the cells reach 95%-100% confluency by changing to 100% KSR media containing LDN193189 (200 nM), and SB431542 (10 &#181;M) (day1).</li>
	<li>On day 2, change the media again with 100% KSR supplemented with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M).</li>
	<li>On day 4 of differentiation, switch to a mixture of KSR medium (75%) and N2 medium (25%) with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M).</li>
	<li>From day 6 to day 12, gradually switch the media to 100% N2 supplemented with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M) by increasing the N2 media 25% each day and changing the media after every 2 days.</li>
	<li>Culture day 12 NPCs in N2:B27 media supplemented with 20 ng/mL bFGF.</li>
	<li>Seed 2 x 105 cells in each well of a 1:50 diluted complete basement membrane matrix-coated P6-plate in 2 mL of NPCs culture media and incubate to allow the cells to attach.</li>
	<li>The next day, infect the cells with lentiviral particles at an MOI 6 in the presence of 8 &#181;g/mL polybrene.</li>
	<li>After 8 h, replace the virus-containing media with fresh NPC growth media.</li>
	<li>The next day, repeat the infections and change the media at 8 h.</li>
	<li>Keep the cells in culture for 72 h before harvesting for further analysis.</li>
</ol>

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282 (5391), 1145-1147 (1998).</li><li>Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+from+human+blastocysts:+Somatic+differentiation+in+vitro.">Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro.</a> Nature Biotechnology. 18 (4), 399-404 (2000).</li><li>Strulovici, Y., Leopold, P. L., O'Connor, T. P., Pergolizzi, R. G., Crystal, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cells+and+gene+therapy.">Human embryonic stem cells and gene therapy.</a> Molecular Therapy. 15 (5), 850-866 (2007).</li><li>Kane, N., McRae, S., Denning, C., Baker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+and+nonviral+gene+delivery+and+its+role+in+pluripotent+stem+cell+engineering.">Viral and nonviral gene delivery and its role in pluripotent stem cell engineering.</a> Drug Discovery Today. Technologies. 5 (4), 105 (2008).</li><li>Li, S. D., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+is+superior+to+viral+gene+delivery.">Nonviral is superior to viral gene delivery.</a> Journal of Controlled Release. 123 (3), 181-183 (2007).</li><li>Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+gene+delivery+systems:+From+simple+transfection+agents+to+artificial+viruses.">Nonviral gene delivery systems: From simple transfection agents to artificial viruses.</a> Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).</li><li>Cao, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+gene-transfer+efficiency+in+human+embryonic+stem+cells.">Comparison of gene-transfer efficiency in human embryonic stem cells.</a> Molecular Imaging and Biology. 12 (1), 15-24 (2010).</li><li>Mohr, J. C., de Pablo, J. J., Palecek, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+human+embryonic+stem+cells:+Small+and+macromolecule+loading+and+DNA+transfection.">Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection.</a> Biotechnology Progress. 22 (3), 825-834 (2006).</li><li>Sukhorukov, V. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surviving+high-intensity+field+pulses:+Strategies+for+improving+robustness+and+performance+of+electrotransfection+and+electrofusion.">Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion.</a> The Journal of Membrane Biology. 206 (3), 187-201 (2005).</li><li>Floch, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+phosphonolipids+as+non+viral+vectors+for+DNA+transfection+in+hematopoietic+cell+lines+and+CD34++cells.">Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells.</a> Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).</li><li>Lakshmipathy, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transfection+of+embryonic+and+adult+stem+cells.">Efficient transfection of embryonic and adult stem cells.</a> Stem Cells. 22 (4), 531-543 (2004).</li><li>Siemen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleofection+of+human+embryonic+stem+cells.">Nucleofection of human embryonic stem cells.</a> Stem Cells and Development. 14 (4), 378-383 (2005).</li><li>Zhang, X., Godbey, W. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+for+gene+delivery+in+tissue+engineering.">Viral vectors for gene delivery in tissue engineering.</a> Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).</li><li>Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+sustained+transgene+expression+in+human+embryonic+stem+cells+using+lentiviral+vectors.">High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors.</a> Stem Cells. 21 (1), 111-117 (2003).</li><li>Gropp, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+genetic+modification+of+human+embryonic+stem+cells+by+lentiviral+vectors.">Stable genetic modification of human embryonic stem cells by lentiviral vectors.</a> Molecular Therapy. 7 (2), 281-287 (2003).</li><li>Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HEK293+cell+line+as+a+platform+to+produce+recombinant+proteins+and+viral+vectors.">HEK293 cell line as a platform to produce recombinant proteins and viral vectors.</a> Frontiers in Bioengineering and Biotechnology. 9, 796991 (2021).</li><li>Merten, O. W., Hebben, M., Bovolenta, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+lentiviral+vectors.">Production of lentiviral vectors.</a> Molecular Therapy: Methods &amp; Clinical Development. 3, 16017 (2016).</li><li>Lungwitz, U., Breunig, M., Blunk, T., G&#246;pferich, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+nonviral+gene+delivery+systems.">Polyethylenimine-based nonviral gene delivery systems.</a> European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation+during+in-vitro+human+embryonic+cortical+neurogenesis.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis.</a> Frontiers in Cellular Neuroscience. 11, 415 (2017).</li><li>Weissinger, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+in+purified+human+hematopoietic+peripheral-blood+stem+cells+by+means+of+electroporation+without+prestimulation.">Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation.</a> Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).</li><li>Cui, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+transgene+expression+to+antigen-presenting+cells+derived+from+lentivirus-transduced+engrafting+human+hematopoietic+stem/progenitor+cells.">Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells.</a> Blood. 99 (2), 399-408 (2002).</li><li>Yu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+with+two+independent+internal+promoters+transfer+high-level+expression+of+multiple+transgenes+to+human+hematopoietic+stem-progenitor+cells.">Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells.</a> Molecular Therapy. 7 (6), 827-838 (2003).</li><li>Sweeney, N. P., Vink, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+lentiviral+vector+genome+size+and+producer+cell+genomic+to+gag-pol+mRNA+ratios+on+packaging+efficiency+and+titre.">The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre.</a> Molecular Therapy - Methods &amp; Clinical Development. 21, 574-584 (2021).</li></ol>

The authors declare that there is no conflict of interest.

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods20. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased transfection efficiency in hESCs. The focus of these new developments has been efficient and stable gene delivery to hESCs while maintaining minimal effect on hESCs&#39; growth, pluripotency, and differentiation potential over prolonged periods. Among the various new developments that meet these strict criteria is lentiviral mediated gene transfer to hESCs21,22. For the production of lentiviral particles expressing a certain gene, the desired gene is cloned in one of the transfer vectors and is transfected in HEK293T cells along with packaging plasmids to harvest a cell culture supernatant containing lentiviral particles. To be used in hESCs, it is essential to concentrate these viral particles using various techniques to yield high titers of viruses at least in the range of 1 x 107-1 x 108 IU/mL. In general, large volumes of LVS are concentrated from 200x-500x the original volume to achieve these titers. This means using a highly cost-effective method without compromising the transfection efficiency in HEK293T cells is a prerequisite for these methods to be routinely used in the lab. The present method describes the use of the cationic polymer PEI as a cost-effective method to produce large volumes of LVS with a transfection efficiency similar to lipofection-based methods, which are considered gold standard. Using the presented method, we can get average LVS titers well above 5 x 107 IU/mL after a concentration factor of 200x the original volume. Using these LVS particles, we have been able to establish several stable cell lines of H9 hESCs expressing shRNAs for several genes by infecting the cells at high MOIs. The method presented here bypasses the use of tedious and time-consuming methods of clonal selection and expansion while still getting knockdown efficiencies close to 100%, as shown by one of the representative western blot results for L2HGDH gene knockdown in Figure 4. Following are some of the recommendations for a successful approach.
The use of a low passage number of HEK293T cells is required (ideally below 30) for high viral titers. The confluency of HEK293T cells is another important factor in this regard. HEK293T cells must be at least 80% confluent before transfection as cell-cell contact greatly reduces the cytotoxicity and improves virus production. The vectors used must be prepared using endotoxin-free plasmid isolation kits followed by ethanol precipitation and reconstituted at a minimum concentration of 1mg/mL before usage for transfection. There could be batch-to-batch variations of PEI solutions prepared at different dates. For that reason, each batch of PEI solution must be first tested for performance by using GFP vectors, and the solution must be stored at &#8722;20 &#176;C in single-use aliquots to avoid repeated freeze-thaw cycles. For high titers, the collection of LVS supernatant post 72 h of transfection of HEK293T cells is only recommended provided the cells are healthy and attached. Filtration of the LVS-containing supernatant greatly increases the solubility of LVS post ultracentrifugation. It is not advised to store the LVS supernatant at 4 &#176;C for more than 5 days as it will result in a significant reduction of virus titers. Sucrose gradient during ultracentrifugation is required for optimal titers. Temperatures must be maintained close to 4 &#176;C during all the steps of ultracentrifugation. Overnight incubation of concentrated LVS particles in DPBS is required for complete resuspension. Centrifugation following resuspension of LVS removes cellular debris (if any) as it can cause cytotoxicity when used on target cells. After the infection of H9 cells, it is important to replace the virus-containing media with fresh growth media after 8 h as prolonged incubation with the virus would result in significant cell death of the H9 hESCs. The puromycin selection should only be started when the confluency is more than 80%.
The method described above was originally adapted for the expression of shRNAs. A similar approach could be used for the ectopic expression of cDNAs to be cloned into expression vectors. However, a major limitation of lentiviral mediated gene delivery is the size constraint. As size increases, the packaging of lentiviral vectors is not optimal, which results in reduced viral titers23. Future research should be directed to optimize the protocol to overcome these constraints.

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies7. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications11,12.
In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies13. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles14,15. Lipofection and CaPO4 precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles16. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO4 precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO4 precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations17. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.
Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods18. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 107 IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

<table><tbody><tr><td>2-Mercaptoethanol</td><td>Invitrogen</td><td>31350010</td><td></td></tr><tr><td>38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes</td><td>Beckman Coulter</td><td>C14292</td><td></td></tr><tr><td>Accutase</td><td>Stem Cell Technologies</td><td>7920</td><td></td></tr><tr><td>bFGF Recombinant human</td><td>Invitrogen</td><td>PHG0261</td><td></td></tr><tr><td>Bovine serum albumin FRAC V</td><td>Invitrogen</td><td>15260037</td><td></td></tr><tr><td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td><td>Corning</td><td>354234</td><td></td></tr><tr><td>Cyclopamine</td><td>Stem Cell Technologies</td><td>72074</td><td></td></tr><tr><td>DMEM media</td><td>Invitrogen</td><td>11995073</td><td></td></tr><tr><td>DMEM Nutrient mix F12&amp;nbsp;</td><td>Invitrogen</td><td>11320033</td><td></td></tr><tr><td>DPBS w/o: Ca and Mg</td><td>PAN Biotech</td><td>P04-36500</td><td></td></tr><tr><td>Fetal bovie serum</td><td>Invitrogen</td><td>10270106</td><td></td></tr><tr><td>GAPDH (14C10) Rabbit mAb Antibody</td><td>CST</td><td>2118S</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stem Cell Technologies</td><td>7174</td><td></td></tr><tr><td>HyClone Non Essential Amino Acids (NEAA) 100X Solution</td><td>GE healthcare</td><td>SH30238.01</td><td></td></tr><tr><td>L Glutamine, 100X&amp;nbsp;</td><td>Invitrogen</td><td>2924190090</td><td></td></tr><tr><td>L2HGDH Polyclonal antibody</td><td>Proteintech</td><td>15707-1-AP</td><td></td></tr><tr><td>L2HGDH shRNA</td><td>Macrogen</td><td></td><td>Seq: CGCATTCTTCATGTGAGAAAT</td></tr><tr><td>Lipofectamine 3000 kit</td><td>Thermo Fisher</td><td>L3000001</td><td></td></tr><tr><td>mTesR1 complete media</td><td>Stem Cell Technologies</td><td>85850</td><td></td></tr><tr><td>Neurobasal medium 1X CTS</td><td>Invitrogen</td><td>A1371201</td><td></td></tr><tr><td>Neuropan 2 Supplement 100x</td><td>PAN Biotech</td><td>P07-11050</td><td></td></tr><tr><td>Neuropan 27 Supplement 50x</td><td>PAN Biotech</td><td>P07-07200</td><td></td></tr><tr><td>Penicillin streptomycin SOL</td><td>Invitrogen</td><td>15140122</td><td></td></tr><tr><td>pLKO.1 TRC vector</td><td>Addgene</td><td>10878</td><td></td></tr><tr><td>pLL3.7 vector&amp;nbsp;</td><td>Addgene</td><td>11795</td><td></td></tr><tr><td>pMD2.G</td><td>Addgene</td><td>12259</td><td></td></tr><tr><td>Polybrene infection reagent</td><td>Sigma</td><td>TR1003- G</td><td></td></tr><tr><td>Polyethylenimine, branched</td><td>Sigma</td><td>408727</td><td></td></tr><tr><td>psPAX2.0</td><td>Addgene</td><td>12260</td><td></td></tr><tr><td>Purmorphamine</td><td>Tocris</td><td>4551/10</td><td></td></tr><tr><td>Puromycin</td><td>Invitrogen</td><td>A1113802</td><td></td></tr><tr><td>ROCK inhibitor Y-27632&lt;br/&gt; dihydrochloride&amp;nbsp;</td><td>Tocris</td><td>1254</td><td></td></tr><tr><td>SB 431542</td><td>Tocris</td><td>1614/10</td><td></td></tr><tr><td>Trypsin .05% EDTA&amp;nbsp;</td><td>Invitrogen</td><td>25300062</td><td></td></tr><tr><td>XAV 939</td><td>Tocris</td><td>3748/10</td><td></td></tr></tbody></table>

lentiviral mediated delivery of shrnas to hescs and npcs using low-cost cationic polymer polyethylenimine (pei)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 107. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency20. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approaches: one using GFP as reporter and transient expression in hESCs-derived NPCs and the other one using puromycin for the stable selection of hESCs for long-term differentiation experiments.
In the first set of experiments, lentiviral particles were produced by co-transfecting shRNAs carrying the pll3.7 vector with GFP as reporter along with second-generation lentiviral packaging plasmids psPAX2.0 and pMD2.G. Lentiviral particles were collected following 48 h and 72 h post transfection and concentrated using ultracentrifugation. Figure 1A shows the abundant GFP expression in HEK293T cells after 72 h of transfection. The expression of viral proteins also resulted in syncytia formation of HEK293T cells where single cells are fused together, as shown by arrows in Figure 1A. The titers were determined using FACS analysis. We also compared the lentiviral titers using low-cost PEI and Lipofectamine 3000 reagent and found no significant difference between the two in terms of viral titers (Figure 2A). Next, H9 hESCs-derived NPCs were infected twice with these GFP-containing lentiviral particles at an MOI of 6 and harvested for analysis post 72 h. Figure 1B shows marked expression of GFP in NPCs following infection. As discussed above, for long-term differentiation experiments, it is imperative to have hESCs that stably express shRNAs. In an attempt to create stable cell lines expressing shRNA for various genes, we used plKO.1-based vectors and cloned shRNAs according to the manufacturer&#39;s recommendations. Next, lentiviral particles were produced as described above, and titers were determined using a commercial lentiviral titer measurement kit using qPCR-based methods (Figure 2B). hESCs were infected with lentiviral particles at an MOI of 10 and selected using puromycin selection. Figure 3 shows the results of stable selection of hESCs following transduction. After 5 days of selection with 0.8 &#181;g/mL puromycin, lentiviral transfected cells showed more than 80% cell viability as compared to non-transduced cells, where no cells survived the treatment. After the selection, the stably transduced H9 cells were further expanded, cryopreserved, and analyzed using western blot to assay for efficient gene knockdown.
In our laboratory, we have created multiple stable cell lines of H9 hESCs expressing shRNAs for different genes using the above approach. Here, we have presented the results of one of those, which is the L-2-hydroxyglutarate dehydrogenase (L2HGDH) gene using western blot analysis. Abundant expression of L2HGDH is observed in cells transduced with empty vector backbone. However, no expression of L2HGDH is observed in cells transduced with a vector carrying shRNAs for L2HGDH, showing the efficacy of the stable generation of an H9 hESCs cell line with reduced expression of L2HGDH, which can be used for further differentiation studies (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63953/63953fig01.jpg" /> 
Figure 1: Expression of GFP in HEK293T cells and viral-infected NPCs. (A) shRNAs were cloned into a pll3.7 vector carrying GFP as reporter and co-transfected with packaging plasmids in HEK293T cells using PEI. The high GFP expression shows efficient transfection efficiency post 72 h of transfection. Arrows indicate syncytia formation in the HEK293T cells, where groups of individual HEK293T cells have fused together due to the expression of viral proteins. (B) H9-derived NPCs were infected twice at an MOI of 6 with lentiviral particles containing GFP as reporter, and GFP expression was observed at 72 h post infection. Scale bar = 50 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63953/63953fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63953/63953fig02.jpg" /> 
Figure 2: LVS titer measurements. (A) Viral titers for pll3.7-based vectors were measured using FACS analysis by quantifying the %GFP positive cells for those viral dilutions that gave 2%-20% GFP positive cells. (B) Viral titers for pLKO.1-based vectors were determined by using a commercial qPCR lentivirus titer kit, following the manufacturer&#39;s recommendations. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63953/63953fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63953/63953fig03.jpg" /> 
Figure 3: Establishment of stable shRNA-expressing H9 hESC lines. shRNAs were cloned into pLKO.1-based lentiviral vectors carrying the puromycin selection gene. H9 hESCs were infected with lentiviral particles at an MOI of 10 and selected using puromycin. Using 0.8 &#181;g/mL puromycin for 5 days, 100% of the non-infected cells were killed, while most of the cells survived the treatment in the viral-infected group. These cells were expanded without clonal selection for cryopreservation and further analysis. Scale bar = 50 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63953/63953fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63953/63953fig04.jpg" /> 
Figure 4: A representative western blot analysis for stable knockdown of the L2HGDH gene in H9 hESCs. Total cell lysates from negative control (H9, puro uncut) cells, as well as cells stably expressing shRNAs against L2HGDH (H9, sh-L2HGDH)&#160;were subjected to western blot using the anti-L2HGDH antibody. As shown in the figure, no expression of L2HGDH was observed in H9 hESCs stably expressing shRNAs for L2HGDH. A non-specific band was observed just above the specific band corresponding to the correct molecular weight of 46-48 kDa (indicated by a triangle) for the L2HGDH antibody. Anti-GAPDH was used as a loading control. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63953/63953fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI at JoVE.com

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) ...

lentiviral-mediated-delivery-shrnas-to-hescs-npcs-using-low-cost

Nanyang Technological University

Research

JoVE Journal

Biology

2.4K Views.  United Arab Emirates University. Transfectie van HEK293T-cellen moet worden uitgevoerd bij 90% confluency. Ook het gebruik van een 0,45 micron laag eiwitbindend filter voor lentivirale vectorfiltratie en het gebruik van een sucrosekussen voor ultracentrifugatie zijn essentieel. Begin met het kweken van HEK293T-cellen in DMEM-medium met 10% FBS en 1X penicilline streptomycine bij 37 graden Celsius in een bevochtigde incubator met een atmosfeer van 5% koolstofdioxide en 21% zuurstof totdat cellen 90% samenvloeiing bereiken voo...

Video: Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

Generation of Induced Pluripotent Stem Cells from Frozen Buffy Coats using Non-integrating Episomal Plasmids

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, Klf-4, and c-Myc), typically expressed by human embryonic stem cells (hESCs). Due to their similarity with hESCs, iPSCs have become an important tool for potential patient-specific regenerative medicine, avoiding ethical issues associated with hESCs. In order to obtain cells suitable for clinical application, transgene-free iPSCs need to be generated to avoid transgene reactivation, altered gene expression and misguided differentiation. Moreover, a highly efficient and inexpensive reprogramming method is necessary to derive sufficient iPSCs for therapeutic purposes. Given this need, an efficient non-integrating episomal plasmid approach is the preferable choice for iPSC derivation. Currently the most common cell type used for reprogramming purposes are fibroblasts, the isolation of which requires tissue biopsy, an invasive surgical procedure for the patient. Therefore, human peripheral blood represents the most accessible and least invasive tissue for iPSC generation.
In this study, a cost-effective and viral-free protocol using non-integrating episomal plasmids is reported for the generation of iPSCs from human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats after whole blood centrifugation and without density gradient separation.

Induced pluripotent stem cells (iPSCs) represent a source of patient-specific tissues for clinical applications and basic research. Here, we present a detailed protocol to reprogram human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats into viral-free iPSCs using non-integrating episomal plasmids.

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, ...

Developmental Biology

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays (MEA)

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for silencing specific genes1-8 for functional genomics and therapeutics. A major challenge involved in RNAi based studies is the delivery of RNAi agents to targeted cells. Traditional non-viral delivery techniques, such as bulk electroporation and chemical transfection methods often lack the necessary spatial control over delivery and afford poor transfection efficiencies9-12. Recent advances in chemical transfection methods such as cationic lipids, cationic polymers and nanoparticles have resulted in highly enhanced transfection efficiencies13. However, these techniques still fail to offer precise spatial control over delivery that can immensely benefit miniaturized high-throughput technologies, single cell studies and investigation of cell-cell interactions. 
Recent technological advances in gene delivery have enabled high-throughput transfection of adherent cells14-23, a majority of which use microscale electroporation. Microscale electroporation offers precise spatio-temporal control over delivery (up to single cells) and has been shown to achieve high efficiencies19, 24-26. Additionally, electroporation based approaches do not require a prolonged period of incubation (typically 4 hours) with siRNA and DNA complexes as necessary in chemical based transfection methods and lead to direct entry of naked siRNA and DNA molecules into the cell cytoplasm. As a consequence gene expression can be achieved as early as six hours after transfection27. Our lab has previously demonstrated the use of microelectrode arrays (MEA) for site-specific transfection in adherent mammalian cell cultures17-19. In the MEA based approach, delivery of genetic payload is achieved via localized micro-scale electroporation of cells. An application of electric pulse to selected electrodes generates local electric field that leads to electroporation of cells present in the region of the stimulated electrodes. The independent control of the micro-electrodes provides spatial and temporal control over transfection and also enables multiple transfection based experiments to be performed on the same culture increasing the experimental throughput and reducing culture-to-culture variability. 
Here we describe the experimental setup and the protocol for targeted transfection of adherent HeLa cells with a fluorescently tagged scrambled sequence siRNA using electroporation. The same protocol can also be used for transfection of plasmid vectors. Additionally, the protocol described here can be easily extended to a variety of mammalian cell lines with minor modifications. Commercial availability of MEAs with both pre-defined and custom electrode patterns make this technique accessible to most research labs with basic cell culture equipment.

High efficiency, Site-specific Transfection of Adherent Cells with siRNA Using Microelectrode Arrays MEA

The article details the protocol for site-specific transfection of scrambled sequence of siRNA in an adherent mammalian cell culture using a microelectrode array (MEA).

The discovery of RNAi pathway in eukaryotes and the subsequent development of RNAi agents, such as siRNA and shRNA, have achieved a potent method for ...

Bioengineering

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the differentiation of hiPSCs derived from a patient with the triplication of the alpha-synuclein gene (SNCA) locus into Parkinson&#8217;s disease (PD)-relevant dopaminergic neuronal populations. Accumulating evidence has shown that high levels of SNCA are causative for the development of PD. Recognizing the unmet need to establish novel therapeutic approaches for PD, especially those targeting the regulation of SNCA expression, we recently developed a CRISPR/dCas9-DNA-methylation-based system to epigenetically modulate SNCA transcription by enriching methylation levels at the SNCA intron 1 regulatory region. To deliver the system, consisting of a dead (deactivated) version of Cas9 (dCas9) fused with the catalytic domain of the DNA methyltransferase enzyme 3A (DNMT3A), a lentiviral vector is used. This system is applied to cells with the triplication of the SNCA locus and reduces the SNCA-mRNA and protein levels by about 30% through the targeted DNA methylation of SNCA intron 1. The fine-tuned downregulation of the SNCA levels rescues disease-related cellular phenotypes. In the current protocol, we aim to describe a step-by-step procedure for differentiating hiPSCs into neural progenitor cells (NPCs) and the establishment and validation of pyrosequencing assays for the evaluation of the methylation profile in the SNCA intron 1. To outline in more detail the lentivirus-CRISPR/dCas9 system used in these experiments, this protocol describes how to produce, purify, and concentrate lentiviral vectors and to highlight their suitability for epigenome- and genome-editing applications using hiPSCs and NPCs. The protocol is easily adaptable and can be used to produce high titer lentiviruses for in vitro and in vivo applications.

Targeted DNA epigenome editing represents a powerful therapeutic approach. This protocol describes the production, purification, and concentration of all-in-one lentiviral vectors harboring the CRISPR-dCas9-DNMT3A transgene for epigenome-editing applications in human induced pluripotent stem cell (hiPSC)-derived neurons.

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the ...

Genetics

Porous Silicon Microparticles for Delivery of siRNA Therapeutics

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the successful implementation of siRNA therapy requires the use of delivery platforms that can overcome the major challenges of siRNA delivery, such as enzymatic degradation, low intracellular uptake and lysosomal entrapment. Here, a protocol for the preparation and use of a biocompatible and effective siRNA delivery system is presented. This platform consists of polyethylenimine (PEI) and arginine (Arg)-grafted porous silicon microparticles, which can be loaded with siRNA by performing a simple mixing step. The silicon particles are gradually degraded over time, thereby triggering the formation of Arg-PEI/siRNA nanoparticles. This delivery vehicle provides a means for protecting and internalizing siRNA, without causing cytotoxicity. The major steps of polycation functionalization, particle characterization, and siRNA loading are outlined in detail. In addition, the procedures for determining particle uptake, cytotoxicity, and transfection efficacy are also described.

Delivery remains the main challenge for the therapeutic implementation of small interfering RNA (siRNA). This protocol involves the use of a multifunctional and biocompatible siRNA delivery platform, consisting of arginine and polyethylenimine grafted porous silicon microparticles.

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the ...

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes. The emergence of prion diseases in wildlife populations and their increasing threat to human health has led to increased efforts to find a treatment for these diseases. Recent studies have found numerous anti-prion compounds that can either inhibit the infectious PrPRes isomer or down regulate the normal cellular prion protein. However, most of these compounds do not cross the blood brain barrier to effectively inhibit PrPRes formation in brain tissue, do not specifically target neuronal PrPC, and are often too toxic to use in animal or human subjects. 
We investigated whether siRNA delivered intravascularly and targeted towards neuronal PrPC is a safer and more effective anti-prion compound. This report outlines a protocol to produce two siRNA liposomal delivery vehicles, and to package and deliver PrP siRNA to neuronal cells. The two liposomal delivery vehicles are 1) complexed-siRNA liposome formulation using cationic liposomes (LSPCs), and 2) encapsulated-siRNA liposome formulation using cationic or anionic liposomes (PALETS). For the LSPCs, negatively charged siRNA is electrostatically bound to the cationic liposome. A positively charged peptide (RVG-9r [rabies virus glycoprotein]) is added to the complex, which specifically targets the liposome-siRNA-peptide complexes (LSPCs) across the blood brain barrier (BBB) to acetylcholine expressing neurons in the central nervous system (CNS). For the PALETS (peptide addressed liposome encapsulated therapeutic siRNA), the cationic and anionic lipids were rehydrated by the PrP siRNA. This procedure results in encapsulation of the siRNA within the cationic or anionic liposomes. Again, the RVG-9r neuropeptide was bound to the liposomes to target the siRNA/liposome complexes to the CNS. Using these formulations, we have successfully delivered PrP siRNA to AchR-expressing neurons, and decreased the PrPC expression of neurons in the CNS.

The goal of this protocol is to use cationic/anionic liposomes with a neuro-targeting peptide as a CNS delivery system to enable siRNA to cross the BBB. The optimization of a delivery system for treatments, like siRNA, would allow for more treatment options for prion and other neurodegenerative diseases.

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes.  The ...

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene and cell therapies are highly promising alternative approaches for CVD treatment. However, the broad clinical application of gene therapy is greatly limited by the lack of suitable gene delivery systems. The development of appropriate gene delivery vectors can provide a solution to current challenges in cell therapy. In particular, existing drawbacks, such as limited efficiency and low cell retention in the injured organ, could be overcome by appropriate cell engineering (i.e., genetic) prior to transplantation. The presented protocol describes the efficient and safe transient modification of endothelial cells using a polyethyleneimine superparamagnetic magnetic nanoparticle (PEI/MNP)-based delivery vector. Also, the algorithm and methods for cell characterization are defined. The successful intracellular delivery of microRNA (miR) into human umbilical vein endothelial cells (HUVECs) has been achieved without affecting cell viability, functionality, or intercellular communication. Moreover, this approach was proven to cause a strong functional effect in introduced exogenous miR. Importantly, the application of this MNP-based vector ensures cell magnetization, with accompanying possibilities of magnetic targeting and non-invasive MRI tracing. This may provide a basis for magnetically guided, genetically engineered cell therapeutics that can be monitored non-invasively with MRI.

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

This manuscript describes the efficient, non-viral delivery of miR to endothelial cells by a PEI/MNP vector and their magnetization. Thus, in addition to genetic modification, this approach allows for magnetic cell guidance and MRI detectability. The technique can be used to improve the characteristics of therapeutic cell products.

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Medicine

Polyethyleneimine-coated Iron Oxide Nanoparticles as a Vehicle for the Delivery of Small Interfering RNA to Macrophages In Vitro and In Vivo

Because of their critical role in regulating immune responses, macrophages have continuously been the subject of intensive research and represent a promising therapeutic target in many disorders, such as autoimmune diseases, atherosclerosis, and cancer. RNAi-mediated gene silencing is a valuable approach of choice to probe and manipulate macrophage function; however, the transfection of macrophages with siRNA is often considered to be technically challenging, and, at present, few methodologies dedicated to the siRNA transfer to macrophages are available. Here, we present a protocol of using polyethyleneimine-coated superparamagnetic iron oxide nanoparticles (PEI-SPIONs) as a vehicle for the targeted delivery of siRNA to macrophages. PEI-SPIONs are capable of binding and completely condensing siRNA when the Fe:siRNA weight ratio reaches 4 and above. In vitro, these nanoparticles can efficiently deliver siRNA into primary macrophages, as well as into the macrophage-like RAW 264.7 cell line, without compromising cell viability at the optimal dose for transfection, and, ultimately, they induce siRNA-mediated target gene silencing. Apart from being used for in vitro siRNA transfection, PEI-SPIONs are also a promising tool for delivering siRNA to macrophages in vivo. In view of its combined features of magnetic property and gene-silencing ability, systemically administered PEI-SPION/siRNA particles are expected not only to modulate macrophage function but also to enable macrophages to be imaged and tracked. In essence, PEI-SPIONs represent a simple, safe, and effective nonviral platform for siRNA delivery to macrophages both in vitro and in vivo.

Polyethyleneimine-coated Iron Oxide Nanoparticles as a Vehicle for the Delivery of Small Interfering RNA to Macrophages In Vitro and In Vivo

We describe a method of using polyethyleneimine (PEI)-coated superparamagnetic iron oxide nanoparticles for transfecting macrophages with siRNA. These nanoparticles can efficiently deliver siRNA to macrophages in vitro and in vivo and silence target gene expression.

Because of their critical role in regulating immune responses, macrophages have continuously been the subject of intensive research and represent a ...

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell populations.&#160;These cultures contain the cells of interest, but are also contaminated with undifferentiated ESCs, non-neural derivatives and other neuronal subtypes.&#160; This limits their use in in vitro and in vivo applications, such as in vitro modeling for drug discovery or cell replacement therapy. To help overcome this, reporter cell lines, which offer a means to visualize, track and isolate cells of interest, can be engineered.&#160;However, to achieve this in human embryonic stem cells via conventional homologous recombination is extremely inefficient.&#160;This protocol describes targeting of the Pituitary homeobox 3 (PITX3) locus in human embryonic stem cells using custom designed zinc-finger nucleases, which introduce site-specific double-strand DNA breaks, together with a PITX3-EGFP-specific DNA donor vector. Following the generation of the PITX3 reporter cell line, it can then be differentiated using published protocols for use in studies such as in vitro Parkinson&#8217;s disease modeling or cell replacement therapy.

Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations.&#160;However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Samenvatting

Meer video's verkennen