VirWaTest was a research project funded by the HIF (Humanitarian Innovation Funds) program of ELHRA (Enhancing Learning &#38; Research for Humanitarian Assistance). The authors acknowledge the WASH teams who kindly collaborated in this study. The analysis of samples in Ecuador was funded by Oxfam Ecuador and Direcci&#243;n de Investigaciones de la Universidad de las Americas (AMB.BRT.17.01). S. Bofill-Mas is a Serra-Hunter fellow at the University of Barcelona.

1. Preparation and packaging
NOTE: The materials/equipment to be packed is listed in Table 1. Use gloves to handle the reagents required for the process control, the concentration reagents, the nucleic acid extraction reagents&#160;and the&#160;detection reagents. Wear protective glasses to handle the reagents required for nucleic acid extraction.
<ol>
	<li>Process control
	<ol>
		<li>Prepare MS2 bacteriophage stock culture (American Type Culture Collection [ATCC] 15597-B1) containing 1 x 1010 PFU/mL in the laboratory by following the ISO procedure 10705-1:199514.</li>
		<li>Then, aliquot 10 &#181;L of the suspension per tube containing 1 x 108 PFU into 10 mL tubes and let the water evaporate at 37 &#176;C. Use one tube per water sample.</li>
		<li>Additionally, prepare one tube containing 10 mL of sterile distilled water per collected sample.</li>
	</ol>
	</li>
	<li>Concentration reagents
	<ol>
		<li>For the preflocculated skimmed milk solution (PSM), use the following amounts to concentrate five 10 L water samples.
		<ol>
			<li>Prepare a plastic tube containing 5 g of skimmed milk.</li>
			<li>Prepare a zipper plastic bag containing 16.66 g of sea salts.</li>
			<li>Prepare a plastic bottle containing 500 mL of distilled water.</li>
		</ol>
		</li>
		<li>Prepare the reagents required for pH adjustment. Use the following amounts to adjust the pH of the PSM and of five 10 L water samples.
		<ol>
			<li>Add 5 g of citric acid 1-hydrate to a 10 mL plastic tube. 
			CAUTION: Citric acid causes serious irritation when it comes in contact with eyes. If this occurs, rinse the eye cautiously with water for several minutes. If irritation persists, seek medical advice.</li>
			<li>Put 2 g of sodium hydroxide into a 10 mL plastic tube. 
			CAUTION: Sodium hydroxide can cause severe skin burns and eye damage. If swallowed, rinse the mouth. Do not induce vomiting. If it comes in contact with the eyes, rinse cautiously with water for several minutes. Then, seek medical advice.</li>
			<li>Put 25 mL of sterile distilled water into a plastic container.</li>
			<li>Put 50 mL of sterile distilled water into a plastic container.</li>
		</ol>
		</li>
		<li>Prepare the sample conditioning sachet used for the flocculation, the preservative solution used to preserve the nucleic acids, and the neutralizing sachet to neutralize the discarded water and materials. Use the following amounts for each 10 L water sample to be tested.
		<ol>
			<li>Put 15 g of sea salts and 8 g of citric acid 1-hydrate into a zipper plastic bag for the conditioning sachet.</li>
			<li>Add 2 mL of lysis buffer (Table of Materials) and 0.3 mL of nucleic acid preserving agent (Table of Materials) to a 5 mL tube. 
			CAUTION: Lysis buffer contains guanidine thiocyanate and Triton X-100. Contact with acid liberates toxic gas, and it is harmful if swallowed, inhaled, or comes in contact with the skin. If swallowed, rinse the mouth. Do not induce vomiting. If it comes in contact with the skin, wash with plenty of water. Then, seek medical advice. Nucleic acid preserving agent causes skin and eye irritation and is harmful if swallowed. If it comes in contact with the skin or the eyes, rinse with abundant water for several minutes. In any case, especially if swallowed and feeling unwell, seek medical advice.</li>
			<li>Put 40 g of detergent powder into four zipper plastic bags. 
			CAUTION: Powder detergent causes eye irritation. If it comes in contact with the eyes, rinse with abundant water for several minutes. If irritation persists or if swallowed, seek medical advice.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Nucleic acid extraction reagents
	<ol>
		<li>Put 50 &#181;L of magnetic particles (Table of Materials) and 1 mL of ethanol 96% into a 5 mL tube which constitute the Binding Buffer. 
		CAUTION: The magnetic particles buffer contains sodium azide, which forms a toxic gas when it comes in contact with acids or heavy metal ions and is toxic if ingested or when it comes in contact with skin. If ingested or in contact with skin, rinse the mouth or the skin with abundant water and seek medical advice. Ethanol is a highly flammable liquid and vapor and causes serious eye irritation. Keep away from heat, hot surfaces, sparks, and any other ignition source. If it comes in contact with the skin or the eyes, rinse with abundant water. In case of ingestion of large amounts of water and/or if inhaled, go outside into the fresh air. In any case, seek medical advice.</li>
		<li>Add 500 &#181;L, 600 &#181;L, and 200 &#181;L of washing buffers 1, 2, and 3, respectively (Table of Materials), to three 2 mL tubes. 
		CAUTION: Washing buffers contain guanidinium thiocyanate and guanidinium chloride, which are harmful if inhaled or swallowed and irritate the skin and eyes. Contact with acids releases very toxic gas. If they come in contact with the skin or eyes, rinse with abundant water. If swallowed, rinse the mouth with abundant water. Do not induce vomiting. Always seek medical advice.</li>
		<li>Add 120 &#181;L of elution buffer (Table of Materials) to a 0.5 mL tube.</li>
	</ol>
	</li>
	<li>HAdV and MS2 detection reagents 
	NOTE: Two different nucleic acid extraction reactions may be analyzed simultaneously in each PCR assay if an 8-well thermocycler is used. For all PCR assays, prepare molecular biology water aliquoted into 1.5 mL tubes.
	<ol>
		<li>HAdV detection
		<ol>
			<li>Prepare a mix containing 10 &#181;L of 22.5 &#181;M AdF forward primer, 10 &#181;L of 22.5 &#181;M AdR reverse primer, and 5 &#181;L of 11.25 &#181;M AdP probe (Table 2).</li>
			<li>Add 2.5 &#181;L of the mix to tubes 1 to 8 of a tube strip. Let it dry at room temperature, close the tubes, and keep them protected from the light.</li>
			<li>Cut the strip dividing it into two strips: tubes 1-5 and tubes 6-8.</li>
			<li>Prepare a serial dilution of DNA suspensions containing the nucleotide sequence of the amplified HAdV region. Air-dry 1 &#181;L of suspensions containing 1 x 105, 1 x 107, and 1 x 109 GC/mL into tubes 6-8. 
			NOTE: Keep the tubes containing the primers, probe, and the air-dried suspensions protected from light.</li>
		</ol>
		</li>
		<li>MS2 detection
		<ol>
			<li>Prepare a mix containing 10 &#181;L of 25 &#181;M pecson-2F forward primer, 10 &#181;L of 25 &#181;M pecson-2R reverse primer, and 2.5 &#181;L of 25 &#181;M PecP-2 probe (Table 2).</li>
			<li>Add 2.25 &#181;L of the mix to tubes 1 to 8 of a tube strip. Let it dry at room temperature, close the tubes, and keep them protected from the light.</li>
			<li>Cut the strip dividing it into two strips: tubes 1-5 and tubes 6-8.</li>
			<li>Proceed as in step 1.4.1.4 but use a standard suspension designed for MS2 instead.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Viral concentration
NOTE: Use gloves at all times during the sample collection, reagent preparation, flocculation, flocs collection, and waste disposal procedures. Wear protective glasses during the reagent preparation procedure.
<ol>
	<li>Sample collection
	<ol>
		<li>Collect a 10 L water sample in a flat bottom bucket with a lid. Collect a minimum of two replicates for each sample. 
		NOTE: It is important to use clear buckets to visualize the pellet. If the water sample contains suspended material (e.g., sand, algae), let it sediment and, then, collect the water supernatant in a new bucket.</li>
		<li>Register the collected volume, as well as the location and collection date, for each water sample.</li>
		<li>Put a magnetic stirrer connected to a battery under a bucket support and place the bucket containing the water sample on its support. 
		NOTE: Look for a flat surface in a fresh place and keep the buckets containing the water samples from direct sunlight.</li>
	</ol>
	</li>
	<li>Reagents preparation
	<ol>
		<li>pH adjustment reagents
		<ol>
			<li>Pour the citric acid powder and the sodium hydroxide pellets into the pots containing 25 and 50 mL of distilled water, respectively.</li>
			<li>Gently shake by hand until the citric acid and the sodium hydroxide are completely dissolved. 
			CAUTION: Do not pour the water over the sodium hydroxide pellets. Instead, pour the sodium hydroxide pellets over the water.</li>
		</ol>
		</li>
		<li>Preflocculated skimmed milk
		<ol>
			<li>Place a stand-up bag on a magnetic stirrer and pour 500 mL of distilled water in it. Drop a stirring magnet inside the bag and turn on the magnetic stirrer.</li>
			<li>Pour the contents of a sea salt sachet and of a skimmed milk tube into the stand-up bag and stir for 5 min at medium speed to dissolve them.</li>
			<li>Add 3 mL of citric acid to the PSM solution using a Pasteur pipette to make sure the pH lies between 3.4 and 3.6. Measure the pH of the PSM solution using pH indicator strips. Add smaller amounts of citric acid and sodium hydroxide as the pH gets closer to 3.5.</li>
			<li>Turn off the magnetic stirrer and make sure the flocs are visible. Use a flashlight to help to visualize the flocs.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Flocculation
	<ol>
		<li>Drop a stirring magnet into the water, set the magnetic stirrer at maximum speed, and turn it on. Make sure the stirring magnet starts spinning.</li>
		<li>Add 10 mL of distilled water to a process control tube. Invert the tube a few times to rehydrate the viral stock and pour the solution into the water.</li>
		<li>Pour the contents of one sample conditioning sachet into the water and stir for 5 min.</li>
		<li>Measure the pH of the water sample using pH indicator strips. Add a few drops of citric acid or sodium hydroxide to the water sample to make sure the pH lies between 3.4 and 3.6. Add smaller amounts of citric acid and sodium hydroxide as the pH gets closer to 3.5.</li>
		<li>Add 100 mL of the PSM solution using a 100 mL container.</li>
		<li>Seal the bucket with the lid, set the magnetic stirrer at minimum speed, and leave the water stirring for 8 h.</li>
		<li>Turn off the magnetic stirrer and let the water still for at least 5 h to allow the flocs to settle.</li>
	</ol>
	</li>
	<li>Floc&#160;collection
	<ol>
		<li>Build a siphoning system composed of a pipette controller, two pipettes, and a plastic tube, to aspirate the water supernatant for discharging the water on the flocs.
		<ol>
			<li>Attach a 10 mL tape-end pipette to the pipette controller. Then, attach the tip of the pipette to the plastic tube.</li>
			<li>Remove the filter of a 10 mL open-tip pipette using tweezers and attach the pipette to the plastic tube.</li>
		</ol>
		</li>
		<li>Place an empty bucket on the floor.</li>
		<li>Immerse the tip of the open-tip pipette in the water. Make sure to keep it close to the water surface to avoid disturbing the flocs. Aspirate the water supernatant until it reaches the tape-end pipette.</li>
		<li>Pinch the plastic tube by the end attached to the tape-end pipette and detach it from the pipette.</li>
		<li>Place the tube in an empty bucket. Release the pressure on the tube to let the water flow into the empty bucket.</li>
		<li>Pinch the plastic tube to stop the water flow when the water level is about to reach the stirring magnet and move the pipette away from the bucket.</li>
		<li>Shake the bucket to resuspend the flocs and pour them into a 500 mL stand-up plastic bag. Allow the flocs to settle for 1 h more.</li>
		<li>Carefully aspirate the water supernatant using a 50 mL pipette and a manual pipette controller, avoiding disturbing the flocs.</li>
		<li>Aspirate the flocs using a 100 mL pipette and transfer them to a 50 mL graduated centrifuge tube. Note down the final volume of sample concentrate and transfer 1 mL of it to a 5 mL tube containing the preservative solution, using a Pasteur pipette. 
		NOTE: It is important that the centrifuge tube is graduated so the final volume of the concentrated sample can be measured as accurately as possible and registered.</li>
		<li>Perform the nucleic acid extraction in the field. Alternatively, store the preservative solution containing the viruses at 20-30 &#176;C for up to 15 days or ship them to a reference laboratory for further analysis.</li>
	</ol>
	</li>
	<li>Waste disposal and material reuse
	<ol>
		<li>Add the contents of a neutralizing agent sachet to the bucket containing the discarded water. Mix the water, and then, leave it still for 30 min.</li>
		<li>Dispose of the treated water as general waste.</li>
		<li>Place the pipettes and the plastic tube inside the bucket. Fill the bucket with water and pour in the contents of one neutralizing agent sachet.</li>
		<li>Wash them for at least 30 min to sterilize them and rinse them with abundant clean water to remove any remaining neutralizing agent.</li>
	</ol>
	</li>
</ol>
3. Nucleic acid extraction
NOTE: Use gloves and always wear protective glasses during the nucleic acid extraction procedure.
<ol>
	<li>Magnetic pipette operation
	<ol>
		<li>Get familiarized with the operation of the magnetic pipette before performing the extraction.</li>
	</ol>
	</li>
	<li>Nucleic acid extraction
	<ol>
		<li>Arrange the tubes containing the reagents required for the extraction in a rack, from left to right: binding buffer, washing buffers, and elution buffer. Set the appropriate number of tubes according to the number of samples or replicates being analyzed.</li>
		<li>Transfer 1 mL of sample concentrate to the tube containing the binding buffer, using a disposable Pasteur pipette. Invert the tube 8x to 10x to homogenize the solution.</li>
		<li>Incubate the solution at room temperature for 10 min while continuously mixing, either using a solar-powered orbital or manually.</li>
		<li>Collect the magnetic particles using the magnetic pipette and a clean tip, which can be reused for the three washing buffers.</li>
		<li>Release the magnetic particles into the tube containing 500 &#181;L of washing buffer 1. Wash them by gently shaking the solution with the tip for 30 s and collect them.</li>
		<li>Transfer the magnetic particles to the tube containing 600 &#181;L of washing buffer 2. Wash them by gently shaking the solution with the tip for 30 s and collect them.</li>
		<li>Transfer the magnetic particles to the tube containing 200 &#181;L of washing buffer 3. Wash them by gently shaking the solution with the tip for 30 s and collect them.</li>
		<li>Release the magnetic particles into the tube containing the elution buffer and discard the tip.</li>
		<li>Incubate the solution at room temperature for 5 min while continuously mixing, using the solar-powered orbital. 
		NOTE: Mixing the magnetic particles in the elution buffer is a crucial step. In case of lacking an orbital, continuously mix by hand during the incubation time.</li>
		<li>Replace the tip on the magnetic pipette by a new one and collect the magnetic particles from the elution buffer. Make sure to completely remove the magnetic particles from the elution buffer since they can interfere with molecular detection methods.</li>
		<li>Discard the tip with the particles attached to it. Proceed with the PCR analysis, ship the elution buffer to a reference laboratory, or store the elution buffer in at 4 &#730;C for further analysis.</li>
	</ol>
	</li>
</ol>
4. Viral detection with a battery-operated eight-tube real-time thermocycler
NOTE: Use gloves and always wear protective glasses during the nucleic acid detection procedure. Replace the gloves for new ones when performing a new PCR experiment to avoid cross-contamination.
<ol>
	<li>HAdV quantitative PCR
	<ol>
		<li>Add 14 &#181;L of nuclease-free water to tubes 2, 4, and 5.</li>
		<li>Add 4 &#181;L of PCR mix to tubes 1-5.</li>
		<li>Add 14 &#181;L of nucleic acid extraction from sample A to tube 1 and 14 &#181;L from sample B to tube 3.</li>
		<li>Add 2 &#181;L of extracted nucleic acids from sample A to tube 2 and 2 &#181;L from sample B to tube 4. Close the five-tube strip.</li>
		<li>Add 14 &#181;L of nuclease-free water to tubes 6, 7, and 8.</li>
		<li>Add 4 &#181;L of this mix to tubes 6, 7, and 8, and close them.</li>
		<li>Put both strips in the thermocycler and select the appropriate run (Table 3).</li>
		<li>Discard the water tube and keep the extracted nucleic acid in the freezer, if possible, or, if not, in a fresh place protected from light in case a second test needs to be performed.</li>
		<li>Clean the micropipettes, the rack, the working material, and all material properly with a nucleic acid cleaner, and discard the plastic bag containing the used tip, gloves, and tubes. 
		CAUTION: Nucleic acid remover is a very flammable liquid and steam. Do not breathe in the spray mist and avoid any contact of the liquid with the eyes or the skin. Otherwise, immediately rinse with abundant water and seek medical advice.</li>
		<li>Collect the results and analyze the obtained data.</li>
	</ol>
	</li>
	<li>MS2 quantitative PCR
	<ol>
		<li>Add 14 &#181;L of nuclease-free water to tubes 2, 4, and 5.</li>
		<li>Add 4 &#181;L of PCR mix and 0.5 &#181;L of reverse transcriptase enzyme to tubes 1-5.</li>
		<li>Add 14 &#181;L of nucleic acid extraction from sample A to tube 1 and 14 &#181;L from sample B to tube 3.</li>
		<li>Add 1 &#181;L of extracted nucleic acids from sample A to tube 2 and 1 &#181;L from sample B to tube 4. Close the five-tube strip.</li>
		<li>Add 15.5 &#181;L of nuclease-free water to tubes 5, 6, 7, and 8, and close them.</li>
		<li>Add 4 &#181;L of PCR mix and 0.5 &#181;L of reverse transcriptase enzyme to tubes 6, 7, and 8.</li>
		<li>Put both strips in the thermocycler and select the appropriate run (Table 3).</li>
		<li>Proceed as described in steps 4.1.8 to 4.1.10.</li>
	</ol>
	</li>
</ol>

<ol><li>The Sphere Project. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22The+Sphere+Project%3A+Humanitarian+Charter+and+Minimum+Standards+in+Humanitarian+Response%22">The Sphere Project: Humanitarian Charter and Minimum Standards in Humanitarian Response</a>. , Practical Action Publishing. Rugby, UK. https://www.spherestandards.org/wp-content/uploads/2018/06/Sphere_Handbook_2011_English.pdf (2011).</li>
<li>Bartram, J., et al. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aBartram%2C+J+%22Water+Safety+Plan+Manual%3AStep-by-step+risk+management+for+drinking-water+suppliers%22">Water Safety Plan Manual:Step-by-step risk management for drinking-water suppliers</a>. , WHO Press. Geneva, Switzerland. http://apps.who.int/iris/handle/10665/75141 (2009).</li>
<li>World Health Organization. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22Guidelines+for+Drinking-water+Quality%22">Guidelines for Drinking-water Quality</a>. , WHO Press. Geneva, Switzerland. http://whqlibdoc.who.int/publications/2011/9789241548151_eng.pdf?ua=1 (2011).</li>
<li>World Health Organization. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%2225+Years+Progress+on+Sanitation+and+Drinking+Water%22">25 Years Progress on Sanitation and Drinking Water</a>. , WHO Press. Geneva, Switzerland. http://apps.who.int/iris/bitstream/10665/177752/1/9789241509145_eng.pdf?ua=1 (2015).</li>
<li>Girones, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+detection+of+pathogens+in+water+-+The+pros+and+cons+of+molecular+techniques%5BTitle%5D)+AND+%22Water+Research%22%5BJournal%5D)">Molecular detection of pathogens in water - The pros and cons of molecular techniques.</a> Water Research. 44 (15), 4325-4339 (2010).</li>
<li>Rodriguez-Manzano, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Standard+and+new+fecal+indicators+and+pathogens+in+sewage+treatment+plants%2C+microbiological+parameters+for+improving+the+control+of+reclaimed+water%5BTitle%5D)+AND+%22Water+Science+and+Technology%22%5BJournal%5D)">Standard and new fecal indicators and pathogens in sewage treatment plants, microbiological parameters for improving the control of reclaimed water.</a> Water Science and Technology. 66 (12), 2517-2523 (2012).</li>
<li>Puig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+adenoviruses+and+enteroviruses+in+polluted+waters+by+nested+PCR+amplification%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Detection of adenoviruses and enteroviruses in polluted waters by nested PCR amplification.</a> Applied and Environmental Microbiology. 60 (8), 2963-2970 (1994).</li>
<li>Carter, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enterically+infecting+viruses%3A+Pathogenicity%2C+transmission+and+significance+for+food+and+waterborne+infection%5BTitle%5D)+AND+%22Journal+of+Applied+Microbiology%22%5BJournal%5D)">Enterically infecting viruses: Pathogenicity, transmission and significance for food and waterborne infection.</a> Journal of Applied Microbiology. 98 (6), 1354-1380 (2005).</li>
<li>Bofill-Mas, S., Pina, S., Girones, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Documenting+the+epidemiologic+patterns+of+polyomaviruses+in+human+populations+by+studying+their+presence+in+urban+sewage%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Documenting the epidemiologic patterns of polyomaviruses in human populations by studying their presence in urban sewage.</a> Applied and Environmental Microbiology. 66 (1), 238-245 (2000).</li>
<li>Bofill-Mas, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantification+and+stability+of+human+adenoviruses+and+polyomavirus+JCPyV+in+wastewater+matrices%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Quantification and stability of human adenoviruses and polyomavirus JCPyV in wastewater matrices.</a> Applied and Environmental Microbiology. 72 (12), 7894-7896 (2006).</li>
<li>Rames, E., Roiko, A., Stratton, H., Macdonald, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Technical+aspects+of+using+human+adenovirus+as+a+viral+water+quality+indicator%5BTitle%5D)+AND+%22Water+Research%22%5BJournal%5D)">Technical aspects of using human adenovirus as a viral water quality indicator.</a> Water Research. 96, 308-326 (2016).</li>
<li>Calgua, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+and+application+of+a+one-step+low+cost+procedure+to+concentrate+viruses+from+seawater+samples%5BTitle%5D)+AND+%22Journal+of+Virological+Methods%22%5BJournal%5D)">Development and application of a one-step low cost procedure to concentrate viruses from seawater samples.</a> Journal of Virological Methods. 153 (2), 79-83 (2008).</li>
<li>Bofill-Mas, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cost-effective+method+for+microbial+source+tracking+using+specific+human+and+animal+viruses%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Cost-effective method for microbial source tracking using specific human and animal viruses.</a> Journal of Visualized Experiments. 58, 5-9 (2011).</li>
<li>International Organization for Standardization. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22ISO+10705-1%3A1995%3A+Water+quality+-+Detection+and+enumeration+of+bacteriophages+-+Part+1%3A+Enumeration+of+F-specific+RNA+bacteriophages%22">ISO 10705-1:1995: Water quality - Detection and enumeration of bacteriophages - Part 1: Enumeration of F-specific RNA bacteriophages</a>. , https://www.iso.org/standard/18794.html (1995).</li>
<li>Hernroth, B. E., Conden-Hansson, A. C., Rehnstam-Holm, A. S., Girones, R., Allard, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Environmental+factors+influencing+human+viral+pathogens+and+their+potential+indicator+organisms+in+the+blue+mussel%2C+Mytilus+edulis%3A+the+first+Scandinavian+report%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: the first Scandinavian report.</a> Applied and Environmental Microbiology. 68 (9), 4523-4533 (2002).</li>
<li>Pecson, B. M., Martin, L. V., Kohn, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+PCR+for+determining+the+infectivity+of+bacteriophage+MS2+upon+inactivation+by+heat%2C+UV-B+radiation%2C+and+singlet+oxygen%3A+Advantages+and+limitations+of+an+enzymatic+treatment+to+reduce+false-positive+results%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Quantitative PCR for determining the infectivity of bacteriophage MS2 upon inactivation by heat, UV-B radiation, and singlet oxygen: Advantages and limitations of an enzymatic treatment to reduce false-positive results.</a> Applied and Environmental Microbiology. 75 (17), 5544-5554 (2009).</li>
<li>Calgua, B., Barardi, C. R. M., Bofill-Mas, S., Rodriguez-Manzano, J., Girones, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+and+quantitation+of+infectious+human+adenoviruses+and+JC+polyomaviruses+in+water+by+immunofluorescence+assay%5BTitle%5D)+AND+%22Journal+of+Virological+Methods%22%5BJournal%5D)">Detection and quantitation of infectious human adenoviruses and JC polyomaviruses in water by immunofluorescence assay.</a> Journal of Virological Methods. 171 (1), 1-7 (2011).</li>
<li>Bofill-Mas, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cost-effective+method+for+microbial+source+tracking+using+specific+human+and+animal+viruses%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Cost-effective method for microbial source tracking using specific human and animal viruses.</a> Journal of Visualized Experiments. (58), e2820(2011).</li>
<li>Gonzales-Gustavson, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+the+efficiency+and+uncertainty+of+skimmed+milk+flocculation+for+the+simultaneous+concentration+and+quantification+of+water-borne+viruses%2C+bacteria+and+protozoa%5BTitle%5D)+AND+%22Journal+of+Microbiological+Methods%22%5BJournal%5D)">Characterization of the efficiency and uncertainty of skimmed milk flocculation for the simultaneous concentration and quantification of water-borne viruses, bacteria and protozoa.</a> Journal of Microbiological Methods. 134, 46-53 (2017).</li>
</ol>

The authors have nothing to disclose.

The VirWaTest method enables the concentration of viruses and nucleic acid extraction from water samples at the point of use by non-experienced users. It is an affordable, rapid, and simple protocol. The concentration is based on the principle of organic flocculation using skimmed milk, by which the low pH and high conductivity conditions make skimmed milk proteins aggregate into flocs the viruses adsorb to. When the flocs sediment, it is easy to collect them, making it possible to concentrate 10 L of water, whereas traditional ultracentrifugation cannot deal with big water volumes.
The method has been modified for being practicable at the point of sampling without using any electric equipment except for a battery-operated magnetic stirrer. Some other approaches based on water filtration have been adapted to the concentration of viruses and can also be performed at the point of use. However, suspended material present in water samples often clogs the filters; thus, the small volume that may be concentrated with these systems is a serious limitation.
This is the first description of a method for concentrating viruses from water samples at the point of use, regardless of the turbidity of the sample. The VirWaTest concentration method allows several samples to be processed simultaneously if the appropriate material is available. Moreover, skimmed milk flocculation has been shown to be useful for bacteria and parasite concentration19.
The preparation of the appropriate material is crucial for performing the procedure properly. Consider the number of water samples to be analysed and prepare the reagents and material before moving to the place where the test is needed&#160;for the preparation of the reagents and material. Several samples can be processed at the same time if the appropriate amount of material is available.
Before starting the concentration of a water sample, a known concentration of a viral stock will be used to spike the sample as process control. This method uses a dried viral stock which is rehydrated with distilled water before being added to the water sample at the point of use. This is useful to rule out false-negative results at the end of the procedure and gives an indication of the performance of the method.
Viral concentrates obtained with the VirWaTest may be further tested in the field applying the VirWaTest nucleic acid extraction and detection methods or, alternatively, concentrates may be sent to a reference laboratory at room temperature. The preservative solution added to the concentrate enables viruses to remain stable for up to 2 weeks (unpublished results).
VirWaTest nucleic acid extraction is a magnetic particle-based method. It is easy and fast and allows several samples to be processed at the same time and shows equivalent and even better recovery efficiency than methods currently used for viral nucleic acid extractions. The nucleic acids may be sent to reference labs at room temperature or, if users are confident in performing molecular detection, a quantitative PCR assay can be performed at the point of use of the original water sample.
Also, if a small laboratory facility is available, the VirWaTest concentration protocol may be coupled to standard nucleic acid extraction kits that depend on a centrifuge and standard PCR-based methods that require a freezer to maintain the reagents but that use standard thermocyclers, which are less expensive than battery-operated ones.
However, since a power supply is sometimes not available, we have optimized detection assays for MS2 bacteriophages as process control and HAdV as a viral fecal indicator, and the methodology can be customized for any other virus of interest, such as hepatitis viruses, RoV, NoV, or others, to be run in the field without needing a freezer for maintenance of the reagents, nor conventional thermocyclers but only a battery-operated one. Several battery-operated thermocyclers are commercially available. Alternatively, if a power supply is available, other conventional qPCR equipment may be used. If an eight-tube thermocycler is used, up to two nucleic acid extractions (two different samples or two replicates from the same sample) can be tested in the same PCR assay. For each nucleic acid extraction, two different quantities will be tested to rule out enzymatic inhibition originated by the sample. The adaptation is based on the previous preparation of PCR tubes by air-drying primers, probes, and standard suspensions. Several lyophilized commercial qPCR solutions exist that could be used by applying the same procedure as described here. We have described one possibility that we considered to be easy to perform.
Comparison assays performed during the development of the method showed that the VirWaTest methods of concentration, extraction, and detection are efficient for the quantification of viruses in water samples.
The limit of detection (LOD) of the described procedure is variable since the volume collected after concentration is variable. Also, the LOD can be slightly different for different viruses. If a volume of approximately 10 L is collected, the LOD for HAdV would be around 1 x 102 viral GC/L. So, relatively small concentrations of HAdV can be detected by the VirWaTest method. In Pedernales (Ecuador), six out of the six samples tested presented HAdV, in concentrations close to the LOD, ranging from 3.27 x 101 to 1.80 x 102 GC/L. In Banghi (RCA), HAdV were detected in one out of the five samples analyzed, at a concentration of 3.46 x 102 GC/L. The presence of HAdV, as well as the presence of MS2 as the control process in the tested samples, shows the method is useful for the recovery of viral particles from water samples, even when performed by nonexperienced users.
Feedback obtained until now indicates that viral concentration is an easy procedure to perform, with no major problems when applied at the point of use of the samples, although 8 h and 5 h steps are required. It is important to note that these steps occur without any human assistance. Moreover, a faster method based on filtration is being developed as an alternative for nonturbid waters. However, flocculation seems to be, until now, the unique method that allows the concentration of samples presenting high turbidity. Viral concentrates may be then sent to any laboratory around the world at room temperature, which also makes it easier to test viruses since sampling areas do not always have good transportation services providing cooling conditions. Alternatively, the extraction and detection protocols presented here allow testing for viral detection at the point of use of the samples.
As far as we know, this is the first method reported to be useful for the concentration and testing for the presence of viruses in water samples in the field. Further efforts should be conducted to apply the procedure to the evaluation of the presence of human viral pathogens of interest in several other humanitarian crisis scenarios. Also, the user&#39;s feedback will be necessary to provide insights into the potential implementation to make the procedure friendlier.

During the first phases of any humanitarian emergency, access to clean water supplies, sanitation, and hygiene are critical for the survival of those affected. Therefore, monitoring water quality is a priority to prevent waterborne outbreaks. It is well-known that contaminated water is frequently the origin of diseases, but it is often difficult to determine the sources of viral outbreaks such as Hepatitis E virus (HEV), even with the availability of conventional laboratory methods. The control of water quality is based on the quantification of FIB1,2,3,4. However, it has been extensively documented that there is no correlation between the absence of FIB and the presence of viral waterborne pathogens such as rotavirus (RoV), norovirus (NoV), or HEV5,6. Thus, using the water quality criteria based on FIB might result in an underestimation of risks associated with the presence of waterborne viral pathogens. The surveillance of indicator viruses, such as human adenoviruses (HAdV), or specific pathogens would be helpful in defining the exposure to viral pathogens and identifying the potential source of human infection7,8,9,10 and in validating the efficacy of sanitation measures11.
Until now, the detection of viruses in these scenarios relied on skilled staff and complex logistics. VirWaTest (virwatest.org) is aimed at the development of a simple, affordable, and portable method for the concentration and subsequent detection of viruses from water samples at the point of use.
The virus concentration is based on the principle of organic flocculation of 10 L water samples, by which viruses are recovered in smaller volumes12,13. The flocs are collected and added to a buffer that lyses the viruses and prevents the nucleic acids from degradation when they stored at room temperature for not more than 2 weeks.
The nucleic acid extraction method is based on the use of magnetic particles to which the nucleic acids get adsorbed. They can be transferred from one washing buffer to another and finally into the elution buffer by using a magnetic pipette to which the particles attach. Viral nucleic acid suspensions obtained can be shipped to a reference laboratory where the detection can be performed using molecular methods based on PCR. For each nucleic acid extraction, two different quantities are tested to rule out enzymatic inhibition originated by the sample. Alternatively, with minimum equipment availability, PCR tests can be run at the point of use. The entire process is designed to be performed independently of a power supply (Figure 1).
A quantitative PCR assay to detect HAdV, excreted by humans and found in wastewater samples in high concentrations, has been adapted to be run at the point of use. HAdV are used as human fecal viral indicators. A PCR for the quantification of MS2 bacteriophage has been also adapted since MS2 is used in VirWaTest as process control. The method can be customized for the detection of any virus of interest.
After development, the VirWaTest method has been applied by the users in two different settings in the Republic of Central Africa (RCA) and Ecuador, providing feedback on the application of the protocol in real situations.
To our knowledge, this is the first procedure that allows the concentration and detection of viruses at the point of use, independent of any power supply, large equipment, and freezing/cooling conditions. It is recommended to collect two replicates of each water sample in order to obtain robust results.

<table><tbody><tr><td>5x HOT FIREPol Probe qPCR Mix Plus (ROX)</td><td>Solis BioDyne</td><td>08-14-00001</td><td>Includes Solis Biodyne&#039;s 5x HOT FIREPol Probe qPCR Mix Plus (qPCR Mix), 50 Reactions</td></tr><tr><td>8-Microtube Strips with Caps</td><td>dD Biolab</td><td>840637</td><td>Low Profile, Thin Walls, Adapted for Quantitative and Qualitative PCR</td></tr><tr><td>Batteries and Power Adapters for Magnetic Stirrer</td><td>GenIUL</td><td>900011674</td><td>Includes 12V car power adapter</td></tr><tr><td>Bucket Support</td><td>GenIUL</td><td>900011648</td><td>Aluminium support</td></tr><tr><td>Bucket, 10 L</td><td>Cater4You</td><td>10LTR</td><td>Polypropilene, Tamperproof, Clear color</td></tr><tr><td>Centrifuge Tube, 50 mL</td><td>LabBox</td><td>CTSP-E50-050</td><td>Polypropylene, Sterile, Graduated, With Skirt</td></tr><tr><td>Citric Acid 1-Hydrate, 500 g</td><td>PanReac AppliChem</td><td>1410181211</td><td>Pure, Pharma Grade, 1 Kilogram</td></tr><tr><td>Clear PET Bottle</td><td>LabBox</td><td>FPET-500-088</td><td>Clear Color, PET, Cap Not Included</td></tr><tr><td>Difco Skim Milk, 500 g</td><td>Becton Dickinson</td><td>232100</td><td>Dehydrated</td></tr><tr><td>DNA/RNA Shield, 250 mL</td><td>Zymo Research</td><td>R1100-250</td><td>DNA/RNA Preservation Medium, 250 mL</td></tr><tr><td>Easy9 Pipette Controller</td><td>LabBox</td><td>EAS9-001-001</td><td>0.3 &amp;mu;m filter, Pipettes from 0.1 to 100 mL, Autoclavable silicone pipette holder</td></tr><tr><td>Eppendorf Tube, 0.5 mL</td><td>Eppendorf</td><td>0030121023</td><td>Polypropilene, Safe-Lock</td></tr><tr><td>Eppendorf Tube, 2 mL</td><td>Eppendorf</td><td>0030120094</td><td>Polypropilene, Safe-Lock</td></tr><tr><td>Eppendorf Tube, 5 mL</td><td>dD Biolab</td><td>999542</td><td>Polypropylene, Sterile, Graduated</td></tr><tr><td>Ethanol 96% V/V, 1 L</td><td>Panreac AppliChem</td><td>361085-1611</td><td>For UV, IR&amp;nbsp; and HPLC</td></tr><tr><td>Laboratory Tweezers</td><td>LabBox</td><td>FORS-007-002</td><td>Thin, Curved End, L= 120 mm</td></tr><tr><td>Magnetic Stirrer</td><td>GenIUL</td><td>900017000</td><td>Battery-powered</td></tr><tr><td>Marker</td><td>dD Biolab</td><td>929203</td><td>Black, Extra fine Tip, Water Resistant, Fast Drying, For Plastic and Glassware</td></tr><tr><td>Micro Rota-Rack for Microtubes</td><td>dD Biolab</td><td>37782</td><td>4 Modules, L x W x H= 208 x 100 x 100 mm</td></tr><tr><td>Mini8 Real-Time PCR Cycler</td><td>Coyote Biosciences, China</td><td>Mini-8</td><td>Portable, Works with 12V Power Supplies or External Batteries, Two channels, Capacity for 8 Tubes</td></tr><tr><td>NucliSens Lysis Buffer</td><td>Biomerieux</td><td>200292</td><td>Reagents for up to 48 Isolations, Store at Ambient Temperature</td></tr><tr><td>Open Tip Serological Pipette, 10 mL</td><td>Deltalab</td><td>900136N</td><td>Sterile, Individually Wrapped (Paper/Plastic)</td></tr><tr><td>PE Screw Cap PP28</td><td>LabBox</td><td>TP28-004-020</td><td>For PET Bottles</td></tr><tr><td>pH Indicator Strip</td><td>LabBox</td><td>WSPH-001-001</td><td>Range pH 2.8 to pH 4.4, 50 Strips per Pack</td></tr><tr><td>Plastic Test Tube</td><td>Quimikals</td><td>300913</td><td>Includes Cap</td></tr><tr><td>Polyethylene Pasteur Pipette</td><td>LabBox</td><td>PIPP-003-500</td><td>Graduated, 7 mL Overall Volume, Non-Sterile</td></tr><tr><td>Polypropylene Screw Flask With Screw Cap, 150 mL</td><td>Deltalab</td><td>409726</td><td>Screw cap, Sterile, graduated up to 100 mL</td></tr><tr><td>Polypropylene Screw Flask With Screw Cap, 60 mL</td><td>Deltalab</td><td>409526G</td><td>Screw cap, Sterile, Graduated up to 50 mL</td></tr><tr><td>Powder Powder Detergent</td><td>-</td><td>-</td><td>Regular Powder Soap for washing clothes</td></tr><tr><td>Power Cables for Magnetic Stirrer</td><td>GenIUL</td><td>900011692</td><td>Connection between batteries and magnetic stirrers</td></tr><tr><td>QuickPick Magnetic Tool</td><td>BioNobile</td><td>24001</td><td>Hand-held tool for magnetic particles</td></tr><tr><td>QuickPick Tips in Box</td><td>BioNobile</td><td>24296</td><td>RNase-Free, Autoclaved, 96 Units</td></tr><tr><td>QuickPick XL gDNA Magnetic Particles</td><td>BioNobile</td><td>SN51100</td><td>3.2 mL</td></tr><tr><td>Sea Salts</td><td>Sigma-Aldrich</td><td>S9883-500G</td><td>An artificial salt mixture closely resembling the composition of the dissolved salts of ocean water</td></tr><tr><td>Silicone Tubing</td><td>LabBox</td><td>SILT-006-005</td><td>Roll of 5 Meters, Inner&amp;nbsp; &amp;oslash; x Outer&amp;nbsp; &amp;oslash;= 6 x 10 mm</td></tr><tr><td>Sodium Hydroxide Pellets, 98.5 - 100.5%</td><td>VWR Chemicals</td><td>28244295</td><td>Pellets, 1 Kg</td></tr><tr><td>Solar Rotary Platform</td><td>SOL-EXPERT Group</td><td>70020</td><td>Acrylic Plate, 10 RPM, Supports up to 300 Grams</td></tr><tr><td>SOLIScript 1-step Probe Kit</td><td>Solis BioDyne</td><td>08-57-00250</td><td>Includes Solis Biodyne&#039;s 5x One-Step Probe Mix (qPCR Mix) and 40x One-Step SOLIScript Mix (Reverse Transcriptase Enzyme), 250 Reactions</td></tr><tr><td>SPEEDTOOLS RNA Virus Extraction Kit</td><td>BioTools</td><td>21.141-4197</td><td>Includes BioTools&#039;s BAW Buffer (Washing Buffer 1), BAV3 Buffer (Washing Buffer 2 and 3) and BRE Buffer (Elution Buffer).</td></tr><tr><td>SpinBar Octhaedral Stirring Magnet</td><td>dD Biolab</td><td>045926</td><td>Pivot Ring, L x&amp;nbsp; &amp;oslash; = 38 x 8 mm, Blue</td></tr><tr><td>Tape-End Serological Pipette, 10 mL</td><td>Deltalab</td><td>PN10E1</td><td>Sterile, Individually Wrapped (Paper/Plastic)</td></tr><tr><td>Tape-End Serological Pipette, 50 mL</td><td>Deltalab</td><td>900043</td><td>Sterile, Individually Wrapped (Paper/Plastic)</td></tr><tr><td>Termi-DNA-Tor - Nucleic Acid Remover</td><td>BioTools</td><td>22001-4291</td><td>Remover of nucleic acids, bacteria, fungi and mycoplasma from material and surfaces, 450 mL</td></tr><tr><td>Water Molecular Biology Reagent, 1L</td><td>Sigma-Aldrich</td><td>W4502-1L</td><td>Nuclease and Protease Free, 0.1 &amp;mu;m Filtered</td></tr><tr><td>Whirl-Pak Bag, 540 mL</td><td>Deltalab</td><td>200361</td><td>Stable bottom</td></tr><tr><td>Zip Lock Plain Bag</td><td>LabBox</td><td>BZIP-080-100</td><td>Polyethylene, L x W= 120 x 80 mm</td></tr></tbody></table>

virwatest, a point-of-use method for the detection of viruses in water samples

Viruses excreted by humans and animals may contaminate water sources and pose a risk to human health when this water is used for drinking, food irrigation, washing, etc. The classical fecal bacteria indicator does not always check for the presence of viral pathogens so the detection of viral pathogens and viral indicators is relevant in order to adopt measures of risk mitigation, especially in humanitarian scenarios and in areas where water-borne viral outbreaks are frequent.
At present, several commercial tests allowing the quantification of fecal indicator bacteria (FIB) are available for testing at the point of use. However, such commercial tests are not available for the detection of viruses. The detection of viruses in environmental water samples requires concentrating several liters into smaller volumes. Moreover, once concentrated, the detection of viruses relies on methods such as nucleic acid extraction and molecular detection (e.g., polymerase chain reaction [PCR]-based assays) of the viral genomes.
The method described here allows the concentration of viruses from 10 L water samples, as well as the extraction of viral nucleic acids at the point of use, with simple and portable equipment. This allows the testing of water samples at the point of use for several viruses and is useful in humanitarian scenarios, as well as at any context where an equipped laboratory is not available. Alternatively, the method allows concentrating viruses present in water samples and the shipping of the concentrate to a laboratory at room temperature for further analysis.

Method development 
This procedure has been developed in the Laboratory of Viruses Contaminants of Water and Food with the collaboration of GenIUL and Oxfam Interm&#243;n. It comprises of three different steps. The first one, the viral particle concentration, is an adaptation of a skimmed milk flocculation method previously described12,17,18. The original method was modified as to be independent of a power supply, simpler, and without centrifugation steps.
The recovery of the VirWaTest concentration method was tested in HAdV and MS2 bacteriophage-spiked groundwater samples. The viral recovery of the VirWaTest concentration and extraction method was estimated to be 3.01% to 18.02% for MS2 and 17.52% to 44.22% for HAdV. These recoveries were calculated from the values obtained by quantitative PCR during the development of the method compared to the initial concentrations of HAdV and MS2 in the water samples after spiking them with known concentrations of these viral stocks.
The VirWaTest magnetic nucleic acid extraction was compared to a commercial RNA mini kit (e.g., QIAamp Viral RNA Mini Kit), a column-based extraction method used in the laboratory, by testing 33 river and groundwater samples spiked with HAdV and MS2 and concentrated by skimmed milk flocculation. The comparison results showed that the VirWaTest method recovery was higher in 23/33 cases for HAdV, as well as for MS2 (Table 4). A Wilcoxon test showed p-values of 0.0005569 for HAdV and 0.02791 for MS2. VirWaTest nucleic acid extraction provides significantly higher viral recoveries than the commercial one.
Detection of HAdV in environmental water samples concentrated by the VirWaTest method
To test the developed method for viral concentration in the field, the Oxfam Water, Sanitation and Hygiene (WASH) team, located in Banghi (RCA) in March 2017, collected and concentrated viruses from five well water samples.
Also, in the area of Pedernales (Ecuador), which was affected by earthquakes in 2016 and 2017, six well water samples were collected by an Oxfam WASH team in February 2017, and its viruses were concentrated by the VirWaTest concentration method. Viral concentrates from both settings were sent to the laboratory in Barcelona for VirWaTest nucleic acid extraction and viral quantification.
In Ecuador, naturally occurring HAdV were detected in six out of the six samples analyzed, with concentration values ranging from 3.27 x 101 to 1.80 x 102 GC/L, whereas one out of the five samples collected and concentrated in Banghi (RCA) tested positive for HAdV, at a concentration of 3.46 x 102 GC/L (Table 5).
MS2, added to all tested samples as internal process control, was detected in all samples tested, showing that the method was correctly performed from concentration to detection.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59463/59463fig1.jpg" /> 
Figure 1: VirWaTest method. Overview of the steps the VirWaTest method is composed of. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59463/59463fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Materials</td>
			<td>Concentration</td>
			<td>Nucleic Acid Extraction</td>
			<td>Detection</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td>Magnetic Stirrer (2 Units) 
			Battery (2 Units) 
			Battery/Stirrer Connectors (2 Units) 
			Power Adapters (2 Units) 
			Bucket Support (2 Units) 
			Rope (1 Unit) 
			Stirring Magnet (3 Units) 
			Tweezers (1 Unit) 
			Silicon Tubing (1 Unit) 
			Pipette Controller (1 Unit) 
			Marker (1 Unit)</td>
			<td>Magnetic Pipette (1 Unit) 
			Solar Rotary Platform (1 Unit) 
			Multi-Size Tube Rack (1 Unit) 
			Timer (1 Unit)</td>
			<td>Thermocycler (1 Unit) 
			Battery (1 Unit) 
			Computer 
			Tube Rack (1 Unit) 
			0.5 &#956;L - 10 &#956;L Micropipette (1 Unit) 
			2 &#956;L - 20 &#956;L Micropipette (1 Unit)</td>
		</tr>
		<tr>
			<td>Consumables and Reagents (for every 2 water samples/replicates)</td>
			<td>Bucket (3 Units) 
			pH Indicator Strips 
			Tape-End 10 mL Pipette (2 Units) 
			Open-Tip 10 mL Pipette (2 Units) 
			Tape-End 50 mL Pipette (2 Units) 
			Tape-End 100 mL Pipette (2 Units) 
			Pasteur Pipette (4 Units) 
			Stand-Up Plastic Bag (4 Units) 
			Plastic Container with 25 mL of distilled water (1 Unit) 
			Plastic Container with 50 mL of distilled water (1 Unit) 
			100 mL Empty Container (1 Unit) 
			Gloves (6 Pairs) 
			Process Control (2 Tubes) 
			Tube with 10 mL of distilled water (2 Units) 
			Citric Acid (1 Tube) 
			Sodium Hydroxide (1 Tube) 
			Skimmed Milk (1 Tube)&#160; 
			Citric Acid Sachet (1 Unit) 
			Distilled Water (1 500 mL Bottle) 
			Sample Conditioning (2 Sachets) 
			Preservative Solution (2 Tubes) 
			Neutralizing Agent (4 Sachets)</td>
			<td>Magnetic Pipette Tips (2 Units) 
			Pasteur Pipette (2 Units) 
			Binding Buffer (2 Tubes) 
			Washing Buffer 1 (2 Tubes) 
			Washing Buffer 2 (2 Tubes) 
			Washing Buffer 3 (2 Tubes) 
			Elution Buffer (2 Tubes) 
			Gloves (6 Pairs)</td>
			<td>10 &#956;L Micropipette Tips (1 box) 
			20 &#956;L Micropipette Tips (1 box) 
			DNA qPCR Mix (1 Tube) 
			RNA qPCR Mix (1 Tube) 
			Reverse Transcriptase Enzyme (1 Tube) 
			Molecular Biology Water (1 Tube) 
			HAdV Tube Strip with primers, probe and standard (1 Unit) 
			MS2 Tube Strip with primers, probe and standard (1 Unit) 
			Nucleic Acid Remover 
			Gloves (6 Pairs)</td>
		</tr>
	</tbody>
</table>
Table 1: VirWaTest contents. Equipment, consumables, and reagents that have to be prepared for the concentration, extraction, and detection of viruses in two water samples/replicates.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Virus</td>
			<td>Primers</td>
			<td>Genbank Accession No.</td>
			<td>Position</td>
			<td colspan="3">Sequence (5&#8217;&#8210;3&#8217;)</td>
			<td>Length</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td rowspan="3">Human Adenovirus (HAdV)</td>
			<td>AdF</td>
			<td rowspan="3">J01917.1</td>
			<td>18869&#8210;18887</td>
			<td colspan="3">CWTACATGCACATCKCSGG</td>
			<td>19</td>
			<td rowspan="3">Hernroth et al., 200215</td>
		</tr>
		<tr>
			<td>AdR</td>
			<td>18919&#8210;18937</td>
			<td colspan="3">CRCGGGCRAAYTGCACCAG</td>
			<td>19</td>
		</tr>
		<tr>
			<td>AdP1</td>
			<td>18890&#8210;18916</td>
			<td colspan="3">6-FAM-CCGGGCTCAGGTACTCCGAGGCGTCCT-BMN-Q535</td>
			<td>27</td>
		</tr>
		<tr>
			<td rowspan="3">MS2 Bacteriophage (MS2)&#160;</td>
			<td>pecson-2F</td>
			<td rowspan="3">NC_001417.2</td>
			<td>344&#8210;363</td>
			<td colspan="3">AAGGTGCCTACAAGCGAAGT</td>
			<td>20</td>
			<td rowspan="3">Pecson et al., 200916</td>
		</tr>
		<tr>
			<td>pecson-2R</td>
			<td>659&#8210;678</td>
			<td colspan="3">TTCGTTTAGGGCAAGGTAGC</td>
			<td>20</td>
		</tr>
		<tr>
			<td>PecP-2</td>
			<td>369&#8210;388</td>
			<td colspan="3">6-FAM-ATCGTGGGGTCGCCCGTACG-BHQ-1</td>
			<td>20</td>
		</tr>
	</tbody>
</table>
Table 2: Oligonucleotides for quantitative PCR experiments. Primers and probe designed to bind to nucleic acid sequences of HAdV and MS2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td rowspan="2">95 &#176;C</td>
			<td rowspan="2">12 min</td>
			<td rowspan="2">1</td>
			<td>55 &#176;C</td>
			<td>15 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>15 s</td>
			<td rowspan="2">40</td>
			<td>95 &#176;C</td>
			<td>15 s</td>
			<td rowspan="2">40</td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>1 min</td>
			<td>60 &#176;C</td>
			<td>1 min</td>
		</tr>
	</tbody>
</table>
Table 3: Thermal conditions for quantitative PCR experiments. Temperature, time, and cycles used for HAdV and MS2 amplification.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>QIAgen</td>
			<td>VirWaTest</td>
			<td rowspan="4"></td>
			<td>QIAgen</td>
			<td>VirWaTest</td>
		</tr>
		<tr>
			<td>Median</td>
			<td>2.53 x 103</td>
			<td>2.43 x 103</td>
			<td>4.74 x 104</td>
			<td>5.13 x 104</td>
		</tr>
		<tr>
			<td>Mean</td>
			<td>1.74 x 104</td>
			<td>3.12 x 104</td>
			<td>4.24 x 104</td>
			<td>5.97 x 104</td>
		</tr>
		<tr>
			<td>SD</td>
			<td>5.66 x 105</td>
			<td>2.23 x 106</td>
			<td>4.49 x 104</td>
			<td>1.63 x 105</td>
		</tr>
		<tr>
			<td rowspan="2"></td>
			<td colspan="5">p-value (Wilcoxon) for HAdV: 0.0005569</td>
		</tr>
		<tr>
			<td colspan="5">p-value (Wilcoxon) for MS2: 0.02791</td>
		</tr>
		<tr>
			<td>Virus tested&#160;</td>
			<td>Samples Tested&#160;</td>
			<td>QIAgen&#160;</td>
			<td>VirWa Test</td>
			<td colspan="2" rowspan="3"></td>
		</tr>
		<tr>
			<td>HAdv</td>
			<td>33</td>
			<td>10</td>
			<td>23</td>
		</tr>
		<tr>
			<td>MS2</td>
			<td>33</td>
			<td>10</td>
			<td>23</td>
		</tr>
	</tbody>
</table>
Table 4: VirWaTest nucleic acid extraction development. Median, mean, and SD values obtained when comparing the Qiagen and VirWaTest extraction methods in 33 groundwater samples for HAdV and MS2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Country</td>
			<td>Site</td>
			<td>Sample</td>
			<td>HAdV GC/L</td>
		</tr>
		<tr>
			<td rowspan="5">RCA</td>
			<td>Eau de la SODECA</td>
			<td>1</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Ile Bongossoua, Village 1</td>
			<td>2</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Ile Bongossoua, Village 3</td>
			<td>3</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Bangui, Puits Quartier Fondo</td>
			<td>4</td>
			<td>ND</td>
		</tr>
		<tr>
			<td>Bangui, Puits Quartier Yambassa</td>
			<td>5</td>
			<td>3.64 x 102</td>
		</tr>
		<tr>
			<td rowspan="6">Ecuador</td>
			<td>Borehole A</td>
			<td>6</td>
			<td>7.96 x 101</td>
		</tr>
		<tr>
			<td>Borehole B</td>
			<td>7</td>
			<td>1.80 x 102</td>
		</tr>
		<tr>
			<td>Borehole C</td>
			<td>8</td>
			<td>8.88 x 101</td>
		</tr>
		<tr>
			<td>Well water A</td>
			<td>9</td>
			<td>6.06 x 101</td>
		</tr>
		<tr>
			<td>Well water B</td>
			<td>10</td>
			<td>1.12 x 102</td>
		</tr>
		<tr>
			<td>Well water C</td>
			<td>11</td>
			<td>3.27 x 101</td>
		</tr>
	</tbody>
</table>
Table 5: Quantification of HAdV using the VirWaTest Method. Quantitative PCR results, expressed in GC/liter, for HAdV quantified in water samples collected and concentrated from RCA and Ecuador.

Watch this Scientific Journal Video about VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples at JoVE.com

VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples

Here we present VirWaTest, which is a simple, affordable and portable method for the concentration and detection of viruses from water samples at the point of use.

Viruses excreted by humans and animals may contaminate water sources and pose a risk to human health when this water is used for drinking, food ...

virwatest-point-use-method-for-detection-viruses-water

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.5K Views.  University of Barcelona. Enterische virussen zijn meestal te vinden in verschillende aquatische reservoirs, waaronder grondwater, stilstaand water, beken, rivieren en r water. Ze worden geassocieerd met gezondheidsrisico's en zijn verantwoordelijk voor infecties bij de mens. Enterische virussen veroorzaken vaak gastro-enteritis en worden meestal overgedragen via de fecaale-orale route.Andere door water overgedragen ziekten veroorzaken acute hepatitis door hepatitis A-virus en hepatitis E-virussen, met aanzienl...

Video: VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples

A Small Volume Procedure for Viral Concentration from Water

Small-scale concentration of viruses (sample volumes 1-10 L, here simulated with spiked 100 ml water samples) is an efficient, cost-effective way to identify optimal parameters for virus concentration. Viruses can be concentrated from water using filtration (electropositive, electronegative, glass wool or size exclusion), followed by secondary concentration with beef extract to release viruses from filter surfaces, and finally tertiary concentration resulting in a 5-30 ml volume virus concentrate. In order to identify optimal concentration procedures, two different electropositive filters were evaluated (a glass/cellulose filter [1MDS] and a nano-alumina/glass filter [NanoCeram]), as well as different secondary concentration techniques; the celite technique where three different celite particle sizes were evaluated (fine, medium and large) followed by comparing this technique with that of the established organic flocculation method. Various elution additives were also evaluated for their ability to enhance the release of adenovirus (AdV) particles from filter surfaces. Fine particle celite recovered similar levels of AdV40 and 41 to that of the established organic flocculation method when viral spikes were added during secondary concentration. The glass/cellulose filter recovered higher levels of both, AdV40 and 41, compared to that of a nano-alumina/glass fiber filter. Although not statistically significant, the addition of 0.1% sodium polyphosphate amended beef extract eluant recovered 10% more AdV particles compared to unamended beef extract.

An approach was developed for identifying optimal viral concentration conditions for small volume water samples using spikes of human adenovirus. The techniques described here are used to identify concentration parameters for other viral targets, and applied to large-scale viral concentration experimentation.

Small-scale concentration of viruses (sample volumes 1-10 L, here simulated with spiked 100 ml water samples) is an efficient, cost-effective way to ...

Environment

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. I. Collection of Virus Samples

EPA Method 1615 was developed with a goal of providing a standard method for measuring enteroviruses and noroviruses in environmental and drinking waters. The standardized sampling component of the method concentrates viruses that may be present in water by passage of a minimum specified volume of water through an electropositive cartridge filter. The minimum specified volumes for surface and finished/ground water are 300 L and 1,500 L, respectively. A major method limitation is the tendency for the filters to clog before meeting the sample volume requirement. Studies using two different, but equivalent, cartridge filter options showed that filter clogging was a problem with 10% of the samples with one of the filter types compared to 6% with the other filter type. Clogging tends to increase with turbidity, but cannot be predicted based on turbidity measurements only. From a cost standpoint one of the filter options is preferable over the other, but the water quality and experience with the water system to be sampled should be taken into consideration in making filter selections.

EPA Method 1615 uses an electropositive filter to concentrate enteroviruses and noroviruses in environmental and drinking waters. This manuscript describes the procedure for collecting samples for Method 1615 analyses.

EPA Method 1615 was developed with a goal of providing a standard method for measuring enteroviruses and noroviruses in environmental and drinking waters. ...

Estimating Virus Production Rates in Aquatic Systems

Viruses are pervasive components of marine and freshwater systems, and are known to be significant agents of microbial mortality. Developing quantitative estimates of this process is critical as we can then develop better models of microbial community structure and function as well as advance our understanding of how viruses work to alter aquatic biogeochemical cycles. The virus reduction technique allows researchers to estimate the rate at which virus particles are released from the endemic microbial community. In brief, the abundance of free (extracellular) viruses is reduced in a sample while the microbial community is maintained at near ambient concentration. The microbial community is then incubated in the absence of free viruses and the rate at which viruses reoccur in the sample (through the lysis of already infected members of the community) can be quantified by epifluorescence microscopy or, in the case of specific viruses, quantitative PCR. These rates can then be used to estimate the rate of microbial mortality due to virus-mediated cell lysis.

The turnover rate of viruses in marine and freshwater systems can be estimated by a reduction and reoccurrence technique. The data allow researchers to infer rates of virus-mediated microbial mortality in aquatic systems.

Viruses are pervasive components of marine and freshwater systems, and are known to be significant agents of microbial mortality. Developing quantitative ...

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. II. Total Culturable Virus Assay

A standardized method is required when national studies on virus occurrence in environmental and drinking waters utilize multiple analytical laboratories. The U.S Environmental Protection Agency&#8217;s (USEPA) Method 1615 was developed with the goal of providing such a standard for measuring Enterovirus and Norovirus in these waters. Virus is concentrated from water using an electropositive filter, eluted from the filter surface with beef extract, and then concentrated further using organic flocculation. Herein we present the protocol from Method 1615 for filter elution, secondary concentration, and measurement of total culturable viruses. A portion of the concentrated eluate from each sample is inoculated onto ten replicate flasks of Buffalo Green Monkey kidney cells. The number of flasks demonstrating cytopathic effects is used to quantify the most probable number (MPN) of infectious units per liter. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. Laboratories must meet defined performance standards. Method 1615 was evaluated by examining virus recovery from reagent-grade and ground waters seeded with Sabin poliovirus type 3. Mean poliovirus recoveries with the total culturable assay were 111% in reagent grade water and 58% in groundwaters.

Here we present a procedure to measure total culturable viruses using the Buffalo Green Monkey kidney cell line. The procedure provides a standardized tool for measuring the occurrence of infectious viruses in environmental and drinking waters.

A standardized method is required when national studies on virus occurrence in environmental and drinking waters utilize multiple analytical laboratories. ...

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Glass Wool Filters for Concentrating Waterborne Viruses and Agricultural Zoonotic Pathogens

The key first step in evaluating pathogen levels in suspected contaminated water is concentration. Concentration methods tend to be specific for a particular pathogen group, for example US Environmental Protection Agency Method 1623 for Giardia and Cryptosporidium1, which means multiple methods are required if the sampling program is targeting more than one pathogen group. Another drawback of current methods is the equipment can be complicated and expensive, for example the VIRADEL method with the 1MDS cartridge filter for concentrating viruses2. In this article we describe how to construct glass wool filters for concentrating waterborne pathogens. After filter elution, the concentrate is amenable to a second concentration step, such as centrifugation, followed by pathogen detection and enumeration by cultural or molecular methods. The filters have several advantages. Construction is easy and the filters can be built to any size for meeting specific sampling requirements. The filter parts are inexpensive, making it possible to collect a large number of samples without severely impacting a project budget. Large sample volumes (100s to 1,000s L) can be concentrated depending on the rate of clogging from sample turbidity. The filters are highly portable and with minimal equipment, such as a pump and flow meter, they can be implemented in the field for sampling finished drinking water, surface water, groundwater, and agricultural runoff. Lastly, glass wool filtration is effective for concentrating a variety of pathogen types so only one method is necessary. Here we report on filter effectiveness in concentrating waterborne human enterovirus, Salmonella enterica, Cryptosporidium parvum, and avian influenza virus.

Glass wool filters have been used to concentrate waterborne viruses by a number of research groups around the world. Here we show a simple approach for constructing glass wool filters and demonstrate the filters are also effective in concentrating waterborne viral, bacterial and protozoan pathogens.

The key first step in evaluating pathogen levels in suspected contaminated water is concentration.  Concentration methods tend to be specific for a ...

Detection of Viruses from Bioaerosols Using Anion Exchange Resin

This protocol demonstrates a customized bioaerosol sampling method for viruses. In this system, anion exchange resin is coupled with liquid impingement-based air sampling devices for efficacious concentration of negatively-charged viruses from bioaerosols. Thus, the resin serves as an additional concentration step in the bioaerosol sampling workflow. Nucleic acid extraction of the viral particles is then performed directly from the anion exchange resin, with the resulting sample suitable for molecular analyses. Further, this protocol describes a custom-built bioaerosol chamber capable of generating virus-laden bioaerosols under a variety of environmental conditions and allowing for continuous monitoring of environmental variables such as temperature, humidity, wind speed, and aerosol mass concentration. The main advantage of using this protocol is increased sensitivity of viral detection, as assessed via direct comparison to an unmodified conventional liquid impinger. Other advantages include the potential to concentrate diverse negatively-charged viruses, the low cost of anion exchange resin (~$0.14 per sample), and ease of use. Disadvantages include the inability of this protocol to assess infectivity of resin-adsorbed viral particles, and potentially the need for the optimization of the liquid sampling buffer used within the impinger.

An anion exchange resin-based method, adapted to liquid impingement-based bioaerosol sampling of viruses is demonstrated. When coupled with downstream molecular detection, the method allows for facile and sensitive detection of viruses from bioaerosols.

This protocol demonstrates a customized bioaerosol sampling method for viruses. In this system, anion exchange resin is coupled with liquid ...

Concentration of Virus Particles from Environmental Water and Wastewater Samples Using Skimmed Milk Flocculation and Ultrafiltration

Water and wastewater-based epidemiology have emerged as alternative methods to monitor and predict the course of outbreaks in communities.&#160;The recovery of microbial fractions, including viruses, bacteria, and microeukaryotes from wastewater and environmental water samples&#160;is one of the challenging steps in these approaches. In this study, we focused on the recovery efficiency of sequential ultrafiltration and skimmed milk flocculation (SMF) methods using Armored RNA as a test virus, which is also used as a control by some other studies. Prefiltration with 0.45 &#181;m and 0.2 &#181;m membrane disc filters were applied to eliminate solid particles before ultrafiltration to prevent the clogging of ultrafiltration devices. Test samples, processed with the sequential ultrafiltration method, were centrifuged at two different speeds. An increased speed resulted in lower recovery and positivity rates of Armored RNA.&#160;On the other hand, SMF resulted in relatively consistent recovery and positivity rates of Armored RNA. Additional tests conducted with environmental water samples demonstrated the utility of SMF to concentrate other microbial fractions. The partitioning of viruses into solid particles might have an impact on the overall recovery rates, considering the prefiltration step applied before the ultrafiltration of wastewater samples. SMF with prefiltration performed better when applied to environmental water samples&#160;due to lower solid concentrations in the samples and thus lower partitioning rates to solids. In the present study, the idea of using a sequential ultrafiltration method arose from the necessity to decrease the final volume of the viral concentrates during the COVID-19 pandemic, when the supply of the commonly used ultrafiltration devices was limited, and there was a need for the development of alternative viral concentration methods.

Virus concentration from environmental water and wastewater samples is a challenging task, carried out primarily for the identification and quantification of viruses. While several virus concentration methods have been developed and tested, we demonstrate here the effectiveness of ultrafiltration and skimmed milk flocculation for RNA viruses with different sample types.

Water and wastewater-based epidemiology have emerged as alternative methods to monitor and predict the course of outbreaks in communities.&#160;The ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

VirWaTest, A Point-of-Use Method for the Detection of Viruses in Water Samples

Samenvatting

Meer video's verkennen