Name: modeling tuberculosis in mycobacterium marinum infected adult zebrafish
Uploaded: 2018-10-08T14:00:00.000+00:00
Duration: 7 min
Description: Watch this Scientific Journal Video about Modeling Tuberculosis in Mycobacterium marinum Infected Adult Zebrafish at JoVE.com

This work has been supported by the Finnish Cultural Foundation (H.L.), Tampere Tuberculosis Foundation (H.L., L.-M.V., M.M.H., M.P.), Foundation of the Finnish Anti-Tuberculosis Association (Suomen Tuberkuloosin Vastustamisyhdistyksen Sa&#776;a&#776;tio&#776;) (H.L., M.M.H., M.P.), Sigrid Juse&#769;lius Foundation (M.P.), Emil Aaltonen Foundation (M.M.H.), Jane and Aatos Erkko Foundation (M.P.) and Academy of Finland (M.P.). Leena Ma&#776;kinen, Hanna-Leena Piippo and Jenna Iloma&#776;ki are acknowledged for their technical assistance.&#160;The authors acknowledge the Tampere Zebrafish Laboratory for their service.

All zebrafish experiments have been approved by the Animal Experiment Board in Finland (ESAVI/8245/04.10.07/2015). Methods are performed according to the act (497/2013) and the government decree (564/2013) on the protection of animals used for scientific or educational purposes in Finland.
1. Culturing of Mycobacterium marinum 
NOTE: Since Mycobacterium marinum is a pathogen capable of causing superficial infections in humans, find out the local guidelines for personal safety and biohazard waste disposal before starting to work with this bacterium.
<ol>
	<li>Culture M. marinum on a 7H10 plate supplemented with 10% OADC (oleic acid, albumin, dextrose, catalase) enrichment and 0.5% v/v of glycerol at 29 &#176;C for at least 5 days. Maintain M. marinum cultures by taking fresh bacteria from the freezer every two weeks and transferring onto a new plate every other week. 
	NOTE: M. marinum is a natural fish pathogen infecting aquatic species and it is important to take precautions not to contaminate zebrafish stocks with the bacteria. Infected zebrafish and items contaminated with bacteria have to be kept separate from the breeding facilities.</li>
	<li>Use a sterile 1-&#181;L inoculation loop to aseptically transfer a loopful of M. marinum bacterial mass into a cell culture flask containing 10 mL of 7H9 medium with 10% ADC (albumin, dextrose, catalase) enrichment, 0.2% v/v polysorbate 80 and 0.2% v/v of glycerol. Culture for 3&#8211;4 days to approximately an OD600 (optical density) of 0.7 at 29 &#176;C in the dark without shaking. Leave the cap loose, or use a filter cap, to allow for the sufficient exchange of gases. 
	NOTE: Polysorbate 80 is added to the medium to prevent the aggregation of bacteria. In addition, exposure to light leads to phenotypic changes in bacterial colonies (e.g., the color changes from white to yellow). To avoid this, keep the cultures in the dark.</li>
	<li>Measure the OD600value with a spectrophotometer. Dilute the liquid culture to an OD600 of 0.07&#8211;0.09 and continue culturing for 2 days at 29 &#176;C in the dark without shaking. Leave the cap loose. 
	NOTE: During these two days, the bacterial suspension will reach an OD600of approximately 0.5 corresponding to an early log-phase.</li>
</ol>
2. Preparation of Bacterial Solution for Infecting Adult Zebrafish
<ol>
	<li>Transfer the bacterial suspension into a big sterile cuvette or a 15 mL tube and place it in the dark at room temperature for 15 min to allow the biggest clumps to settle.</li>
	<li>Transfer the top 5&#8211;7 mL of the suspension into a clean tube or a cuvette and measure the OD600. Use this top phase of the suspension for the infections.</li>
	<li>Collect 1 mL of M. marinum culture into a fresh tube and centrifuge for 3 min at 10,000 x g. Remove the supernatant and resuspend the pellet in 1 mL of sterile 1x PBS.</li>
	<li>Dilute to reach the desired bacterial concentration by using sterile 1x PBS with 0.3 mg/mL phenol red as a tracer. Divide the diluted suspension into three aliquots. 
	NOTE: Use a predetermined OD600 vs. CFU (colony-forming units)/&#181;L curve to estimate the dilution required to get the wanted number of bacteria in the 5 &#181;L injection volume34. The correlation between OD600 and concentration of the bacterial suspension needs to be validated before starting the actual infection experiments. Reserve two weeks for collecting this validation data.</li>
	<li>Using a 1 mL syringe, slowly pull the suspension through a 27 G needle 3x. For each aliquot, perform this step just before use. 
	NOTE: Do not use the same bacterial solution for more than 2 h.</li>
</ol>
3. Experimental M. marinum Infection with Intraperitoneal Injection
<ol>
	<li>Pipette a 5 &#181;L droplet of the diluted bacterial solution onto a piece of parafilm film and pull the droplet into a 30 G insulin needle.</li>
	<li>Use 5&#8211;8 month-old wild-type fish and rag1&#8722;/&#8722;hu1999 mutant fish for the experiment. Anesthetize adult zebrafish in the tank water with 0.02% 3-aminobenzoic acid ethyl ester (pH 7.0). Position the fish ventral side up into a slit on a moist foamed plastic. 
	NOTE: Rag-/- mutant fish are not able to undergo somatic recombination and produce functional T and B cells.</li>
	<li>Inject the needle between the pelvic fins at an approximately 45&#176; angle. Keep the needle opening upwards to observe that the entire opening is inside the abdominal cavity. Slowly inject the bacterial suspension and carefully remove the needle. 
	NOTE: In case the red tracer is leaking out of the fish upon injection, exclude the fish from the experiment.</li>
	<li>Immediately after injection, transfer the fish into a recovery tank with fresh tank water.</li>
	<li>Take samples of the bacterial suspension on 7H10 plates every 15 min from the bacterial aliquot in use and incubate the bacteria at 29 &#176;C for 5 days and verify the infection dose by counting the colonies on the plates.</li>
	<li>Check the well-being of the fish regularly and euthanize any fish with symptoms of the infection with over 0.02% concentration of 3-aminobenzoic acid ethyl ester (pH 7.0). 
	NOTE: Approximately, 7% of the adult zebrafish infected with 34 &#177; 15 CFU and 30% of zebrafish infected with 2029 &#177; 709 CFU will have had symptoms by 8 weeks19. The symptoms may include abnormal swimming, lack of response to touch, gasping, edema or observable wasting.</li>
	<li>Maintain the zebrafish according to the common standards35.</li>
</ol>
4. Collection of Internal Organs
<ol>
	<li>Euthanize the zebrafish with an overdose of 3-aminobenzoic acid ethyl ester (over 0.02% concentration, pH 7.0) in the tank water.</li>
	<li>Insert one pin posterior to the branchiostegal rays and another through the tail to tack the fish onto the platform.</li>
	<li>Open the whole abdominal cavity with a scalpel and collect the internal organs by using a small spoon and sharp-ended tweezers. Start from the heart and work along the spine towards the tail to detach all internal organs in one block. 
	NOTE: Be sure to collect all kidney tissue by scraping along the spine with the spoon.</li>
	<li>Finally, use tweezers to detach the gut next to the cloaca and transfer the organs into a 1.5 mL homogenization tube with six 2.8 mm ceramic beads. Immediately place on dry-ice to freeze the sample. The sample can be stored at -80 &#176;C until homogenized.</li>
	<li>Rinse the instruments with 70% ethanol between individuals.</li>
</ol>
5. Homogenization and RNA extraction from an organ block.
NOTE: The method is modified from the Stanford University protocols36.
<ol>
	<li>Add guanidine thiocyanate-phenol solution used for nucleic acid extraction (Table of Materials) on the top of the sample to a total volume of 1,500 &#181;L. Ensure that the sample covers a maximum of 10% of the total volume. 
	CAUTION: The expected volume of the harvested tissue is 100 &#181;L. Guanidine thiocyanate-phenol solution contains toxic and irritating compounds and requires protective clothing, nitrile gloves and working in a fume hood. Do not combine with bleach as this will cause formation of toxic gases. Read the material safety data sheet (MSDS) before use.</li>
	<li>Homogenize samples using a bead-beating homogenizer 3 times for 40 s at 3,200 rpm. Cool on ice for 30 s between the cycles. Sonicate the homogenized samples in a water bath for 9 min.</li>
	<li>Centrifuge the samples at 12,000 x g for 10 min at 4 &#176;C and move 1,000 &#181;L of the cleared homogenate into a fresh microcentrifuge tube.</li>
	<li>Add 200 &#181;L of chloroform, immediately mix by vortexing for 15 s and incubate for 2 min at room temperature. 
	CAUTION: Chloroform is a toxic and irritant compound if inhaled, swallowed or contacted with skin or eyes. Use necessary safety equipment for personal protection and work in a fume hood. Read the material safety data sheet (MSDS) before use.</li>
	<li>Centrifuge at 12,000 x g for 15 min at 4 &#176;C to separate the aqueous and organic phases.</li>
	<li>Carefully, transfer 500 &#181;L of the top phase to a fresh tube to avoid contaminating the RNA. Remove and discard the rest of the aqueous phase (~100 &#181;L) and store the interphase and organic phase at 4 &#176;C for DNA extraction. 
	NOTE: The top phase contains the RNA.</li>
	<li>Add 500 &#181;L of 2-propanol and immediately mix by vortexing for 15 s. Incubate for 10 min at room temperature to precipitate the RNA.</li>
	<li>Centrifuge at 12,000 x g for 10 min at 4 &#176;C to pellet the RNA. Remove the supernatant by pipetting.</li>
	<li>Add 1 mL of 75% ethanol and vortex for 10 s. 
	NOTE: The protocol can be paused here, and the samples kept overnight at 4 &#176;C.</li>
	<li>Centrifuge at 7,500 x g for 5 min at 4 &#176;C. Remove the supernatant by pipetting.</li>
	<li>Repeat the wash steps 5.9&#8211;5.10. Remove the supernatant carefully by pipetting and let the pellet air-dry in a fume hood.</li>
	<li>Dissolve the RNA pellet in 500 &#181;L of nuclease-free water and keep the samples on ice. Measure the concentrations with a microvolume spectrophotometer or with equivalent equipment. Store the RNA at -80 &#176;C.</li>
</ol>
6. Purification of Co-extracted Zebrafish and Mycobacterial DNA
<ol>
	<li>Prepare a back-extraction buffer (BEB) by dissolving 118.2 g of guanidine thiocyanate (final concentration 4 M), 3.68 g of sodium citrate (final concentration 50 mM) and 30.29 g of Tris free base (final concentration 1 M) in 120 mL of nuclease-free water (this may require stirring overnight). Add nuclease-free water to a final total volume of 250 mL and filter to sterilize the solution. 
	NOTE: This buffer can be stored at room temperature for up to 6 months. Do not combine BEB with bleach as they react to produce toxic gases such as hydrogen chloride and hydrogen cyanide.</li>
	<li>Use the interphase and organic phase of the sample to extract mycobacterial DNA. Add 500 &#956;L of BEB to each tube. Mix extensively for 10 min by inversion at room temperature.</li>
	<li>Centrifuge the tubes at 12,000 x g for 30 min at room temperature and carefully transfer 500 &#181;L of the upper aqueous phase containing the DNA to a new tube.</li>
	<li>Add 400 &#956;L of 2-propanol. Mix by inverting and incubate for 10 min at room temperature.</li>
	<li>Centrifuge the samples at 12,000 x g for 15 min at 4 &#176;C. A pellet containing the DNA should be visible at this point. Carefully remove the supernatant by pipetting.</li>
	<li>Add 800 &#956;L of 70% ethanol. Wash the pellet by inversion. Do not vortex the samples at this point, as genomic DNA breaks down easily.</li>
	<li>Centrifuge the samples at 12,000 x g for 15 min at 4&#176;C and remove the supernatant by pipetting. Repeat the ethanol wash (steps 6.6 and 6.7).</li>
	<li>Remove the ethanol by carefully pipetting. Let the samples air-dry for 5&#8211;10 min. Dissolve the pellet in 200 &#956;L of nuclease-free water.</li>
	<li>Measure DNA concentrations with a microvolume spectrophotometer or with equivalent equipment. DNA can be stored at 4 &#176;C or at -20 &#176;C for long-term storage.</li>
</ol>
7. Quantitative PCR for Measuring Mycobacterial Loads
<ol>
	<li>Prepare qPCR reaction mixes with no-ROX (carboxy-X-rhodamine) against the M. marinum internal transcribed spacer (ITS) between 16S-23S ITS according to the manufacturer&#39;s instructions with MMITS1 primers (Table 1). Pipette the reaction mix and sample dilutions as duplicates on a 96-well plate suitable for qPCR. Include a DNA standard dilution series of a known amount of bacteria in each run. 
	NOTE: The expected M. marinum load per fish can range from 0 CFU to 1,000,000 CFU at 4 wpi. The qPCR assay can be also performed with other qPCR kits but the annealing temperature for the primers has to be re-optimized.</li>
	<li>Seal the plate with an optically transparent film and centrifuge the plate at 2,000 x g for 2 min at 4 &#176;C.</li>
	<li>Run the qPCR program shown in the Table 2.</li>
	<li>Using the standard curve, calculate the number of bacteria in the entire fish sample.</li>
</ol>
8. DNase Treatment of the RNA Samples
<ol>
	<li>To remove any possible remaining traces of genomic DNA from the RNA, carry out DNase I treatment. Thaw the RNA samples on ice. 
	NOTE: Be sure to use only RNase-free equipment and solutions and wipe the working surface and pipettes with a decontamination reagent eliminating RNases (Table of Materials) before starting to work. Wear a long-sleeved lab coat and gloves to protect your samples.</li>
	<li>Prepare 10 &#956;L DNase I reaction mixes on ice according to the manufacturer&#39;s instructions. Mix 1 &#956;L of DNase I, 1 &#956;L of 10x DNase buffer and 8 &#956;L of RNA sample including a maximum of 1 &#956;g of RNA.</li>
	<li>Gently mix the reactions (no vortexing) and incubate for 30 min at 37 &#176;C.</li>
	<li>Prior to heat-inactivation, add 1 &#181;L of 50 mM EDTA to each 10 &#181;L sample. If EDTA is not added, the RNA will undergo chemical degradation when heated.</li>
	<li>Incubate for 10 min at 65 &#176;C to heat-inactivate DNase I. Continue directly to cDNA synthesis or store the DNase-treated RNA at -80 &#176;C.</li>
</ol>
9. cDNA Synthesis
<ol>
	<li>Keep all reagents and samples on ice and prepare the reaction mixes according to the manufacturer&#39;s instructions. For a 5 &#956;L reaction mix, include 1 &#956;L of Reverse Transcription Master Mix, 3 &#956;L of nuclease-free water and 1 &#956;L of DNase treated RNA.</li>
	<li>Gently mix the reverse transcription reactions and briefly spin the tube, if needed.</li>
	<li>Place samples in a PCR machine and use the program shown in Table 3.</li>
	<li>Dilute the cDNA in nuclease-free water for qPCR to a maximum concentration of 2.5 ng/&#956;L, if needed. cDNA can be stored at -20 &#176;C.</li>
</ol>
10. Measuring Zebrafish Gene Expression by Quantitative PCR
<ol>
	<li>Prepare a qPCR master mix on ice according to the manufacturer&#39;s instructions and protect from light. Use the primers introduced in Table 1. 
	NOTE: To calculate the fold of induction for each gene, measure the expression also from a pooled baseline sample extracted from 6 healthy zebrafish.</li>
	<li>Prepare replicates of each sample and pipette the reaction mixes onto a qPCR plate. Seal the plate with an optically transparent film and centrifuge the plate at 2,000 x g for 2 min at 4 &#176;C before starting the run.</li>
	<li>Run the qPCR program shown in the Table 4 with the annealing temperature depending on the primer pair used (Table 1).</li>
	<li>Analyze the gene expression ratio compared to a house-keeping gene (loopern437) with the &#916;Ct method using the equation: 
	<img alt="Equation" src="/files/ftp_upload/58299/58299eq1.jpg" /></li>
</ol>

The authors have nothing to disclose.

Here we describe a qPCR-based application to measure mycobacterial loads from DNA extracted from experimentally infected adult zebrafish tissues. This application is based on primers designed around the 16S-23S rRNA internal transcribed spacer sequence40. The total mycobacterial load in a fish sample is estimated using a standard curve prepared from DNA extracted from a known number of cultured mycobacteria and assuming that one bacterium has one copy of its genome at any given moment. The detection limit of the M. marinum -qPCR is approximately 100 colony forming units18. A clear advantage of the method compared to traditional plating is that both active and non-dividing dormant bacteria can be detected. In addition, a common problem of contaminating growth on culture plates from zebrafish tissues is circumvented by this approach. However, as DNA is used as the template, it is possible that some of the copies measured can be derived from the DNA of bacteria that have died very recently. A significant advantage of the nucleic acid-based protocol is that as both DNA and RNA (as well as proteins, not described here) can be extracted from the same individual, the mycobacterial load of the individual can be combined with gene expression data of both the host and the bacteria.
The dosing of M. marinum is a critical determinant of the outcome of infection. The low M. marinum (~20&#8211;90 CFU) infection dose produces a spectrum of disease states with latency as the most common form. If the infection dose is in the order of thousands, a more progressive disease develops in the majority of individuals. As the natural infectious dose is known to be low in human tuberculosis41, using a low dose of M. marinum in the zebrafish model is likely to produce a more natural infection. To reach the correct dose, make sure to validate the relation between the OD600 and colony-forming units prior to starting any experiments. The normal variation of the plated infection doses is approximately 30% and is not considered a problem. However, it is important to verify that the entire 5 &#181;L volume of the bacterial suspension remains inside the fish. Leaking of the injection solution will cause extra variation in the infection dose. In addition to the infection dose, the strain of the bacteria can affect the disease progression. It has been shown that the virulence of the different M. marinum strains can alter between the strains. The two most commonly used strains are ATCC927 (fish isolated strain used in these experiments) and the M strain. However, these strains differ greatly in their virulence. The human-isolated M strain develops a more progressive disease whereas the fish-isolated strain produces a milder disease well-suitable for studying the latent form of the mycobacterial infection33. The virulence of the bacteria within a strain may also alter if the bacteria is serially transferred from one culture to another, which can be prevented by taking fresh mycobacteria from a freezer stock often enough.
In vitro culturing of slowly dividing M. marinum without antibiotics is prone to contaminations. Therefore, the handling of the bacteria requires strict aseptic approach carried out in a laminar flow hood. Possible contamination in the culture can be detected as too high an OD600 value, odd-looking bacterial suspension or colonies. M. marinum colonies are normally fuzzy-edged, flat and matt white in color. M. marinum cultures are sensitive to light and they start producing yellow pigment when exposed to light. This yellow pigment can be used to distinguish M. marinum colonies from other bacteria after the infections. Contaminants can cause the fish to die soon after infection. Usually, the first symptoms of a low-dose infection do not appear before 3 weeks post infection and any mortalities before this time point are likely due to contamination in the bacterial suspension or trauma induced during injection.
Adult zebrafish are very sensitive to 3-aminobenzoic acid ethyl ester and do not survive if the exposure time is too long or the concentration of the anesthetic is too high. Therefore, when infecting, the zebrafish should be exposed to the anesthetic only for the minimum of time to achieve good anesthesia (~1&#8211;2 min). After infection, adult zebrafish are kept in groups at water temperature of 26&#8211;28 &#176;C. If the temperature is higher or lower than this, it might affect the M. marinum growth rate and kinetics of the infection. Also, the tank water quality (microbiological quality, salt concentration, pH, oxygen saturation) is an important part ensuring a successful experiment. Health monitoring of the fish needs to be carried out daily and fish that show symptoms of infection need to be removed from the group and euthanized. If the fish die in the tank, the other fish may become re-infected through the gut, which will affect the progression of infection.
The commonly used zebrafish larval model of tuberculosis is applicable to study innate immunity, which directs the experiments to a limited subset of host-microbe interactions. The use of adult zebrafish makes it possible to study both innate and adaptive immune responses in a versatile model18,32,39. Adult zebrafish presents itself as a convenient vertebrate model to study the entire spectrum of tuberculosis. With a low-dose exposure of M. marinum, 7% of the fish population develop primary progressive disease, 10% are able to sterilize the infection, 65% develop latent disease and in 18% spontaneous reactivation occurs (Figure 2). The disease spectrum closely resembles that seen in human tuberculosis, in which the vast majority develop a latent disease, approximately 4&#8211;14% produce primary active infection within the first five years after the infection42, 10&#8211;20% of heavily exposed persons seem to be able to sterilize the infection43 and 5&#8211;10% of the latent infections reactivate44. Differences in hosts&#39; genetics affects the susceptibility to tuberculosis and the disease progression45. This is also seen in the zebrafish population that is genetically very heterogeneous unlike many other laboratory animals46,47. The natural genetic variation makes it a highly applicable model in the search for optimal immune responses in this multifactorial disease.

Zebrafish (Danio rerio) is a widely used animal model in biomedical research and it is an accepted model for common vertebrate biology. The zebrafish has been adapted to many fields of research modeling human diseases and disorders ranging from cancer1 and cardiac disease2 to infection and immunological studies of several bacterial 3 and viral infections4,5. In addition, the ex utero development of zebrafish embryos has made the zebrafish a popular model in developmental biology6 and toxicology7,8.
In many fields of research, including infection biology, the optically transparent zebrafish larvae are commonly used. The first immune cells appear within 24 h post fertilization (hpf), when primitive macrophages are detected9. Neutrophils are the next immune cells to appear around 33 hpf10. Zebrafish larvae are thus feasible for studying the early stages of infection and the role of innate immunity in the absence of adaptive immune cells11. However, the adult zebrafish with its fully functional adaptive immune system provides an additional layer of complexity for infection experiments. T cells can be detected around 3 days post fertilization12, and B cells are able to produce functional antibodies by 4 weeks post fertilization13. The adult zebrafish has all the main counterparts of the mammalian innate and adaptive immune system. The main differences between the immune systems of fish and humans are found in antibody isotypes as well as in the anatomy of lymphoid tissues. The zebrafish has only three antibody classes14, whereas humans have five15. In the absence of bone marrow and lymph nodes, the primary lymphoid organs in the fish are the kidney and the thymus16 and the spleen, the kidney and the gut serve as secondary lymphoid organs17. Despite these differences, with its full immune arsenal of innate and adaptive cells, the adult zebrafish is a highly applicable, easy-to-use, non-mammalian model for host-pathogen interaction studies.
The zebrafish has lately been established as a feasible model to study tuberculosis18,19,20,21,22. Tuberculosis is an airborne disease caused by Mycobacterium tuberculosis. According to the World Health Organization, tuberculosis caused1.7 million deaths in 2016 and is the leading cause of death by a single pathogen worldwide23. Mice24,25, rabbits26 and non-human primates27 are the best-known animal models in tuberculosis research but each face their limitations. The non-human primate model of M. tuberculosis infection resembles the human disease most closely, but using this model is limited due to serious ethical considerations. Other animal models are hindered by the host-specificity of M. tuberculosis that affects the disease pathology. Probably the biggest issue in modeling tuberculosis is the wide spectrum of infection and disease outcomes in the human disease: tuberculosis is a very heterogeneous disease ranging from sterilizing immunity to latent, active and reactivated infection28, which can be hard to reproduce and model experimentally.
Mycobacterium marinum is a close relative of M. tuberculosis with ~3,000 orthologous proteins with 85% amino acid identity29. M. marinum naturally infects zebrafish producing granulomas, the hallmarks of tuberculosis, in its internal organs19,30. Unlike other animal models used in tuberculosis research, zebrafish produces many offspring, it requires only a limited space and importantly, it is neurophysiologically the least developed vertebrate tuberculosis model available. Additionally, the M. marinum infection causes latent infection, active disease or even sterilization of mycobacterial infection in adult zebrafish closely mimicking the spectrum of disease outcomes of human tuberculosis19,31,32. Here, we describe methods for the experimental tuberculosis model of adult zebrafish by injecting M. marinum into the abdominal cavity and using quantitative PCR to measure the mycobacterial loads and immune responses from zebrafish tissue samples.

<table><tbody><tr><td>&lt;em&gt;Mycobacterium marinum&lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 927</td><td></td></tr><tr><td>Middlebrock 7H10 agar</td><td>BD, Thermo Fisher Scientific</td><td>11799042</td><td></td></tr><tr><td>Middlebrock OADC enrichment</td><td>BD, Thermo Fisher Scientific</td><td>11718173</td><td></td></tr><tr><td>Middlebrock 7H9 medium</td><td>BD, Thermo Fisher Scientific</td><td>11753473</td><td></td></tr><tr><td>Middlebrock ADC enrichment</td><td>BD, Thermo Fisher Scientific</td><td>11718173</td><td></td></tr><tr><td>Tween 80</td><td>Sigma-Aldrich</td><td>P1754</td><td></td></tr><tr><td>Glycerol</td><td>Sigma-Aldrich</td><td>G5516-500ML</td><td></td></tr><tr><td>GENESYS20 Spectrophotometer</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>Phosphate buffered saline tablets (PBS)</td><td>Sigma-Aldrich</td><td>P4417-50TAB</td><td></td></tr><tr><td>Phenol red</td><td>Sigma-Aldrich</td><td>P3532</td><td></td></tr><tr><td>27 G needle</td><td>Henke Sass Wolf</td><td>4710004020</td><td></td></tr><tr><td>1 mL syringe</td><td>Henke Sass Wolf</td><td>4010.200V0</td><td></td></tr><tr><td>Omnican 100 30 G insulin needle</td><td>Braun</td><td>9151133</td><td></td></tr><tr><td>3-aminobenzoic acid ethyl ester (pH 7.0)</td><td>Sigma-Aldrich</td><td>A5040</td><td></td></tr><tr><td>1.5 mL homogenization tube</td><td>Qiagen</td><td>13119-1000</td><td></td></tr><tr><td>2.8 mm ceramic beads</td><td>Qiagen</td><td>13114-325</td><td></td></tr><tr><td>Ethanol, ETAX Aa</td><td>Altia</td><td></td><td></td></tr><tr><td>2-propanol</td><td>Sigma-Aldrich</td><td>278475</td><td></td></tr><tr><td>Chloroform</td><td>VWR</td><td>22711.290</td><td></td></tr><tr><td>Guanidine thiocyanate</td><td>Sigma-Aldrich</td><td>G9277</td><td>FW 118.2 g/mol</td></tr><tr><td>Sodium citrate</td><td>Sigma-Aldrich</td><td>1613859</td><td>FW 294.1 g/mol</td></tr><tr><td>Tris (free base)</td><td>Sigma-Aldrich</td><td>TRIS-RO</td><td>FW 121.14 g/mol</td></tr><tr><td>TRI reagent</td><td>Molecular Research Center</td><td>TR118</td><td>Guanidine thiocyanate-phenol solution</td></tr><tr><td>PowerLyzer24 homogenizator</td><td>Qiagen</td><td></td><td></td></tr><tr><td>Sonicator m08</td><td>Finnsonic</td><td></td><td></td></tr><tr><td>Nanodrop 2000</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>SENSIFAST No-ROX SYBR, Green Master Mix</td><td>Bioline</td><td>BIO-98005</td><td></td></tr><tr><td>qPCR 96-well plate</td><td>BioRad</td><td>HSP9601</td><td></td></tr><tr><td>Optically transparent film</td><td>BioRad</td><td>MSB1001</td><td></td></tr><tr><td>C1000 Thermal cycler with CFX96 real-time system</td><td>BioRad</td><td></td><td></td></tr><tr><td>RNase AWAY</td><td>Thermo Fisher Scientific</td><td>10666421</td><td>decontamination reagent eliminating RNases</td></tr><tr><td>DNase I</td><td>Thermo Fisher Scientific</td><td>EN0525</td><td></td></tr><tr><td>Reverse Transcription Master Mix</td><td>Fluidigm</td><td>100-6298</td><td></td></tr><tr><td>SsoFast Eva Green master mix</td><td>BioRad</td><td>172-5211</td><td></td></tr></tbody></table>

modeling tuberculosis in mycobacterium marinum infected adult zebrafish

Mycobacterium tuberculosis is currently the deadliest human pathogen causing 1.7 million deaths and 10.4 million infections every year. Exposure to this bacterium causes a wide disease spectrum in humans ranging from a sterilized infection to an actively progressing deadly disease. The most common form is the latent tuberculosis, which is asymptomatic, but has the potential to reactivate into a fulminant disease. Adult zebrafish and its natural pathogen Mycobacterium marinum have recently proven to be an applicable model to study the wide disease spectrum of tuberculosis. Importantly, spontaneous latency and reactivation as well as adaptive immune responses in the context of mycobacterial infection can be studied in this model. In this article, we describe methods for the experimental infection of adult zebrafish, the collection of internal organs for the extraction of nucleic acids for the measurement of mycobacterial loads and host immune responses by quantitative PCR. The in-house-developed, M. marinum-specific qPCR assay is more sensitive than the traditional plating methods as it also detects DNA from non-dividing, dormant or recently dead mycobacteria. As both DNA and RNA are extracted from the same individual, it is possible to study the relationships between the diseased state, and the host and pathogen gene-expression. The adult zebrafish model for tuberculosis thus presents itself as a highly applicable, non-mammalian in vivo system to study host-pathogen interactions.

The natural fish pathogen Mycobacterium marinum infects the internal organs of the zebrafish and produces a systemic infection with histologically visible granulomas19. Adult zebrafish are infected with M. marinum by an intraperitoneal injection. The DNA and RNA are extracted, and the mycobacterial load is measured by quantitative polymerase chain reaction (qPCR) using DNA as the template. The outline of the method is shown in Figure 1.
The initial number of mycobacteria used for infecting the fish is a critical determinant for the outcome of infection. A high infection dose of M. marinum (~2,000 CFU) leads to a progressive disease in which the mycobacterial loads continue to increase until the average bacterial load reaches around five million bacteria (Figure 2A) ultimately killing the fish. A low dose (~20&#8211;90 CFU) of M. marinum leads to the development of a disease spectrum similar to that seen in human tuberculosis (Figure 2B). The bacterial load continues to increase until around 4&#8211;7 weeks (Figure 2A and&#160;Figure 3A), after which in the majority of the fish the disease reaches a steady-state. Figure 2B shows an example of the distribution of disease outcomes with a low dose infection: About 7% of the infected zebrafish were unable to restrict the bacterial growth. These individuals developed a primary progressive disease and they died within two months after the infection. Around 10% of the individuals cleared the mycobacterial infection by 4 weeks. The remaining 65% of the fish population developed a latent mycobacterial infection with steady bacterial burdens. However, between 8 and 32 weeks of infection, in 18%, the latent infection spontaneously reactivated leading to the progression of the disease.
By using rag-/- mutant fish, it is possible to study the role of adaptive immune responses in the adult fish. Rag-/- mutant fish cannot sufficiently limit the growth of mycobacteria leading to higher bacterial loads (Figure 3A) and increased morbidity (Figure 3B), clearly demonstrating the importance of adaptive immunity in controlling mycobacterial infection. Also, the importance of adaptive responses in evoking certain cytokine responses in mycobacterial infection can be studied in this model. Here, we show that the adaptive response is required for the efficient induction of interleukin 4 (IL4) (Figure 3C) but is dispensable for the induction of interferon-&#947; (IFN&#947;) at 4 wpi (Figure 3D). Interferon-&#947; is a cytokine driving the response against intracellular pathogens whereas interleukin 4 is a common mediator in the adaptive immune response against extracellular pathogens. The significantly higher expression levels of il4 in the wild-type group compared to rag-/- mutant fish refers to important adaptive humoral responses in the mycobacterial infection (Figure 3C).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58299/58299fig1.jpg" /> 
Figure 1: Workflow of studying the development of mycobacterial loads in the adult zebrafish. Adult zebrafish are infected with an intraperitoneal injection of M. marinum. DNA and RNA are extracted from the internal organs of the fish and the M. marinum load and host&#39;s immune responses are analyzed with quantitative polymerase chain reaction (qPCR). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58299/58299fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58299/58299fig2.jpg" /> 
Figure 2: Injection of M. marinum into adult zebrafish causes a spectrum of disease states.&#160;(A)&#160;Zebrafish were injected with a low (34 &#177;15 CFU) or a high dose (2029 &#177;709 CFU) of M. marinum. Average loads for 5 fish (except 32 weeks&#160;high dose, n = 2) are shown with SD. Low-dose statistics: * p &#60;0.05 compared with 1 week, ** p &#60;0.05 compared with 1 and 2 week. High-dose statistics: *** p &#60;0.05 compared with 1, 2, 8, 11 and 20 wk. &#164; low dose vs. high dose p&#60;0.05. Modified from Parikka et al. 201219. (B)&#160;Typical distribution of disease outcomes within a wild-type zebrafish population infected with a low-dose of M. marinum. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58299/58299fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58299/58299fig3.jpg" /> 
Figure 3: Adaptive immunity affects the course of mycobacterial infection in the adult zebrafish. Adult wild-type (wt) and rag1 (&#8722;/&#8722;) zebrafish were infected with a low dose (n = 30) of M. marinum. (A)&#160;The average mycobacterial loads were measured by qPCR at 2, 4, and 7 weeks post infection (wpi) (n = 10) *P&#60;0.05. (B)&#160;The fish were euthanized upon the development of symptoms of the disease and survival plots were created. (C). The expression levels of il4 were measured at 4 wpi. (D)&#160;The expression levels of IFN&#947; were measured at 4 wpi. (A and B)modified from Parikka et al. 201219. (C and D) Modified from Hammar&#233;n et al. 201438. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58299/58299fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td>Primer sequence</td>
			<td>Annealing temperature</td>
		</tr>
		<tr>
			<td>MMITS1</td>
			<td>F: CACCACGAGAAACACTCCAA</td>
			<td rowspan="2">65</td>
		</tr>
		<tr>
			<td>16S&#8211;23SITS Locus AB548718 for M. marinum quantification</td>
			<td>R: ACATCCCGAAACCAACAGAG</td>
		</tr>
		<tr>
			<td>loopern4</td>
			<td>F: TGAGCTGAAACTTTACAGACACAT</td>
			<td rowspan="2">61</td>
		</tr>
		<tr>
			<td>Expressed repetitive elements</td>
			<td>R: AGACTTTGGTGTCTCCAGAATG</td>
		</tr>
		<tr>
			<td>il4</td>
			<td>GCAGGAATGGCTTTGAAGGG</td>
			<td rowspan="2">59.5</td>
		</tr>
		<tr>
			<td>ZDB-GENE-100204-1</td>
			<td>GCAGTTTCCAGTCCCGGTAT</td>
		</tr>
		<tr>
			<td>ifn&#947;1-2 </td>
			<td>F: GGGCGATCAAGGAAAACGACCC,</td>
			<td rowspan="2">61</td>
		</tr>
		<tr>
			<td>ZDB-GENE-040629-1&#160;</td>
			<td>R: TAGCCTGCCGTCTCTTGCGT</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences and annealing temperatures. The sequences of the primers used and their optimized annealing temperatures. The primers for the M. marinum 16S-23S rRNA transcript have been optimized for a No-ROX qPCR kit and the other primers for a ROX including qPCR kit.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Time</td>
			<td>Temperature</td>
		</tr>
		<tr>
			<td>1</td>
			<td>3 min</td>
			<td>95 &#176;C</td>
		</tr>
		<tr>
			<td>2</td>
			<td>5 s</td>
			<td>95 &#176;C</td>
		</tr>
		<tr>
			<td>3</td>
			<td>10 s</td>
			<td>65 &#176;C</td>
		</tr>
		<tr>
			<td>4</td>
			<td>5 s&#160;</td>
			<td>72 &#176;C (fluorescence detection)</td>
		</tr>
		<tr>
			<td>5</td>
			<td>Go to step 2. 39 times</td>
			<td></td>
		</tr>
		<tr>
			<td>6</td>
			<td>Melting curve analysis 55-95&#176;C with 0.5&#176;C intervals</td>
			<td></td>
		</tr>
		<tr>
			<td>7</td>
			<td>Forever</td>
			<td>4 &#176;C</td>
		</tr>
	</tbody>
</table>
Table 2: qPCR program for measuring M. marinum DNA. A qPCR protocol designed according to the manufacturer&#39;s instructions and optimized for measuring M. marinum DNA from zebrafish samples.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Time</td>
			<td>Temperature</td>
		</tr>
		<tr>
			<td>5 min</td>
			<td>25 &#176;C</td>
		</tr>
		<tr>
			<td>30 min</td>
			<td>42 &#176;C</td>
		</tr>
		<tr>
			<td>5 min</td>
			<td>85 &#176;C</td>
		</tr>
		<tr>
			<td>forever</td>
			<td>4 &#176;C</td>
		</tr>
	</tbody>
</table>
Table 3: cDNA synthesis program. Protocol for synthesizing cDNA from the extracted RNA of an infected zebrafish according to the manufacturer&#39;s instructions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Time</td>
			<td>Temperature</td>
		</tr>
		<tr>
			<td>1</td>
			<td>30 s</td>
			<td>95 &#176;C</td>
		</tr>
		<tr>
			<td>2</td>
			<td>12 s</td>
			<td>95 &#176;C</td>
		</tr>
		<tr>
			<td>3</td>
			<td>30 s</td>
			<td>Annealing &#176;C</td>
		</tr>
		<tr>
			<td>4</td>
			<td>Go to step 2. for 39 times</td>
			<td></td>
		</tr>
		<tr>
			<td>5</td>
			<td>Melting curve analysis 65&#8211;95 &#176;C with 0.5 &#176;C intervals</td>
			<td></td>
		</tr>
		<tr>
			<td>6</td>
			<td>Forever</td>
			<td>4 &#176;C</td>
		</tr>
	</tbody>
</table>
Table 4: qPCR program for measuring host&#39;s gene expression. A qPCR protocol designed according to the manufacturer&#39;s instructions and optimized for measuring the expression of different zebrafish genes.

Watch this Scientific Journal Video about Modeling Tuberculosis in Mycobacterium marinum Infected Adult Zebrafish at JoVE.com

Modeling Tuberculosis in Mycobacterium marinum Infected Adult Zebrafish

Here, we present a protocol to model human tuberculosis in an adult zebrafish using its natural pathogen Mycobacterium marinum. Extracted DNA and RNA from the internal organs of infected zebrafish can be used to reveal the total mycobacterial loads in the fish and the host&#39;s immune responses with qPCR.

Modeling Tuberculosis in Mycobacterium marinum Infected Adult Zebrafish

Mycobacterium tuberculosis is currently the deadliest human pathogen causing 1.7 million deaths and 10.4 million infections every year. Exposure to this ...

modeling-tuberculosis-mycobacterium-marinum-infected-adult

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

10.5K Views.  University of Tampere. Deze methode kan helpen bij het beantwoorden van belangrijke vragen op het gebied van tuberculose, zoals wat is de rol van adaptieve immuunresponsen en de pathogenese van deze multifactoriële ziekte. Het belangrijkste voordeel van deze nucleïnezuurbasismethode is dat zowel bacteriële belastingen als genexpressieniveaus van dezelfde persoon kunnen worden gemeten. Om deze procedure te beginnen, cultuur M.marinum op een 7H10 plaat zoals beschreven in het tekstprotocol.Breng 10 millilit...

Video: Modeling Tuberculosis in Mycobacterium marinum Infected Adult Zebrafish

Infection of Zebrafish Embryos with Intracellular Bacterial Pathogens

Zebrafish (Danio rerio) embryos are increasingly used as a model for studying the function of the vertebrate innate immune system in host-pathogen interactions 1. The major cell types of the innate immune system, macrophages and neutrophils, develop during the first days of embryogenesis prior to the maturation of lymphocytes that are required for adaptive immune responses. The ease of obtaining large numbers of embryos, their accessibility due to external development, the optical transparency of embryonic and larval stages, a wide range of genetic tools, extensive mutant resources and collections of transgenic reporter lines, all add to the versatility of the zebrafish model. Salmonella enterica serovar Typhimurium (S. typhimurium) and Mycobacterium marinum can reside intracellularly in macrophages and are frequently used to study host-pathogen interactions in zebrafish embryos. The infection processes of these two bacterial pathogens are interesting to compare because S. typhimurium infection is acute and lethal within one day, whereas M. marinum infection is chronic and can be imaged up to the larval stage 2, 3. The site of micro-injection of bacteria into the embryo (Figure 1) determines whether the infection will rapidly become systemic or will initially remain localized. A rapid systemic infection can be established by micro-injecting bacteria directly into the blood circulation via the caudal vein at the posterior blood island or via the Duct of Cuvier, a wide circulation channel on the yolk sac connecting the heart to the trunk vasculature. At 1 dpf, when embryos at this stage have phagocytically active macrophages but neutrophils have not yet matured, injecting into the blood island is preferred. For injections at 2-3 dpf, when embryos also have developed functional (myeloperoxidase-producing) neutrophils, the Duct of Cuvier is preferred as the injection site. To study directed migration of myeloid cells towards local infections, bacteria can be injected into the tail muscle, otic vesicle, or hindbrain ventricle 4-6. In addition, the notochord, a structure that appears to be normally inaccessible to myeloid cells, is highly susceptible to local infection 7. A useful alternative for high-throughput applications is the injection of bacteria into the yolk of embryos within the first hours after fertilization 8. Combining fluorescent bacteria and transgenic zebrafish lines with fluorescent macrophages or neutrophils creates ideal circumstances for multi-color imaging of host-pathogen interactions. This video article will describe detailed protocols for intravenous and local infection of zebrafish embryos with S. typhimurium or M. marinum bacteria and for subsequent fluorescence imaging of the interaction with cells of the innate immune system.

Transparent zebrafish embryos have proved useful model hosts to visualize and functionally study interactions between innate immune cells and intracellular bacterial pathogens, such as Salmonella typhimurium and Mycobacterium marinum. Micro-injection of bacteria and multi-color fluorescence imaging are essential techniques involved in the application of zebrafish embryo infection models.

Zebrafish (Danio rerio) embryos are increasingly used as a model for studying the function of the vertebrate innate immune system in host-pathogen ...

Non-invasive Imaging of Disseminated Candidiasis in Zebrafish Larvae

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 to 40% attributable mortality6. Systemic candidiasis is normally controlled by innate immunity, and individuals with genetic defects in innate immune cell components such as phagocyte NADPH oxidase are more susceptible to candidemia7-9. Very little is known about the dynamics of C. albicans interaction with innate immune cells in vivo. Extensive in vitro studies have established that outside of the host C. albicans germinates inside of macrophages, and is quickly destroyed by neutrophils10-14. In vitro studies, though useful, cannot recapitulate the complex in vivo environment, which includes time-dependent dynamics of cytokine levels, extracellular matrix attachments, and intercellular contacts10, 15-18. To probe the contribution of these factors in host-pathogen interaction, it is critical to find a model organism to visualize these aspects of infection non-invasively in a live intact host. 
The zebrafish larva offers a unique and versatile vertebrate host for the study of infection. For the first 30 days of development zebrafish larvae have only innate immune defenses2, 19-21, simplifying the study of diseases such as disseminated candidiasis that are highly dependent on innate immunity. The small size and transparency of zebrafish larvae enable imaging of infection dynamics at the cellular level for both host and pathogen. Transgenic larvae with fluorescing innate immune cells can be used to identify specific cells types involved in infection22-24. Modified anti-sense oligonucleotides (Morpholinos) can be used to knock down various immune components such as phagocyte NADPH oxidase and study the changes in response to fungal infection5. In addition to the ethical and practical advantages of using a small lower vertebrate, the zebrafish larvae offers the unique possibility to image the pitched battle between pathogen and host both intravitally and in color. 
The zebrafish has been used to model infection for a number of human pathogenic bacteria, and has been instrumental in major advances in our understanding of mycobacterial infection3, 25. However, only recently have much larger pathogens such as fungi been used to infect larva5, 23, 26, and to date there has not been a detailed visual description of the infection methodology. Here we present our techniques for hindbrain ventricle microinjection of prim25 zebrafish, including our modifications to previous protocols. Our findings using the larval zebrafish model for fungal infection diverge from in vitro studies and reinforce the need to examine the host-pathogen interaction in the complex environment of the host rather than the simplified system of the Petri dish5.

The rapid development, small size and transparency of zebrafish are tremendous advantages for the study of innate immune control of infection1-4. Here we demonstrate techniques for infecting zebrafish larvae using the fungal pathogen Candida albicans by microinjection, methodology recently used to implicate phagocyte NADPH oxidase activity in control of fungal dimorphism5.

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 ...

Establishment and Optimization of a High Throughput Setup to Study Staphylococcus epidermidis and Mycobacterium marinum Infection as a Model for Drug Discovery

Zebrafish are becoming a valuable tool in the preclinical phase of drug discovery screenings as a whole animal model with high throughput screening possibilities. They can be used to bridge the gap between cell based assays at earlier stages and in vivo validation in mammalian models, reducing, in this way, the number of compounds passing through to testing on the much more expensive rodent models. In this light, in the present manuscript is described a new high throughput pipeline using zebrafish as in vivo model system for the study of Staphylococcus epidermidis and Mycobacterium marinum infection. This setup allows the generation and analysis of large number of synchronous embryos homogenously infected. Moreover the flexibility of the pipeline allows the user to easily implement other platforms to improve the resolution of the analysis when needed. The combination of the zebrafish together with innovative high throughput technologies opens the field of drug testing and discovery to new possibilities not only because of the strength of using a whole animal model but also because of the large number of transgenic lines available that can be used to decipher the mode of action of new compounds.

Establishment and Optimization of a High Throughput Setup to Study Staphylococcus epidermidis and Mycobacterium marinum Infection as a Model for Drug Discovery

This video article describes the high throughput pipeline that has been successfully established to infect and analyze large numbers of zebrafish embryos providing a new powerful tool for compound testing and drug discovery using a whole animal vertebrate organism.

Zebrafish are becoming a valuable tool in the preclinical phase of drug discovery screenings as a whole animal model with high throughput screening ...

Modeling Mucosal Candidiasis in Larval Zebrafish by Swimbladder Injection

Early defense against mucosal pathogens consists of both an epithelial barrier and innate immune cells. The immunocompetency of both, and their intercommunication, are paramount for the protection against infections. The interactions of epithelial and innate immune cells with a pathogen are best investigated in vivo, where complex behavior unfolds over time and space. However, existing models do not allow for easy spatio-temporal imaging of the battle with pathogens at the mucosal level.
The model developed here creates a mucosal infection by direct injection of the fungal pathogen, Candida albicans, into the swimbladder of juvenile zebrafish. The resulting infection enables high-resolution imaging of epithelial and innate immune cell behavior throughout the development of mucosal disease. The versatility of this method allows for interrogation of the host to probe the detailed sequence of immune events leading to phagocyte recruitment and to examine the roles of particular cell types and molecular pathways in protection. In addition, the behavior of the pathogen as a function of immune attack can be imaged simultaneously by using fluorescent protein-expressing C. albicans. Increased spatial resolution of the host-pathogen interaction is also possible using the described rapid swimbladder dissection technique.
The mucosal infection model described here is straightforward and highly reproducible, making it a valuable tool for the study of mucosal candidiasis. This system may also be broadly translatable to other mucosal pathogens such as mycobacterial, bacterial or viral microbes that normally infect through epithelial surfaces.

In vivo spatio-temporal interactions of pathogen and immune defenses at the mucosal level are not easily imaged in existing vertebrate hosts. The method presented here describes a versatile platform to study mucosal candidiasis in live vertebrates using the swimbladder of the juvenile zebrafish as an infection site.

Early defense against mucosal pathogens consists of both an epithelial barrier and innate immune cells. The immunocompetency of both, and their ...

Deciphering and Imaging Pathogenesis and Cording of Mycobacterium abscessus in Zebrafish Embryos

Zebrafish (Danio rerio) embryos are increasingly used as an infection model to study the function of the vertebrate innate immune system in host-pathogen interactions.&#160;The ease of obtaining large numbers of embryos, their accessibility due to external development, their optical transparency as well as the availability of a wide panoply of genetic/immunological tools and transgenic reporter line collections, contribute to the versatility of this model.&#160;In this respect, the present manuscript describes the use of zebrafish as an&#160;in vivo&#160;model system to investigate the chronology of Mycobacterium abscessus infection. This human pathogen can exist either as smooth (S) or rough (R) variants, depending on cell wall composition, and their respective virulence can be imaged and compared in zebrafish embryos and larvae. Micro-injection of either S or R fluorescent variants directly in the blood circulation via the caudal vein, leads to chronic or acute/lethal infections, respectively. This biological system allows high resolution visualization and analysis of the role of mycobacterial cording in promoting abscess formation. In addition, the use of fluorescent bacteria along with transgenic zebrafish lines harbouring fluorescent macrophages produces a unique opportunity for multi-color imaging of the host-pathogen interactions. This article describes detailed protocols for the preparation of homogenous M. abscessus inoculum and for intravenous injection of zebrafish embryos for subsequent fluorescence imaging of the interaction with macrophages. These techniques open the avenue to future investigations involving mutants defective in cord formation and are dedicated to understand how this impacts on M. abscessus pathogenicity in a whole vertebrate.

Deciphering and Imaging Pathogenesis and Cording of Mycobacterium abscessus in Zebrafish Embryos

Optically transparent zebrafish embryos are widely used to study and visualize in real time the interactions between pathogenic microorganisms and the innate immune cells. Micro-injection of Mycobacterium abscessus, combined with fluorescence imaging, is used to scrutinize essential pathogenic features such as cord formation in zebrafish embryos.

Zebrafish (Danio rerio) embryos are increasingly used as an infection model to study the function of the vertebrate innate immune system in host-pathogen ...

A Zebrafish Embryo Model for In Vivo Visualization and Intravital Analysis of Biomaterial-associated Staphylococcus aureus Infection

Biomaterial-associated infection (BAI) is a major cause of the failure of biomaterials/medical devices. Staphylococcus aureus is one of the major pathogens in BAI. Current experimental BAI mammalian animal models such as mouse models are costly and time-consuming, and therefore not suitable for high throughput analysis. Thus, novel animal models as complementary systems for investigating BAI in vivo are desired. In the present study, we aimed to develop a zebrafish embryo model for in vivo visualization and intravital analysis of bacterial infection in the presence of biomaterials based on fluorescence microscopy. In addition, the provoked macrophage response was studied. To this end, we used fluorescent protein-expressing S. aureus and transgenic zebrafish embryos expressing fluorescent proteins in their macrophages and developed a procedure to inject bacteria alone or together with microspheres into the muscle tissue of embryos. To monitor bacterial infection progression in live embryos over time, we devised a simple but reliable method of microscopic scoring of fluorescent bacteria. The results from microscopic scoring showed that all embryos with more than 20 colony-forming units (CFU) of bacteria yielded a positive fluorescent signal of bacteria. To study the potential effects of biomaterials on infection, we determined the CFU numbers of S. aureus with and without 10 &#181;m polystyrene microspheres (PS10) as model biomaterials in the embryos. Moreover, we used the ObjectJ project file &#34;Zebrafish-Immunotest&#34; operating in ImageJ to quantify the fluorescence intensity of S. aureus infection with and without PS10 over time. Results from both methods showed higher numbers of S. aureus in infected embryos with microspheres than in embryos without microspheres, indicating an increased infection susceptibility in the presence of the biomaterial. Thus, the present study shows the potential of the zebrafish embryo model to study BAI with the methods developed here.

A Zebrafish Embryo Model for In Vivo Visualization and Intravital Analysis of Biomaterial-associated Staphylococcus aureus Infection

The present study describes a zebrafish embryo model for in vivo visualization and intravital analysis of biomaterial-associated infection over time based on fluorescence microscopy. This model is a promising system complementing mammalian animal models such as mouse models for studying biomaterial-associated infections in vivo.

Biomaterial-associated infection (BAI) is a major cause of the failure of biomaterials/medical devices. Staphylococcus aureus is one of the major ...

Bioengineering

Immunization of Adult Zebrafish for the Preclinical Screening of DNA-based Vaccines

The interest in DNA-based vaccination has increased during the past two decades. DNA vaccination is based on the cloning of a sequence of a selected antigen or a combination of antigens into a plasmid, which enables a tailor-made and safe design. The administration of DNA vaccines into host cells leads to the expression of antigens that stimulate both humoral and cell-mediated immune responses. This report describes a protocol for the cloning of antigen sequences into the pCMV-EGFP plasmid, the immunization of adult zebrafish with the vaccine candidates by intramuscular microinjection, and the subsequent electroporation to improve intake. The vaccine antigens are expressed as green fluorescent protein (GFP)-fusion proteins, which allows the confirmation of the antigen expression under UV light from live fish and the quantification of expression levels of the fusion protein with ELISA, as well as their detection with a western blot analysis. The protective effect of the vaccine candidates is tested by infecting the fish with Mycobacterium marinum five weeks postvaccination, followed by the quantification of the bacteria with qPCR four weeks later. Compared to mammalian preclinical screening models, this method provides a cost-effective method for the preliminary screening of novel DNA-based vaccine candidates against a mycobacterial infection. The method can be further applied to screening DNA-based vaccines against various bacterial and viral diseases.

Here we describe a protocol for the immunization of the adult zebrafish (Danio rerio) with a DNA-based vaccine and demonstrate the validation of a successful vaccination event. This method is suitable for the preclinical screening of vaccine candidates in various infection models.

The interest in DNA-based vaccination has increased during the past two decades. DNA vaccination is based on the cloning of a sequence of a selected ...

Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex

Tuberculosis is the leading global cause of infectious disease mortality and roughly a quarter of the world&#8217;s population is believed to be infected with Mycobacterium tuberculosis. Despite decades of research, many of the mechanisms behind the success of M. tuberculosis as a pathogenic organism remain to be investigated, and the development of safer, more effective antimycobacterial drugs are urgently needed to tackle the rise and spread of drug resistant tuberculosis. However, the progression of tuberculosis research is bottlenecked by traditional mammalian infection models that are expensive, time consuming, and ethically challenging. Previously we established the larvae of the insect Galleria mellonella (greater wax moth) as a novel, reproducible, low cost, high-throughput and ethically acceptable infection model for members of the M. tuberculosis complex. Here we describe the maintenance, preparation, and infection of G. mellonella with bioluminescent Mycobacterium bovis BCG lux. Using this infection model, mycobacterial dose dependent virulence can be observed, and a rapid readout of in vivo mycobacterial burden using bioluminescence measurements is easily achievable and reproducible. Although limitations exist, such as the lack of a fully annotated genome for transcriptomic analysis, ontological analysis against genetically similar insects can be carried out. As a low cost, rapid, and ethically acceptable model for tuberculosis, G. mellonella can be used as a pre-screen to determine drug efficacy and toxicity, and to determine comparative mycobacterial virulence prior to the use of conventional mammalian models. The use of the G. mellonella-mycobacteria model will lead to a reduction in the substantial number of animals currently used in tuberculosis research.

Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex

Galleria mellonella was recently established as a reproducible, cheap, and ethically acceptable infection model for the Mycobacterium tuberculosis complex. Here we describe and demonstrate the steps taken to establish successful infection of G. mellonella with bioluminescent Mycobacterium bovis BCG lux.

Tuberculosis is the leading global cause of infectious disease mortality and roughly a quarter of the world&#8217;s population is believed to be infected ...

Visualization of Macrophage Lytic Cell Death During Mycobacterial Infection in Zebrafish Embryos via Intravital Microscopy

Zebrafish is an excellent model organism for studying innate immune cell behavior due to its transparent nature and reliance solely on its innate immune system during early development. The Zebrafish Mycobacterium marinum (M. marinum) infection model has been well-established in studying host immune response against mycobacterial infection. It has been suggested that different macrophage cell death types will lead to the diverse outcomes of mycobacterial infection. Here we describe a protocol using intravital microscopy to observe macrophage cell death in zebrafish embryos following M. marinum infection. Zebrafish transgenic lines that specifically label macrophages and neutrophils are infected via intramuscular microinjection of fluorescently labeled M. marinum in either the midbrain or the trunk. Infected zebrafish embryos are subsequently mounted on low melting agarose and observed by confocal microscopy in X-Y-Z-T dimensions. Because long-term live imaging requires using low laser power to avoid photobleaching and phototoxicity, a strongly expressing transgenic is highly recommended. This protocol facilitates the visualization of the dynamic processes in vivo, including immune cell migration, host pathogen interaction, and cell death.

This protocol describes a technique for visualizing macrophage behavior and death in embryonic zebrafish during Mycobacterium marinum infection. Steps for the preparation of bacteria, infection of the embryos, and intravital microscopy are included. This technique may be applied to the observation of cellular behavior and death in similar scenarios involving infection or sterile inflammation.

Zebrafish is an excellent model organism for studying innate immune cell behavior due to its transparent nature and reliance solely on its innate immune ...

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

Health monitoring systems are developed and used in zebrafish research facilities because pathogens of Danio rerio such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa have the potential to impair animal welfare and research. The fish are typically analyzed post mortem to detect microbes. The use of sentinels is a suggested way to improve the sensitivity of the surveillance and to reduce the number of animals to sample. The setting of a pre-filtration sentinel tank out of a recirculating system is described. The technique is developed to prevent water pollution and to represent the fish population by a careful selection of age, gender, and strains. In order to use the minimum number of animals, techniques to screen the environment are also detailed. Polymerase Chain Reaction (PCR) on surface sump swabs is used to significantly improve the detection of some prevalent and pathogenic mycobacterial species such as Mycobacterium fortuitum, Mycobacterium haemophilum, and Mycobacterium chelonae. Another environmental method consists of processing the sludge at the bottom of a holding tank or sump to look for P. tomentosa eggs. This is a cheap and fast technique that can be applied in quarantine where a breeding device is submerged into the holding tank of imported animals. Finally, PCR is applied to the sludge sample and A. hydrophila is detected at the sump&#39;s bottom and surface. Generally, these environmental screening techniques applied to these specific pathogens have led to an increased sensitivity compared to the testing of pre-filtration sentinels.

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

This protocol describes the use of sump swabs and sludge analysis of zebrafish systems, which leads to increased detection compared to the sole use of sentinels to detect pathogens such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa. A system to monitor P. tomentosa eggs in quarantine is also proposed.

Modeling Tuberculosis in Mycobacterium marinum Infected Adult Zebrafish

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video