This work was supported by the Maureen and Ronald Hirsch family philanthropic contribution and Field Neurosciences Institute, St. Mary&#39;s of Michigan. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We also thank Dr. Bernadette Zwaans and Elijah Ward for their critical review of the manuscript.

All methods described here have been approved by the Institutional Review Board (IRB) of Beaumont Health. All experiments were performed in accordance with relevant guidelines and regulations.
CAUTION: All potentially infectious materials should be handled according to Biosafety Level 2 standards including the use of personal protective equipment. Any procedures which may produce aerosol should be performed in a biosafety cabinet. Additionally, work with live mosquitoes should be performed in the appropriate Arthropod Containment Level 1-3 facility. Given the association of ZIKV infection with congenital abnormalities, women who are pregnant, trying to conceive, or the partners of these women should significantly minimize their laboratory exposure to ZIKV. Transport of ZIKV samples is classified in the United States as Category B Biological Substances in accordance with Department of Transportation Hazardous Materials Regulations (49 CFR Part 171-180) and therefore shipping samples should adhere to those guidelines. Import into the United States of ZIKV biospecimens requires a Centers for Disease Control and Prevention (CDC) Import Permit. Import of any arthropods that could serve as a vector for ZIKV transmission, even if they are not infected, requires a United States Department of Agriculture (USDA) permit. This information is current at the time of publication. Up-to-date recommendations can be found at https://www.cdc.gov/zika/laboratories/lab-safety.html.
NOTE: RT-LAMP reactions are prone to higher rates of false positive reactions, so precautions should be taken in experimental planning. All set-up and execution of RT-LAMP reactions should use designated pipettes and filter tips. Ideally, a lateral work flow should be established. If possible, analysis and imaging (Section 5) should occur in a separate enclosed room to prevent contamination. Opening of test tubes containing RT-LAMP products should be kept to a minimum.
1. RT-LAMP Primer Preparation
<ol>
	<li>Reconstitute each lyophilized RT-LAMP primer in molecular grade water to a final concentration of 100 &#181;M (Table 1). Briefly vortex the primer solution to ensure a homogenous solution and briefly spin down the solution at maximum speed in a table top centrifuge to collect all primer solution.</li>
	<li>Prepare a 10x RT-LAMP Primer Mix of the FIP, BIP, F3, B3, LF, and LB primers using the volumes in Table 2. Briefly vortex the primer solution to ensure a homogenous solution, and briefly spin down the solution at maximum speed in a table top centrifuge to avoid any loss. 
	NOTE: The RT-LAMP primer set for Ae. aegypti actin (AEDAE) does not contain a LB primer (loop primers are not always necessary for RT-LAMP reactions). In this case, replace the LB primer volume with molecular grade water.</li>
	<li>Store the primers at -20 &#176;C between uses and avoid free-thaw cycles.</li>
</ol>
2. Sample Preparation
<ol>
	<li>For human urine samples: Use either fresh urine, frozen urine, or urine in preservative. For fresh or frozen sample: immediately spin down the sample after the collection for 10 min at 700 x g, and use the supernatant for analysis or freeze at -80 &#176;C for future use. Thaw frozen samples on ice before use.</li>
	<li>For human serum samples: Use either fresh or frozen serum samples.</li>
	<li>For ZIKV infected cell lines: Use either conditioned media or cell lysates. 
	NOTE: Cell-free conditioned media from Ae. albopictus C6/36 cells 8 days post-infection can be used as positive controls for ZIKV RT-LAMP reactions.</li>
	<li>For Ae. aegypti mosquitoes: Use either whole fresh or frozen mosquito carcasses. Thaw frozen mosquitoes on ice. Prepare a crude mosquito lysate by placing an individual mosquito in 100 &#181;L of phosphate-buffered saline (PBS) and homogenize by crushing the mosquito 10 times with a P10 pipet tip (Figure 1). Briefly centrifuge the crude lysate to pellet any debris. Use the supernatant for downstream RT-LAMP analysis. 
	Note: Positive controls can be generated in a laboratory setting by infecting female mosquitoes using intrathoracic microinjection with approximately 103 genome equivalents of virus in a volume of 200 nL and harvesting the mosquito 5 days post-infection.</li>
</ol>
3. Prepare RT-LAMP Master Mix
<ol>
	<li>Prepare a RT-LAMP master mix reaction on ice for each primer set to be used by using volume guide in Table 3. 
	NOTE: The use of thermolabile Uracil DNA Glycosylase (UDG) assists in preventing false positives.</li>
	<li>Vortex briefly to ensure that all samples are well mixed, then spin down briefly to prevent volume loss.</li>
</ol>
4. RT-LAMP Assay
<ol>
	<li>Pipet 23.0 &#181;L of the RT-LAMP master mix per reaction into a 200 &#181;L PCR tube. Add 2.0 &#181;L of sample (urine, serum, or crude mosquito lysate supernatant as described in Step 2). This will bring the total volume to 25.0 &#181;L per RT-LAMP reaction. For the negative control, use molecular grade water. Include a positive control. 
	&#8203;NOTE: A PCR standard or virus stocks from supernatant of infected cell lines can be used as a positive control.
	<ol>
		<li>Optional: Include a specificity control reaction of a related arbovirus such as dengue virus (DENV). Prepare the sample as outlined in Step 2 according to sample type. Add 2.0 &#181;L of the specificity control to 23.0 &#181;L of the RT-LAMP master mix into a 200 &#181;L PCR tube.</li>
	</ol>
	</li>
	<li>Heat the samples at 61 &#176;C for 30 min using a heat block, water bath, or thermocycler.</li>
	<li>Heat deactivate the polymerase by heating to 80 &#176;C for 10 min.</li>
</ol>
5. RT-LAMP Analysis
NOTE: Perform RT-LAMP analysis in a separate, enclosed space.
<ol>
	<li>After the incubation, access RT-LAMP reactions visually by looking for the presence of a color change.
	<ol>
		<li>Dilute the fluorescent nucleic acid dye 1:10 in TAE (40 mM Tris, 20 mM acetic acid, 1 mM EDTA) buffer. 
		CAUTION: Any nucleic acid stain binds to nucleic acids and therefore is a carcinogen. Wear gloves when handling.</li>
		<li>To 12 &#181;L of the RT-LAMP reaction, add 2 &#181;L of fluorescent nucleic acid dye dilution. 
		NOTE: Negative reactions will be orange in color and positive reactions will be yellow/green in color.</li>
		<li>Optional: Take pictures of RT-LAMP reactions on a white background using a camera.</li>
	</ol>
	</li>
	<li>Place the samples under 302 nm UV light to confirm the presence of RT-LAMP products by fluorescence. Take picture of the result using a camera. 
	NOTE: Positive RT-LAMP reactions will have a fluorescent output. 
	CAUTION: Wear UV protective eye googles or face shield when working with UV light.</li>
	<li>Optional: Confirm the presence of RT-LAMP products by performing gel electrophoresis on the samples.
	<ol>
		<li>Pour a 2% agarose gel in 1x TAE buffer with a nucleic acid stain for visualization. 
		CAUTION: Any nucleic acid stain binds to nucleic acids and therefore is a carcinogen. Wear gloves when handling.</li>
		<li>Add 5 &#181;L of a DNA ladder in the first lane to compare the molecular weights.</li>
		<li>For each RT-LAMP reaction, mix 13 &#181;L of RT-LAMP reaction mixture with 2 &#181;L of DNA loading dye. Load the 15 &#181;L mixture containing the DNA loading dye.</li>
		<li>Run the gel at 90 V for 90 min or until the bands are separated and image with 302 nm UV light. 
		NOTE: Positive RT-LAMP reactions will have a laddering pattern. Negative RT-LAMP reactions should not contain any bands.</li>
	</ol>
	</li>
</ol>
6. Disposal
<ol>
	<li>Dispose of RT-LAMP reactions in double sealed bags. Do not autoclave as this may aerosolize the RT-LAMP products, leading to false positive reactions in the future.</li>
</ol>

<ol><li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="https://www.nejm.org/doi/full/10.1056/NEJMra1602113">Zika Virus.</a> New England Journal of Medicine. 374 (16), 1552-1563 (2016).</li>
<li>Francois, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Robustness+of+a+loop-mediated+isothermal+amplification+reaction+for+diagnostic+applications%5BTitle%5D)+AND+%22Federation+of+European+Microbiological+Societies+Immunology+and+Medical+Microbiology%22%5BJournal%5D)">Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications.</a> Federation of European Microbiological Societies Immunology and Medical Microbiology. 62 (1), 41-48 (2011).</li>
<li>Tomita, N., Mori, Y., Kanda, H., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Loop-mediated+isothermal+amplification+%28LAMP%29+of+gene+sequences+and+simple+visual+detection+of+products%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products.</a> Nature Protocols. 3 (5), 877-882 (2008).</li>
<li>Gandasegui, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Rapid-Heat+LAMPellet+Method%3A+A+Potential+Diagnostic+Method+for+Human+Urogenital+Schistosomiasis%5BTitle%5D)+AND+%22Public+Library+of+Science+Neglected+Tropical+Diseases%22%5BJournal%5D)">The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis.</a> Public Library of Science Neglected Tropical Diseases. 9 (7), 0003963(2015).</li>
<li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/25741643">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> The Journal of Visualized Experiments. (96), (2015).</li>
<li>Lamb, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+Detection+of+Zika+Virus+in+Urine+Samples+and+Infected+Mosquitos+by+Reverse+Transcription-Loop-Mediated+Isothermal+Amplification%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification.</a> Scientific Reports. 8 (1), 3803(2018).</li>
<li>Faye, O., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/18674965">One-step RT-PCR for detection of Zika virus.</a> Journal of Clinical Virology. 43 (1), 96-101 (2008).</li>
<li>Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PCR+inhibitors+-+occurrence%2C+properties+and+removal%5BTitle%5D)+AND+%22Journal+of+Applied+Microbiology%22%5BJournal%5D)">PCR inhibitors - occurrence, properties and removal.</a> Journal of Applied Microbiology. 113 (5), 1014-1026 (2012).</li>
<li>Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diagnosis+of+brugian+filariasis+by+loop-mediated+isothermal+amplification%5BTitle%5D)+AND+%22Public+Library+of+Science+Neglected+Tropical+Diseases%22%5BJournal%5D)">Diagnosis of brugian filariasis by loop-mediated isothermal amplification.</a> Public Library of Science Neglected Tropical Diseases. 6 (12), 1948(2012).</li>
<li>Tanner, N. A., Zhang, Y., Evans, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simultaneous+multiple+target+detection+in+real-time+loop-mediated+isothermal+amplification%5BTitle%5D)+AND+%22Biotechniques%22%5BJournal%5D)">Simultaneous multiple target detection in real-time loop-mediated isothermal amplification.</a> Biotechniques. 53 (2), 81-89 (2012).</li>
<li>Chan, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid%2C+Affordable+and+Portable+Medium-Throughput+Molecular+Device+for+Zika+Virus%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus.</a> Scientific Reports. 6, 38223(2016).</li>
<li>Lee, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simple+and+Highly+Sensitive+Molecular+Diagnosis+of+Zika+Virus+by+Lateral+Flow+Assays%5BTitle%5D)+AND+%22Analytical+Chemistry%22%5BJournal%5D)">Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays.</a> Analytical Chemistry. 88 (24), 12272-12278 (2016).</li>
<li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165 (5), 1255-1266 (2016).</li>
<li>Song, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Instrument-Free+Point-of-Care+Molecular+Detection+of+Zika+Virus%5BTitle%5D)+AND+%22Analytical+Chemistry%22%5BJournal%5D)">Instrument-Free Point-of-Care Molecular Detection of Zika Virus.</a> Analytical Chemistry. 88 (14), 7289-7294 (2016).</li>
<li>Yaren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Point+of+sampling+detection+of+Zika+virus+within+a+multiplexed+kit+capable+of+detecting+dengue+and+chikungunya%5BTitle%5D)+AND+%22BioMed+Central+Infectious+Diseases%22%5BJournal%5D)">Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya.</a> BioMed Central Infectious Diseases. 17 (1), 293(2017).</li>
<li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+and+sensitive+detection+of+Zika+virus+by+reverse+transcription+loop-mediated+isothermal+amplification%5BTitle%5D)+AND+%22Journal+of+Virological+Methods%22%5BJournal%5D)">Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification.</a> Journal of Virological Methods. 238, 86-93 (2016).</li>
<li>Priye, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+smartphone-based+diagnostic+platform+for+rapid+detection+of+Zika%2C+chikungunya%2C+and+dengue+viruses%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses.</a> Scientific Reports. 7, 44778(2017).</li>
</ol>

LEL and MBC have intellectual property on Zika virus diagnosis methods. The remaining authors have no competing interests.

The ZIKV RT-LAMP assay described in this paper works using both human and mosquito samples6. The limit of detection was approximately 1 genome equivalent6, which should be sufficient since the typical viral load of a symptomatic ZIKV infected patient is 103 to&#160;106 PFU/mL7. Additionally, this method can detect ZIKV in samples without first isolating RNA and without virus amplification in cell culture. This significantly decreases the time, cost, and health risks of this assay compared to qRT-PCR.
Urine samples used at the volume ratio indicated in this protocol should allow RT-LAMP reactions to occur without an RNA isolation. While one could theoretically increase the amount of sample used in an RT-LAMP reaction, care should be exercised when this sample is urine. Urine contains multiple chemicals that could inhibit PCR reactions; urea in the urine is known to degrade polymerases8 and using a urine/RT-LAMP reaction ratio that is too high will prevent the RT-LAMP reaction. If a low amount of virus is expected, it would be better to perform an RNA isolation using a kit specific for urine. Similarly, serum can contain PCR inhibitors that may inhibit RT-LAMP when serum is used at a higher volume8.
Included in this protocol is the inclusion of quality controls for RT-LAMP reactions, akin to a loading control in western blotting protocols. If a clinical sample is negative for the RT-LAMP quality control, then a negative reaction for the ZIKV RT-LAMP may be a false negative as the sample may contain a high amount of PCR inhibitors or low amounts of total RNA. It is not necessary to isolate RNA from the sample prior to the RT-LAMP assay. The representative RT-LAMP results in this protocol were obtained without RNA isolation. However, RNA isolation may improve the detection in samples with low virus load or that may contain high levels of PCR inhibitors. For most sample types including serum, an RNA isolation kit can be used following the manufacturer&#39;s suggested protocol. For urine samples, an RNA isolation kit specific for urine samples should be used. For mosquito samples, it is recommended to lyse the mosquito by running the mosquito in 100 &#181;L of PBS through a shredding column for 2 min at maximum speed or douncing before RNA isolation. RNA can be eluted in 30 &#181;L of elution buffer and stored at -80 &#176;C until use.
RNA isolation is then suggested to remove the endogenous PCR inhibitors or concentrate the RNA prior to RT-LAMP. If the RT-LAMP quality control is still negative, then qRT-PCR should be used for ZIKV detection.
The RT-LAMP primers in this protocol have been confirmed to work at a range of temperatures (57&#8211;65 &#176;C) and incubation times (8-60 min), as well as using unconventional heating sources (e.g., flameless ration heater, water bath) outside standard laboratory conditions. All the temperatures tested gave comparable results. Based on the detection by visual color change alone, the optimal time for the detection of ZIKV RT-LAMP products was 30 min. However, the detection by UV light excitation or banding patterns on gels were positive with as little as 8 min total incubation time. Some RT-LAMP protocols include DMSO, but in this protocol, it can result in the inhibition of the RT-LAMP reaction. Using a thermophilic DNA polymerase that can be set up at room temperature may have advantages over wild-type thermophilic DNA polymerase including faster amplification signals and have increased stability at room temperature9,10. Ethidium bromide can be used instead for nucleic acid visualization in 2% agarose gels, however, other fluorescent nucleic acid dyes for agarose gels have lower mutagenic potential making them a safer choice. However, appropriate safety precautions such as wearing gloves should still be used.
A limitation of this protocol is that it is a qualitative and not a quantitative technique, however, relative quantification can be done6. Furthermore, RT-LAMP primers are highly specific and were designed against a highly conserved sequence of the nonstructural protein 5 of ZIKV that is found in 16 strains and verified to work in at least 5 strains6. It is possible that extensive mutations to ZIKV in the wild may not be detectable by these primers in the future. Other groups have also developed new technologies for the detection of ZIKV that may be of interest11,12,13,14,15,16,17.
In summary, this protocol provides a fast, simple, and cost-effective method for ZIKV in a variety of sample types that does not require specialized equipment. This provides a new diagnostic tool for ZIKV detection in which RNA does not have to be isolated before the RT-LAMP reaction.

In 2015, Zika virus (ZIKV) gained prominent global attention as an infectious disease of concern because infection during pregnancy was linked to miscarriage, stillbirth, severe neurological birth defects including microcephaly, as well as other congenital birth defects1. In rare cases, ZIKV has been associated with Guillain-Barr&#233; syndrome. ZIKV is primarily transmitted by Aedes mosquitoes; however, it can also be spread through sexual contact1. Given that the infection with ZIKV is asymptomatic in most people or presents with mild flu-like symptoms that overlap with the symptoms of infection of other arborviruses1, there was a need for improved methods for rapid and cost-effective detection of ZIKV to screen both people as well as local mosquito populations.
Quantitative reverse transcription PCR (qRT-PCR) is a reliable assay for ZIKV detection; however, this technique requires expensive specialized equipment, trained personnel, and RNA isolation from the sample of interest. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) is a one-step nucleic acid amplification method based on PCR technology that only requires one incubation temperature due to the use of a thermophilic DNA polymerase with strand displacement properties. This circumvents the need for a thermocycler and decreases the length of time needed to complete the assay. Additional advantages of RT-LAMP include its high specificity and sensitivity, robustness at a range of pH levels and temperatures, and resistance to many PCR inhibitors2. It has a relatively low cost and reagents are stable at room temperature. Given these characteristics, RT-LAMP can be deployed in a laboratory or in the field. As such, LAMP reactions have been developed to detect a range of pathogens and other types of infection3,4,5. The goal of the RT-LAMP protocol described in this paper is to detect ZIKV without RNA isolation in human serum and urine samples as well as in a single infected mosquito within 30 min through RT-LAMP. This method can be used to replace qRT-PCR as it is a sensitive, rapid diagnostic tool that works quickly and in settings outside of the laboratory.

<table><tbody><tr><td>&lt;em&gt;Bst&lt;/em&gt; 2.0 WarmStart DNA polymerase</td><td>New England Biolabs</td><td>M0537S</td><td></td></tr><tr><td>Isothermal Amplification Buffer&amp;nbsp;</td><td>New England Biolabs</td><td>B0537S</td><td></td></tr><tr><td>WarmStart RTx Reverse Transcriptase</td><td>New England Biolabs</td><td>M0380S</td><td></td></tr><tr><td>Antarctic Thermolabile UDG</td><td>New England Biolabs</td><td>M0372S</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>New England Biolabs</td><td>B1003S</td><td></td></tr><tr><td>100 mM dATP Solution</td><td>New England Biolabs</td><td>N0440S</td><td>Deoxynucleotide Set N0446S</td></tr><tr><td>100 mM dCTP Solution</td><td>New England Biolabs</td><td>N0441S</td><td>Deoxynucleotide Set N0446S</td></tr><tr><td>100 mM dTTP Solution</td><td>New England Biolabs</td><td>N0443S</td><td>Deoxynucleotide Set N0446S</td></tr><tr><td>100 mM dGTP Solution</td><td>New England Biolabs</td><td>N0442S</td><td>Deoxynucleotide Set N0446S</td></tr><tr><td>100 mM dUTP Solution</td><td>Thermo Fisher Scientific</td><td>R0133</td><td></td></tr><tr><td>SYBR Green I Nucleic Acid Gel Stain</td><td>Invitrogen</td><td>S7563</td><td></td></tr><tr><td>Nancy-520</td><td>Sigma Aldrich</td><td>01494</td><td></td></tr><tr><td>Low DNA Mass Ladder</td><td>Invitrogen</td><td>10-068-013</td><td></td></tr><tr><td>Zika Postive Control</td><td>Robert Koch Institute, Germany</td><td>N/A</td><td></td></tr><tr><td>Agarose</td><td>Thermo Fisher Scientific</td><td>BP1600</td><td></td></tr><tr><td>BlueJuice Gel Loading Buffer</td><td>Invitrogen</td><td>10816015</td><td></td></tr><tr><td>Primers</td><td>Integrated DNA Technologies</td><td>Custom Oligo</td><td></td></tr><tr><td>Nuclease-Free Water</td><td>Ambion</td><td>AM9938</td><td></td></tr><tr><td>Urine Preservative</td><td>Norgen Biotek</td><td>18126</td><td></td></tr><tr><td>ZIKV PCR Standard</td><td>Robert Koch Institute</td><td>N/A</td><td>Vero E6 cell supernatants</td></tr><tr><td>DENV2 New Guinea C Control</td><td>Connecticut Agricultural Experiment Station</td><td>N/A</td><td></td></tr></tbody></table>

reverse transcription-loop-mediated isothermal amplification (rt-lamp) assay for zika virus and housekeeping genes in urine, serum, and mosquito samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

RT-LAMP reactions can be analyzed using three different methods. First, with the addition of a fluorescent nucleic acid dye, positive reactions will be yellow/green in color where negative reactions will appear orange in color to the naked eye. Second, the addition of the fluorescent nucleic acid dye to RT-LAMP reaction results in a fluorescent signal when the samples are excited by UV light. Negative reactions will not have a detectable fluorescent signal over any background fluorescence that may be present in small amounts in the negative control. Lastly, RT-LAMP reactions can be run out on an agarose gel. Positive RT-LAMP reactions will have a banding pattern, whereas negative reactions will have no DNA bands. Examples of this using all three of these analysis methods are demonstrated in Figure 2 and 3. None of these samples had RNA isolated prior to RT-LAMP. Figure 1 demonstrates the crushing of a whole mosquito in PBS, which is sufficient for the use in the RT-LAMP reaction. In Figure 2, the specificity of the ZIKV RT-LAMP reaction is demonstrated: only the ZIKV molecular control, not the DENV molecular control or negative control, has a positive RT-LAMP reaction. Furthermore, ZIKV is detected in both the urine and serum of a patient with known ZIKV infection, but not in the asymptomatic control patient without ZIKV infection (Figure 2A). In Figure 2B, the samples are tested for human 18s rRNA using RT-LAMP. Only the samples from the patients (urine or serum), but not the molecular controls or the negative control, are positive for 18s rRNA. Therefore, 18s rRNA RT-LAMP can be used as a quality control for RT-LAMP reactions for the samples from human patients. Mosquito samples can be similarly tested for ZIKV or the RT-LAMP quality control, AEDAE (Figure 3). In this example, the positive molecular control for ZIKV as well as the mosquito infected with ZIKV are positive for ZIKV. The negative control, the molecular control for DENV, the mock infected mosquito (mosquito microinjected with cell culture media containing no virus), and the DENV infected mosquito are all negative for ZIKV (Figure 3A). However, all the mosquitoes are positive for AEDAE by RT-LAMP (Figure 3B).
When possible, all three analytical methods should be used to confirm a positive or negative reaction as sometimes the fluorescent signal can be weak and some individuals may be color blind, making the visual color change difficult to determine. In cases where the negative control is positive, the entire set of samples tested is invalid as contamination and therefore false positives cannot be ruled out. In cases where the positive control is negative, the entire set of samples is invalid as the RT-LAMP reaction may not have worked. This is a qualitative read out, however, higher copies of virus will result in an increase in RT-LAMP products that can be appreciated by fluorescent intensity or by the intensity of the DNA banding pattern by gel electrophoresis.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58436/58436fig1.jpg" /> 
Figure 1: Preparation of mosquito crude lysate. (A) Place a mosquito into 100 &#181;L of PBS in a microcentrifuge tube. (B) Using a P10 pipet tip, crush the mosquito against the sides of the tube 10 times. (C) This produces a crude lysate that should be spun down briefly in a table top centrifuge to pellet debris. Only the supernatant should be used for RT-LAMP reaction. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58436/58436fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58436/58436fig2.jpg" /> 
Figure 2:&#160;ZIKV and 18S rRNA RT-LAMP in patient urine and serum samples. Urine or serum samples from an asymptomatic control patient (C01) or ZIKV infected patient (Z01) were subjected to a ZIKV (A) or 18S rRNA (B) specific RT-LAMP reactions. RT-LAMP reactions were visualized after the addition of a fluorescent nucleic acid dye by eye (upper panel), green fluorescence (middle panel), or gel electrophoresis (bottom panel). Lane M: DNA Mass Marker; NTC: No template control (negative control); ZIKV: ZIKV PCR Standard positive control; DENV: DENV positive control. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58436/58436fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58436/58436fig3.jpg" /> 
Figure 3:&#160;ZIKV and AEDAE RT-LAMP in Ae. aegypti. Single Ae. aegypti infected with mock control, ZIKV, or DENV were subjected to ZIKV (A) or AEDAE (B) specific RT-LAMP reactions. RT-LAMP reactions were visualized after the addition of a fluorescent nucleic acid dye by eye (upper panel), green fluorescence (middle panel), or gel electrophoresis (bottom panel). Lane M: DNA Mass Marker; NTC: No template control (negative control); ZIKV: ZIKV PCR Standard positive control; DENV: DENV positive control. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58436/58436fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Target</td>
			<td>Primer</td>
			<td colspan="3">Sequence (5&#8217;-3&#8217;)</td>
		</tr>
		<tr>
			<td>Homo sapien 18S rRNA</td>
			<td>18SrRNA-FIP* 
			18SrRNA-BIP* 
			18SrRNA-F3 
			18SrRNA-B3 
			18SrRNA-LF 
			18SrRNA-LB</td>
			<td colspan="3">TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG 
			GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG 
			GTTCAAAGCAGGCCCGAG 
			CCTCCGACTTTCGTTCTTGA 
			AGAACCGCGGTCCTATTCCATTATT 
			ATTCCTTGGACCGGCGCAAG</td>
		</tr>
		<tr>
			<td>ZIKV</td>
			<td>ZIKV-FIP* 
			ZIKV-BIP* 
			ZIKV-F3 
			ZIKV-B3 
			ZIKV-LF 
			ZIKV-LB</td>
			<td colspan="3">AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT 
			CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA 
			GCAGAGCAATGGATGGGATA 
			CCCATCCTTGAGGTACAGCT 
			TCGATTGGCTTCACAACGC 
			GGAGCAATTGGGAAGAAGTCC</td>
		</tr>
		<tr>
			<td>Ae. aegypti actin</td>
			<td>Ae21-FIP* 
			Ae21-BIP* 
			Ae21-LF 
			Ae21-F3 
			Ae21-B3</td>
			<td colspan="3">TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA 
			GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG 
			ACCGCAAGGCCAAGAACCG 
			CGGCGCCACCACAAGA 
			TCGTGCCTGTGTTTGTCG</td>
		</tr>
		<tr>
			<td colspan="5">*Primers should be purified by rapid high-performance liquid chromatography (HPLC). For all other primers, standard desalting conditions are sufficient.</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences for RT-LAMP reactions. Primer sequences are originally described in previous publication6.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Volume (&#181;L)</td>
			<td>Primer</td>
			<td>Stock Concentration (&#181;M)</td>
			<td>Final Concentration (&#181;M)</td>
		</tr>
		<tr>
			<td>80</td>
			<td>Forward Inner Primer (FIP)</td>
			<td>100</td>
			<td>16</td>
		</tr>
		<tr>
			<td>80</td>
			<td>Backward Inner Primer (BIP)</td>
			<td>100</td>
			<td>16</td>
		</tr>
		<tr>
			<td>10</td>
			<td>Forward Outer Primer (F3)</td>
			<td>100</td>
			<td>2</td>
		</tr>
		<tr>
			<td>10</td>
			<td>Backward Outer Primer (B3)</td>
			<td>100</td>
			<td>2</td>
		</tr>
		<tr>
			<td>20</td>
			<td>Loop Forward (LF)</td>
			<td>100</td>
			<td>4</td>
		</tr>
		<tr>
			<td>20</td>
			<td>Loop Backward (LB)</td>
			<td>100</td>
			<td>4</td>
		</tr>
		<tr>
			<td>280</td>
			<td>molecular grade water</td>
			<td>-</td>
			<td>-</td>
		</tr>
		<tr>
			<td>500</td>
			<td>Total</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: Preparation of 10x RT-LAMP Primer Mix. The RT-LAMP primer set for Ae. aegypti actin does not contain a BF primer; replace this volume with water.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>1x Volume (&#181;L)</td>
			<td>Component</td>
			<td>Final Conc. For 25 &#181;L Volume</td>
		</tr>
		<tr>
			<td>2.5</td>
			<td>10x Isothermic Amplification Buffer</td>
			<td>1x</td>
		</tr>
		<tr>
			<td>1.8</td>
			<td>100 mM dU/A/T/C/GTPs</td>
			<td>1.4 mM</td>
		</tr>
		<tr>
			<td>2.0</td>
			<td>100 mM MgSO4</td>
			<td>6 mM + 2 mM in buffer = 8 mM [4-10 mM range]</td>
		</tr>
		<tr>
			<td>2.5</td>
			<td>10x Primers</td>
			<td>1.6 &#181;M FIP/BIP, 0.2 &#181;M F3/B3, 0.4 &#181;M FL/BL</td>
		</tr>
		<tr>
			<td>1.0</td>
			<td>thermophilic DNA polymerase with strand displacement (8,000 U/mL)</td>
			<td>8 U</td>
		</tr>
		<tr>
			<td>0.5</td>
			<td>Reverse Transcriptase (15,000 U/mL)</td>
			<td>7.5 U</td>
		</tr>
		<tr>
			<td>0.5</td>
			<td>UDG (1,000 U/mL)</td>
			<td>0.5 U</td>
		</tr>
		<tr>
			<td>12.3</td>
			<td>molecular grade water</td>
			<td>-</td>
		</tr>
		<tr>
			<td>23.0</td>
			<td>Total</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 3: Preparation of RT-LAMP Master Mix.

Watch this Scientific Journal Video about Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples at JoVE

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

reverse-transcription-loop-mediated-isothermal-amplification-rt-lamp

Nanyang Technological University

Research

JoVE Journal

Genetics

13.7K Views.  Beaumont Health System. Deze methode kan snel bepalen of monsters zikavirus bevatten. Dit is handig voor zwangere vrouwen, koppels proberen zwanger te worden, of toezicht op de lokale muggenpopulaties die risico lopen op Zika-infectie. Het belangrijkste voordeel van deze techniek is dat het snel, gemakkelijk, vereist geen dure apparatuur, en kan worden gedaan zonder een RNA isolatie stap.De implicaties van deze techniek breiden zich uit tot de diagnose van Zika-infectie, omdat infectie tijdens de zwangerschap...

Video: Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Biochemistry

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Immunology and Infection

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

Antibody dependent enhancement of infection has been shown to play a major role in Dengue viral pathogenesis. Traditional assays that measure the capacity of antibodies or serum to enhance infection in impermissible cell lines have relied on using viral output in the media followed by plaque assays to quantify infection. More recently, these assays have examined Dengue virus (DENV) infection in the cell lines using fluorescently labeled antibodies. Both these approaches have limitations that restrict the widespread use of these techniques. Here, we describe a simple in vitro assay using Dengue virus reporter viral particles (RVPs) that express green fluorescent protein and K562 cells to examine antibody dependent enhancement (ADE) of DENV infection using serum that was obtained from rhesus macaques 16 weeks after infection with Zika virus (ZIKV). This technique is reliable, involves minimal manipulation of cells, does not involve the use of live replication competent virus, and can be performed in a high throughput format to get a quantitative readout using flow cytometry. Additionally, this assay can be easily adapted to examine antibody dependent enhancement (ADE) of other flavivirus infections such as Yellow Fever virus (YFV), Japanese Equine Encephalitis virus (JEEV), West Nile virus (WNV) etc. where RVPs are available. The ease of setting up the assay, analyzing the data, and interpreting results makes it highly amenable to most laboratory settings.

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

We describe a simple and easy protocol for measuring antibody dependent enhancement of infection by Zika virus convalescent serum using Dengue virus Reporter Viral Particles.

Antibody dependent enhancement of infection has been shown to play a major role in Dengue viral pathogenesis. Traditional assays that measure the capacity ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Design to Implementation Study for Development and Patient Validation of Paper-Based Toehold Switch Diagnostics

Access to low-burden molecular diagnostics that can be deployed into the community for testing is increasingly important and has meaningful wider implications for the well-being of societies and economic stability. Recent years have seen several new isothermal diagnostic modalities emerge to meet the need for rapid, low-cost molecular diagnostics. We have contributed to this effort through the development and patient validation of toehold switch-based diagnostics, including diagnostics for the mosquito-borne Zika and chikungunya viruses, which provided performance comparable to gold-standard reverse transcription-quantitative polymerase chain reaction (RT-qPCR) based assays. These diagnostics are inexpensive to develop and manufacture, and they have the potential to provide diagnostic capacity to low-resource environments. Here the protocol provides all the steps necessary for the development of a switch-based assay for Zika virus detection. The article takes readers through the stepwise diagnostic development process. First, genomic sequences of Zika virus serve as inputs for the computational design of candidate switches using open-source software. Next, the assembly of the sensors for empirical screening with synthetic RNA sequences and optimization of diagnostic sensitivity is shown. Once complete, validation is performed with patient samples in parallel with RT-qPCR, and a purpose-built optical reader, PLUM. This work provides a technical roadmap to researchers for the development of low-cost toehold switch-based sensors for applications in human health, agriculture, and environmental monitoring.

Access to decentralized, low-cost, and high-capacity diagnostics that can be deployed into the community for decentralized testing is critical for combating global health crises. This manuscript describes how to build paper-based diagnostics for viral RNA sequences that can be detected with a portable optical reader.

Access to low-burden molecular diagnostics that can be deployed into the community for testing is increasingly important and has meaningful wider ...

Bioengineering

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Forced Salivation As a Method to Analyze Vector Competence of Mosquitoes

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus particles are transmitted during a blood meal via the saliva of an infected mosquito. Forced salivation assays allow determining the vector potential on the basis of single mosquitoes, avoiding the use of animal experiments. The method is suitable to analyze a large number of mosquitoes in one experiment within a short period of time. Forced salivation assays were used to analyze 856 individual mosquitoes trapped in Germany, including two different Culex pipiens pipiens biotypes, Culex torrentium as well as Aedes albopictus, which were experimentally infected with Zika virus (ZIKV) and incubated at 18 &#176;C or 27 &#176;C for two and three weeks. The results indicated the lack of vector competence of the different Culex taxa for ZIKV. In contrast, Aedes albopictus was susceptible to ZIKV, but only at 27 &#176;C, with transmission rates similar to an Aedes aegypti laboratory colony tested in parallel.

For efficient control of mosquito borne virus transmission, the knowledge of the vector potential of respective mosquitoes is of particular interest. We describe forced salivation as a method to analyze vector competence of Aedes albopictus and three different Culex taxa for the transmission of Zika virus.

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Samenvatting

Meer video's verkennen