We acknowledge Brian Tullius for his kind help in editing the manuscript.

Healthy donor buffy coats were obtained as source material from the Central Ohio Region American Red Cross. This research was determined to be exempt research by the Institutional Review Board of Nationwide Children&#8217;s Hospital.
1. Human NK Cell Purification and Expansion
<ol>
	<li>Isolate PBMCs from Buffy Coat12.
	<ol>
		<li>Layer 35 mL of buffy coat sample on 15 mL of Ficoll-Paque.</li>
		<li>Centrifuge at 400 x g for 20 minutes without brake and collect the PBMC from the interface.</li>
		<li>Wash the recovered PBMCs three times by adding at least an equal volume of PBS, centrifuging at 400 x g for 5 minutes, and aspirating the PBC wash. NK cell can be isolated at this stage by RosettesSep13.</li>
	</ol>
	</li>
	<li>Expand NK cells by stimulating with irradiated 10 x 106 mbIL21-expressing feeder cells at Days 0, 7, and 14. Replace media with fresh RPMI containing 10% FBS, 1% Glutamine, 1% Penicillin Streptomycin, and 100 IU/mL of IL-2 for the entire media volume every other day.</li>
</ol>
2. gRNA Design and Selection
<ol>
	<li>Choose the specific genomic loci to target, using online tools, e.g., NCBI, Ensemble. 
	Example. 
	Description: Transforming growth factor beta receptor 2 (TGFBRR2) ectodomain 
	View record: PF08917 
	View InterPro: IPR015013 
	Position: 49 - 157 aa 
	Targeted Sequence: Exon 4 of TGFBR2 gene (ENSG00000163513)</li>
	<li>To design the gRNAs, use CRISPR design web tools such as http://crispr.mit.edu and &#8216;Benchling.&#8217;
	<ol>
		<li>Enter in the DNA sequence chosen in step 2.1. Choose human (hg 19) as a target genome. CRISPR guides (20 nucleotides followed by a PAM sequence: NGG) will be scanned from the sequence entered earlier. It also shows possible off-target matches throughout the selected genome.</li>
		<li>Choose the best three gRNAs which have the highest score, based on their on-target and off-target rates. For example, Table 1 shows the designed CRISPR RNAs to target exon 4 of TGFBR2 gene suggested by CRISPR design web tools.</li>
	</ol>
	</li>
	<li>Order the CRISPR RNAs as synthetic sequence-specific crRNAs.</li>
	<li>Order a conserved, transactivating RNA (tracrRNA) to interact through partial homology with the crRNA.</li>
</ol>
3. Design Deletion Screening Primers
<ol>
	<li>Design primers spanning the gRNA cleavage sites for T7E1 mutation assay.</li>
	<li>Use primers at least 100 bp away from the predicted cleavage site to ensure small insertion-deletion (indels) at the sgRNA target site will appear on 1.5% agarose gel following the mutation assay. Table 2 shows the primers which are used to amplify the TGFBR2 ectodomain.</li>
</ol>
4. Transduction of Human Primary and Expanded NK Cells
Note: Transduction of Cas9/RNPs elements into NK is done by electroporation using 4D system as follows.
<ol>
	<li>Cell Preparation 
	<ol>
		<li>For primary NK cells, incubate freshly isolated NK cells in RPMI medium in the presence of 100 IU/mL of IL-2 for 4 days and perform the electroporation at Day 5. Replace the media every other day as described earlier and the day before transduction.</li>
		<li>For expanded NK cells, stimulate the cells at day 0 with irradiated feeder cells at a ratio of 1:1 and perform the electroporation at Day 5 or 6 or 7. Replace the media every other day as described earlier and the day before transduction.</li>
		<li>On the day of electroporation, prepare a T25 flask filled with 8 mL of fresh RPMI containing 100 IU/mL of IL-2 for cells undergoing electroporation and pre-incubate flasks in a humidified 37 &#176;C and 5% CO2 incubator. 
		Note: Thawed cells or cells that have undergone 2nd or 3rd stimulation can be electroporated at any time after their recovery as described.</li>
		<li>Take 3 - 4 &#215; 106 cells per condition for 26 &#181;L of transduction mix. 
		Note: Very high concentration of NK cells in electroporation solution enhances the transduction rate.</li>
		<li>Wash the cells 3 times with PBS to remove all FBS, which commonly contains RNase activity. Spin them down each time at 300 x g for 8 minutes. 
		Note: Consider 7 electroporation conditions for Cas/RNPs as single gRNA (gRNA1, gRNA2, gRNA3) and a combination of two gRNAs (gRNA1+gRNA2, gRNA1+gRNA3, gRNA2+gRNA3) and one control with no Cas9/RNPs.</li>
	</ol>
	</li>
	<li>Form the crRNA:tracerRNA/complex
	<ol>
		<li>Resuspend crRNAs (gRNA1, gRNA2, and gRNA3) and tracerRNA in 1x&#160;TE solution to final concentrations of 200 &#956;M. Mix 2.2 &#956;L of each 200 &#956;M gRNA with 200 &#956;M tracerRNA as shown in Table 3.</li>
		<li>Heat the samples at 95 &#176;C for 5 min and allow to cool on the bench top to room temperature (15 - 25 &#176;C). Store resuspended RNAs and crRNA: tracerRNA/complex at -20 &#176;C for later use.</li>
	</ol>
	</li>
	<li>Form the RNP complex 
	Note: To save time, form the RNP complex during the washing step 4.1.5.
	<ol>
		<li>For single crRNA:tracrRNA duplex reaction, dilute Cas9 endonuclease to 36 &#956;M as shown by the example in Table 4.</li>
		<li>For combination transduction of crRNA:tracrRNA duplexes, dilute Cas9 endonuclease to 36 &#956;M as shown by the example in Table 5. </li>
		<li>Add Cas9 endonuclease to crRNA:tracrRNA duplexes slowly while swirling pipette tip, over 30 s to 1 minute.</li>
		<li>Incubate the mixture at room temperature for 15 - 20 min. If not ready to use the mixture after incubation, keep the mixture on ice until use.</li>
	</ol>
	</li>
	<li>Electroporation 
	<ol>
		<li>Add the entire supplement to the electroporation solution P3 and keep it at room temperature.</li>
		<li>Resuspend the cell pellet (3 - 4 &#215; 106 cells from step 4.1.5) in 20 &#956;L of P3 primary 4D electroporation solution. Avoid air bubbles while pipetting. 
		Note: The cells should not be left for a long time in P3 solution.</li>
		<li>Immediately add 5 &#181;L of RNP complex (Step 4.3) to the cell suspension.</li>
		<li>Add 1 &#956;L of 100 &#956;M Cas9 electroporation enhancer to the Cas9/RNPs/cell mix.</li>
		<li>Transfer Cas9/RNPs/cell mix into 20 &#956;L electroporation strips.</li>
		<li>Gently tap the strips to make sure that the sample covers the bottom of the strips.</li>
		<li>Start 4D electroporation system and choose the EN-138 program.</li>
	</ol>
	</li>
</ol>
5. Post Transduction
<ol>
	<li>Let the cells rest for 3 minutes in the strips.</li>
	<li>Add 80 &#181;L of the pre-equilibrated culture media to the cuvette and gently transfer the sample into flasks.</li>
	<li>48 hours after transduction, extract genomic DNA from 5 &#215; 105 cells for the gene deletions screening.</li>
	<li>Amplify the gene of interest using the primers designed in step 3.2 with Taq DNA polymerase kits.</li>
	<li>Form PCR amplicon heteroduplexes for T7EI digestion and incubate the product for 30 -&#160;60 minutes with a T7EI enzyme in 37 &#176;C. 
	Note: The T7EI assay is preferred for screening as it is fast, simple and provides clean electrophoresis results compared to using surveyor assay. However, this method cannot detect insertions and deletions of &#60;2 bases that are generated by non-homologous end joining (NHEJ) activity in Cas9 RNPs experiments14.</li>
	<li>Run the digested DNA on 1.5% agarose gel at 110 V for 30 - 45 minutes, every 15 minutes visualize the gel.</li>
	<li>Stimulate the rest of the cells with the mbIL21-expressing feeder cells at a ratio of 1:1.</li>
	<li>Five days after stimulation extract the RNA for gene expression level using qPCR.</li>
	<li>Conduct calcein assays as previously reported12. Briefly, load target cells with calcein AM (in the example shown, 3 &#181;g/mL/1,000,000 DAOY cells was used). Prepare NK cells for cytotoxicity assays by resting overnight in IL2 (100 IU/mL) plus or minus 10 ng/mL soluble TGF&#946;. Conduct calcein assays in the same cytokines as the NK cells were rested in overnight.</li>
</ol>

<ol>
	<li>Guven, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+gene+transfer+into+primary+human+natural+killer+cells+by+retroviral+transduction.">Efficient gene transfer into primary human natural killer cells by retroviral transduction.</a> Experimental Hematology. 33 (11), 1320-1328 (2005).</li><li>Alici, E., Sutlu, T., Sirac Dilber, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+gene+transfer+into+primary+human+natural+killer+cells.">Retroviral gene transfer into primary human natural killer cells.</a> Methods in Molecular Biology. 508, 127-137 (2009).</li><li>Carlsten, M., Childs, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Manipulation+of+NK+Cells+for+Cancer+Immunotherapy:+Techniques+and+Clinical+Implications.">Genetic Manipulation of NK Cells for Cancer Immunotherapy: Techniques and Clinical Implications.</a> Frontiers in Immunology. 6, 266 (2015).</li><li>Mehta, R. S., Rezvani, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+Antigen+Receptor+Expressing+Natural+Killer+Cells+for+the+Immunotherapy+of+Cancer.">Chimeric Antigen Receptor Expressing Natural Killer Cells for the Immunotherapy of Cancer.</a> Frontiers in Immunology. 283, 9 (2018).</li><li>Zuris, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+lipid-mediated+delivery+of+proteins+enables+efficient+protein-based+genome+editing+in+vitro+and+in+vivo.">Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo.</a> Nature Biotechnology. 33 (1), 73-80 (2015).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+delivery+of+genome-editing+proteins+using+bioreducible+lipid+nanoparticles.">Efficient delivery of genome-editing proteins using bioreducible lipid nanoparticles.</a> PNAS. 113 (11), 2868-2873 (2016).</li><li>Liang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+DNA-free+genome+editing+of+bread+wheat+using+CRISPR/Cas9+ribonucleoprotein+complexes.">Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes.</a> Nature Communications. 8, 14261 (2017).</li><li>DeWitt, M. A., Corn, J. E., Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+via+delivery+of+Cas9+ribonucleoprotein.">Genome editing via delivery of Cas9 ribonucleoprotein.</a> Methods. , 9-15 (2017).</li><li>Rezvani, K., Rouce, R., Liu, E., Shpall, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+Natural+Killer+Cells+for+Cancer+Immunotherapy.">Engineering Natural Killer Cells for Cancer Immunotherapy.</a> Molecular Therapy. 25 (8), 1769-1781 (2017).</li><li>Sutlu, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+intracellular+antiviral+defense+mechanisms+augments+lentiviral+transduction+of+human+natural+killer+cells:+implications+for+gene+therapy.">Inhibition of intracellular antiviral defense mechanisms augments lentiviral transduction of human natural killer cells: implications for gene therapy.</a> Human Gene Therapy. 23 (10), 1090-1100 (2012).</li><li>Viel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta+inhibits+the+activation+and+functions+of+NK+cells+by+repressing+the+mTOR+pathway.">TGF-beta inhibits the activation and functions of NK cells by repressing the mTOR pathway.</a> Science Signaling. 9 (415), (2016).</li><li>Somanchi, S. S., Senyukov, V. V., Denman, C. J., Lee, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion,+purification,+and+functional+assessment+of+human+peripheral+blood+NK+cells.">Expansion, purification, and functional assessment of human peripheral blood NK cells.</a> JoVE. (48), (2011).</li><li>Lee, D. A., Verneris, M. R., Campana, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acquisition,+preparation,+and+functional+assessment+of+human+NK+cells+for+adoptive+immunotherapy.">Acquisition, preparation, and functional assessment of human NK cells for adoptive immunotherapy.</a> Methods in Molecular Biology. , 61-77 (2010).</li><li>Vouillot, L., Thelie, A., Pollet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+T7E1+and+surveyor+mismatch+cleavage+assays+to+detect+mutations+triggered+by+engineered+nucleases.">Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases.</a> G3. 5 (3), 407-415 (2015).</li><li>Eyquem, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+CAR+to+the+TRAC+locus+with+CRISPR/Cas9+enhances+tumour+rejection.">Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection.</a> Nature. 543 (7643), 113-117 (2017).</li><li>Liang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+highly+efficient+mammalian+cell+engineering+via+Cas9+protein+transfection.">Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.</a> Journal of Biotechnology. 208, 44-53 (2015).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chmielecki, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+Profiling+of+a+Large+Set+of+Diverse+Pediatric+Cancers+Identifies+Known+and+Novel+Mutations+across+Tumor+Spectra.">Genomic Profiling of a Large Set of Diverse Pediatric Cancers Identifies Known and Novel Mutations across Tumor Spectra.</a> Cancer Research. 77 (2), 509-519 (2017).</li><li>Schultz, L. M., Majzner, R., Davis, K. L., Mackall, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+immunotherapy+for+pediatric+solid+tumors.">New developments in immunotherapy for pediatric solid tumors.</a> Current Opinion in Pediatrics. 30 (1), 30-39 (2018).</li></ol>

DAL serves/has served as a consultant for Courier Therapeutics, Obsidian Therapeutics, Intellia Therapeutics, Merck Research Laboratories, and Miltenyi Biotec, and has equity/Leadership in CytoSen Therapeutics.

DNA-dependent modification of NK cells has been challenging4,9. We, therefore, introduced directly a synthetically preformed ribonucleoprotein (RNPs) complex and Cas9 protein as purified protein into primary and expanded NK cells8. This method allowed us to eliminate capping, tailing, and other transcriptional and translational processes started by RNA polymerase II, which may cause NK cell apoptosis associated with DNA-dependent transduction methods.
In addition, the method reported here uses purified Cas9 protein complexed as Cas9/RNPs, which are active immediately following electroporation and are degraded quickly, thereby increasing on-target and decreasing off-target effects over current protocols5,6,7,16. Furthermore, optimizing a new electroporation approach to transduce Cas9/RNP with high efficiency is another critical step introduced here, which are applicable to any other genes of interest. This method may be scaled up for modification of larger numbers of NK cells using commercially available larger electroporation cuvettes (data not shown).
In summary, Cas9/RNPs can be used to genetically modify human primary and expanded NK cells for cancer immunotherapy utilizing the above described method. Our results also demonstrated that a successful knockout of the TGFBR2 ectodomain gene leads to these modified NK cells becoming TGF&#946;1 resistant11.
Combining RNP delivery with a source of template DNA (such as naturally recombinogenic adeno-associated virus (AAV) donor vectors) may enable site-specific gene insertion by homologous recombination3,18,19.

Cancer immunotherapy has been advanced in recent years. Genetically-modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells successfully deployed in cancer immunotherapy. These cells were recently approved by the FDA for treatment against CD19 + B cell malignancies, but success has so far been limited to diseases bearing a few targetable antigens, and targeting such limited antigenic repertoires is prone to failure by immune escape. Furthermore, CAR T cells have been focused on the use of autologous T cells because of the risk of graft-versus-host disease caused by allogeneic T cells. In contrast, NK cells are able to kill tumor targets in an antigen-independent manner and do not cause GvHD, which makes them a good candidate for cancer immunotherapy6,7,8,9.
CRISPR/Cas9 technology has been used recently in engineering immune cells, but genetically reprogramming NK cells with plasmids has always been challenging. This has been due to difficulties in transgene delivery in a DNA dependent manner such as lentiviral and retroviral transduction causing substantial procedure-associated NK cell apoptosis and the limited production of genetically engineered NK cells4,9.
Many innate immune cells express high levels of receptors for pathogen-associated molecular patterns such as Retinoic acid-inducible gene I (RIG-I), which enable heightened recognition of foreign DNA. Suppression of these pathways has enabled higher transduction efficiency in NK cells when using DNA-based methods for genetic modification10.
We describe here the method for using a DNA-free genome editing of primary and expanded human NK cells utilizing Cas9 ribonucleoprotein complexes (Cas9/RNPs). Cas9/RNPs is composed of three components, recombinant Cas9 protein complexed with synthetic single-guide RNA comprised of a complexed crRNA and tracerRNA. These Cas9/RNPs are capable of cleaving genomic targets with higher efficiency as compared to foreign DNA-dependent approaches due to their delivery as functional complexes. Additionally, rapid clearance of Cas9/RNPs from the cells may reduce the off-target effects such as induction of apoptosis. Thus, they can be used to generate knock-outs, or knock-ins when combined with DNA for homologous recombination6,7. We showed that electroporation of Cas9/RNPs is an easy and relatively efficient method that overcomes the previous constraints of genetic modification in NK cells.
TGF&#946; is a major immunosuppressive cytokine, which inhibits the activation and functions of NK cells. It has been suggested that targeting the TGF&#946; pathway can increase immune cell functions. We targeted the region encoding TGBR2 ectodomain which binds TGF&#946;11. The representative results show a significant decrease in the level of mRNA expression of this gene and further demonstrate that the modified NK cells become resistant to TGF&#946;. In addition, the modified cells retain viability and proliferative potential, as they are able to be expanded post-electroporation using irradiated feeder cells. Therefore, the following method is a promising approach to genetically manipulate NK cells for any further clinical or research purposes.

<table><tbody><tr><td>RosetteSep&amp;trade; Human NK Cell Enrichment Cocktail</td><td>STEMCELL Technologies</td><td>15065</td><td>The RosetteSep&amp;trade; Human NK Cell Enrichment Cocktail is designed to isolate NK cells from whole blood by negative selection.</td></tr><tr><td>Ficoll-Paque&amp;reg; PLUS</td><td>GE Healthcare - Life Sciences</td><td>17-1440-02</td><td></td></tr><tr><td>Alt-R&amp;reg; CRISPR-Cas9 tracrRNA</td><td>Integrated DNA Technologies</td><td>1072532</td><td>TracrRNA that contains proprietary chemical modifications conferring increased nuclease resistance. Hybridizes to crRNA to activate the Cas9 enzyme</td></tr><tr><td>Alt-R&amp;reg; CRISPR-Cas9 crRNA</td><td>Integrated DNA Technologies</td><td></td><td>Synthetically produced as Alt-R&amp;reg; CRISPR-Cas9 crRNA, based on the sequence of designed gRNA targeting the gene of intrest</td></tr><tr><td>Alt-R&amp;reg; Genome Editing Detection Kit</td><td>Integrated DNA Technologies</td><td>1075931</td><td>Each kit contains T7EI endonuclease, T7EI reaction buffer, and T7EI assay controls.</td></tr><tr><td>Platinum&amp;reg; Taq DNA Polymerase High Fidelity</td><td>Invitrogen</td><td>11304-011</td><td></td></tr><tr><td>4D-Nucleofector&amp;trade; System</td><td>Lonza</td><td>AAF-1002B</td><td></td></tr><tr><td>Human recombinant IL-2 Protein</td><td>Novartis</td><td>65483-0116-07</td><td></td></tr><tr><td>P3 Primary Cell 4D-Nucleofector&amp;trade; X Kit</td><td>Lonza</td><td>V4XP-3032</td><td>Contains pmaxGFP&amp;trade; Vector, Nucleofector&amp;trade; Solution, Supplement, 16-well Nucleocuvette&amp;trade; Strips</td></tr><tr><td>Non-targeting: Custom siRNA, Standard 0.05 2mol ON-TARGETplus</td><td>Dharmacon</td><td>CTM-360019</td><td></td></tr><tr><td>Alt-R&amp;reg; S.p. Cas9 Nuclease 3NLS</td><td>Integrated DNA Technologies</td><td>1074181</td><td>Cas9 Nuclease</td></tr><tr><td>DNeasy&amp;reg; Blood &amp;amp; Tissue Handbook</td><td>Qiagen</td><td>69504</td><td></td></tr><tr><td>RNeasy Mini Kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>Calcein AM</td><td>ThermoFisher</td><td>C3099</td><td></td></tr><tr><td>TGF&amp;beta;</td><td>Biolegend</td><td>580706</td><td></td></tr><tr><td>Alt-R&amp;reg; CRISPR-Cas9 Control Kit, Human</td><td>Integrated DNA Technologies</td><td>1072554</td><td>Includes tracrRNA, HPRT positive control crRNA, negative control crRNA#1, HPRT Primer Mix, and Nuclease-Free Duplex Buffer.</td></tr><tr><td>IDTE pH 7.5 (1X TE Solution)</td><td>Integrated DNA Technologies</td><td>11-01-02-02</td><td></td></tr><tr><td>Alt-R&amp;reg; Cas9 Electroporation Enhancer</td><td>Integrated DNA Technologies</td><td>1075915</td><td>Cas9 Electroporation Enhancer</td></tr></tbody></table>

generation of knock-out primary and expanded human nk cells using cas9 ribonucleoproteins

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging in primary NK cells. For example, transgene delivery using lentiviral or retroviral transduction resulted in a limited yield of genetically-engineered NK cells due to substantial procedure-associated NK cell apoptosis. We describe here a DNA-free method for genome editing of human primary and expanded NK cells using Cas9 ribonucleoprotein complexes (Cas9/RNPs). This method allowed efficient knockout of the TGFBR2 and HPRT1 genes in NK cells. RT-PCR data showed a significant decrease in gene expression level, and a cytotoxicity assay of a representative cell product suggested that the RNP-modified NK cells became less sensitive to TGF&#946;. Genetically modified cells could be expanded post-electroporation by stimulation with irradiated mbIL21-expressing feeder cells.

Electroporation Efficiency
To optimize electroporation of Cas9/RNPs, we tested 16 different programs with transduction of GFP non-targeting siRNA and DNA plasmid into NK cells. Flow cytometry assay showed that the EN-138 had the highest percentage of cell viability and transduction efficiency (35% live GFP positive cells) for both particles (Figure 1 &#38; Figure 2). Interestingly, the efficiency of using this program for Cas9/RNPs electroporation was higher as we saw 60% reduction in TGFBR2 mRNA expression level (Figure 5). Additionally, the genetically modified NK cells could be grown and expanded for 30 days and cryopreserved (data not shown).
Mutation assay
Cas9/RNPs containing gRNA2, gRNA1+gRNA2 and gRNA3 had successful TGFBR2 ectodomain gene knockout, but gRNA1 alone did not make any T7E1 detectable indels (Figure 3). Additionally, Figure 4 indicates successfully knockout of Human HPRT1 (hypoxanthine phosphoribosyltransferase 1) in expanded human NK cells using commercially provided gRNAs. According to band densitometry, the proportional indel rates using gRNA1+gRNA2 resulted in 34% band for TGFBR2 modified NK cells, 25% for gRNA3 and 81% for the HPRT gene modified NK cells.
Gene expression level assay
As a representative of our result, Figure 5 shows the effect of Cas9/RNPs (gRNA1+gRNA2) on mRNA production level of TGFBR2 ectodomain, analyzed by RT-PCR. As seen in the graph, the mRNA expression level of the targeted gene significantly decreased.
Cytotoxicity
As seen in Figure 6, after incubating gRNA1+gRNA2, gRNA2 and gRNA3 Cas9/RNPs modified cells with TGF&#946;1, co-cultured with DAOY cells; the modified cells did not show any significant decrease in their cytotoxicity level in comparison to the control group which had IL-2 in the media overnight. This result demonstrates that the Cas9/RNPs modified cells retain their cytotoxicity function in the presence of TGF&#946;1 and shows that the modified cells became TGF&#946;1 resistant.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58237/58237fig1.jpg" /> 
Figure 1. These figures show the electroporation efficiency of siRNA and plasmid DNA expressing GFP in NK cells using the EN-138 program. As seen here, the NK cell viability is 77.5%, and 35% of live cells were GFP positive. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58237/58237fig2.jpg" /> 
Figure 2. This figure shows viability and efficiency of another one of the 16 programs (DN-100) tested for electroporation optimization. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58237/58237fig3.jpg" /> 
Figure 3. Cas9/RNPs-mediated TGFBR2 knockout in expended (a) Primary NK cells (b) measured by T7E1 mutation assay. T7E1 enzyme recognizes and cleaves mismatched DNA. Each small band (blue arrows) represents digested DNA fragments which carry an indel. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58237/58237fig4.jpg" /> 
Figure 4. Cas9/RNPs - mediated HPRT disruption in expanded NK cells measured by T7E1 mutation assay. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58237/58237fig5.jpg" /> 
Figure 5. mRNA expression level of TGFBR2 ectodomain in CRISPR modified NK cells introduced by Cas9/RNPs (gRNA1+gRNA2) using RT-PCR. GAPDH was used as an endogenous control gene. The reduction in RNA levels indicates a disruption of TGFBR2 gene (mean &#177; SEM, P value &#60;0.0001). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/58237/58237fig6.jpg" /> 
Figure 6. a. The cytotoxicity assay using a representative sample of Cas9/RNPs modified (gRNA1+gRNA2, gRNA2, and gRNA3) NK cells shows that overnight incubation of the cells with TGF&#946;1 does not decrease significantly their ability to lyse DAOY cells. b. When compared with non-modified NK cells, the Cas9/RNP modified NK cells (gRNA2 and gRNA3) are less sensitive to TGF&#946;1 (mean &#177; SEM). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>gRNA NO.</td>
			<td colspan="2">gRNA sequence</td>
			<td colspan="5">Ordered as synthetic crRNA</td>
		</tr>
		<tr>
			<td>gRNA1</td>
			<td colspan="2">5 CCCCTACCATGACTTTATTC 3</td>
			<td colspan="5">/AltR1/rArGrUrCrArUrGrGrUrArGrGrGrGrArGrCrUrUrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/</td>
		</tr>
		<tr>
			<td>gRNA2</td>
			<td colspan="2">5 ATTGCACTCATCAGAGCTAC 3</td>
			<td colspan="5">/AltR1/rArUrUrGrCrArCrUrCrArUrCrArGrArGrCrUrArCrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/</td>
		</tr>
		<tr>
			<td>gRNA3</td>
			<td colspan="2">5 AGTCATGGTAGGGGAGCTTG 3</td>
			<td colspan="5">/AltR1/rArG rUrCrA rUrGrG rUrArGrGrGrG rArGrC rUrUrG rGrUrUrUrUrA rGrArG rCrUrA rUrGrCrU/AltR2/</td>
		</tr>
	</tbody>
</table>
Table 1. Three designed gRNAs to target exon 4 of TGFBR2 ectodomain as synthetic crRNA. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>TGFBR 2 ectodomain Primers FWD</td>
			<td>5 GTC TGC TCC AGG TGA TGT TTA T3</td>
		</tr>
		<tr>
			<td>TGFBR2 ectodomain Primer REV</td>
			<td>5 GGG CCT GAG AAT CTG CAT TTA 3</td>
		</tr>
	</tbody>
</table>
Table 2. Primers used to amplify the TGFBR2 ectodomain gene
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Amount (uL)</td>
		</tr>
		<tr>
			<td>200 &#181;M crRNA</td>
			<td>2.2</td>
		</tr>
		<tr>
			<td>200 &#181;M Tracer RNA</td>
			<td>2.2</td>
		</tr>
		<tr>
			<td>IDTE Buffer</td>
			<td>5.6</td>
		</tr>
		<tr>
			<td>Final product</td>
			<td>10</td>
		</tr>
	</tbody>
</table>
Table 3. Form the crRNA:tracerRNA/complex using 200 &#181;M RNAs 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Amount (&#181;L)</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>1</td>
		</tr>
		<tr>
			<td>crRNA:tracrRNA duplex (from step 4.2)</td>
			<td>2 (200 pmol)</td>
		</tr>
		<tr>
			<td>Alt-R Cas9 endonuclease (61 &#181;M stock)</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>5 ul</td>
		</tr>
	</tbody>
</table>
Table 4. For single crRNA:tracrRNA duplex reaction, dilute Cas9 endonuclease to 36 &#181;M. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Amount (&#181;L)</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>1</td>
		</tr>
		<tr>
			<td>crRNA:tracrRNA duplex (ex. gRNA1)</td>
			<td>1 (100 pmol)</td>
		</tr>
		<tr>
			<td>crRNA:tracrRNA duplex (ex. gRNA2)</td>
			<td>1 (100 pmol)</td>
		</tr>
		<tr>
			<td>Alt-R Cas9 endonuclease</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>5 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 5. For combination transduction of crRNA:tracrRNA duplexes dilute Cas9 endonuclease to 36 &#181;M.

Watch this Scientific Journal Video about Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins at JoVE.com

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

Here, we present a protocol to genetically modify primary or expanded human natural killer (NK) cells using Cas9 Ribonucleoproteins (Cas9/RNPs). By using this protocol, we generated human NK cells deficient for transforming growth factor&#8211;b receptor 2 (TGFBR2) and hypoxanthine phosphoribosyltransferase 1 (HPRT1).

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging ...

generation-knock-out-primary-expanded-human-nk-cells-using-cas9

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

12.4K Views.  Nationwide Children's Hospital. Hier presenteren we een protocol om genetisch wijzigen van primaire of uitgebreide menselijke natural killer (NK) cellen met behulp van Cas9 Ribonucleoproteins (Cas9/RNPs). Met behulp van dit protocol, we genereerden menselijke NK cellen tekort voor Transformeren groeifactor-b receptor 2 (TGFBR2) en hypoxanthine phosphoribosyltransferase 1 (HPRT1).

Video: Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human cells has been low, which prevents the generation of human cell lines at a desired rate. The past two years have witnessed a rapid progression on improving efficiency of genetic manipulation by genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system. This manuscript describes a protocol for generating lineage specific human induced pluripotent stem cell (hiPSC) reporters using CRISPR/Cas system assisted homologous recombination. Procedures for obtaining necessary components for making neural lineage reporter lines using the CRISPR/Cas system, focusing on construction of targeting vectors and single guide RNAs, are described. This protocol can be extended to platform establishment and mutation correction in hiPSCs.

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human ...

Developmental Biology

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Genetics

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Development of Knock-Out Muscle Cell Lines using Lentivirus-Mediated CRISPR/Cas9 Gene Editing

One important application of clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas 9 is the development of knock-out cell lines, specifically to study the function of new genes/proteins associated with a disease, identified during the genetic diagnosis. For the development of such cell lines, two major issues have to be untangled: insertion of the CRISPR tools (the Cas9 and the guide RNA) with high efficiency into the chosen cells, and restriction of the Cas9 activity to the specific deletion of the chosen gene. The protocol described here is dedicated to the insertion of the CRISPR tools in difficult to transfect cells, such as muscle cells. This protocol is based on the use of lentiviruses, produced with plasmids publicly available, for which all the cloning steps are described to target a gene of interest. The control of Cas9 activity has been performed using an adaptation of a previously described system called KamiCas9, in which the transduction of the cells with a lentivirus encoding a guide RNA targeting the Cas9 allows the progressive abolition of Cas9 expression. This protocol has been applied to the development of a RYR1-knock out human muscle cell line, which has been further characterized at the protein and functional level, to confirm the knockout of this important calcium channel involved in muscle intracellular calcium release and in excitation-contraction coupling. The procedure described here can easily be applied to other genes in muscle cells or in other difficult to transfect cells and produce valuable tools to study these genes in human cells.

The protocol describes how to generate knock-out myoblasts using CRISPR/Cas9, starting from the design of guide-RNAs to the cellular cloning and characterization of the knock-out clones.

One important application of clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas 9 is the development of knock-out cell lines, ...

Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to proteins of interest. Identification of gene functions in cell line models is important for gene discovery and exploration of cell-intrinsic mechanisms. However, genetic manipulations of immune cells such as T cells and macrophage cell lines using CRISPR/Cas9-mediated knock-in are difficult because of the low transfection efficiency of these cells, especially in a quiescent state. To modify genes in immune cells, drug-resistance selection and viral vectors are typically used to enrich for cells expressing the CRIPSR/Cas9 system, which inevitably results in undesirable intervention of the cells. In a previous study, we designed dual fluorescent reporters coupled to CRISPR/Cas9 that were transiently expressed after electroporation. This technical solution leads to rapid gene deletion in immune cells; however, gene knock-in in immune cells such as T cells and macrophages without the use of drug-resistance selection or viral vectors is even more challenging. In this article, we show that by using cell sorting to aid selection of cells transiently expressing CRISPR/Cas9 constructs targeting the Rosa26 locus in combination with a donor plasmid, gene knock-in can be achieved in both T cells and macrophages without drug-resistance enrichment. As an example, we show how to express human ACE2, a receptor of SARS-Cov-2, which is responsible for the current Covid-19 pandemic, in RAW264.7 macrophages by performing knock-in experiments. Such gene knock-in cells can be widely used for mechanistic studies.

This protocol uses fluorescent reporters and cell sorting to simplify knock-in experiments in macrophage and T cell lines. Two plasmids are used for these simplified knock-in experiments, namely a CRISPR/Cas9- and DsRed2-expressing plasmid and a homologous recombination donor plasmid expressing EBFP2, which is permanently integrated at the Rosa26 locus in immune cells.

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to ...

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

Biology

Delivery of the Cas9/sgRNA Ribonucleoprotein Complex in Immortalized and Primary Cells via Virus-like Particles ("Nanoblades")

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system has democratized genome-editing in eukaryotic cells and led to the development of numerous innovative applications. However, delivery of the Cas9 protein and single-guide RNA (sgRNA) into target cells can be technically challenge. Classical viral vectors, such as those derived from lentiviruses (LVs) or adeno-associated viruses (AAVs), allow for efficient delivery of transgenes coding for the Cas9 protein and its associated sgRNA in many primary cells and in vivo. Nevertheless, these vectors can suffer from drawbacks such as integration of the transgene in the target cell genome, a limited cargo capacity, and long-term expression of the Cas9 protein and guide RNA in target cells.
To overcome some of these problems, a delivery vector based on the murine Leukemia virus (MLV) was developed to package the Cas9 protein and its associated guide RNA in the absence of any coding transgene. By fusing the Cas9 protein to the C-terminus of the structural protein Gag from MLV, virus-like particles (VLPs) loaded with the Cas9 protein and sgRNA (named &#34;Nanoblades&#34;) were formed. Nanoblades can be collected from the culture medium of producer cells, purified, quantified, and used to transduce target cells and deliver the active Cas9/sgRNA complex. Nanoblades deliver their ribonucleoprotein (RNP) cargo transiently and rapidly in a wide range of primary and immortalized cells and can be programmed for other applications, such as transient transcriptional activation of targeted genes, using modified Cas9 proteins. Nanoblades are capable of in vivo genome-editing in the liver of injected adult mice and in oocytes to generate transgenic animals. Finally, they can be complexed with donor DNA for &#34;transfection-free&#34; homology-directed repair. Nanoblade preparation is simple, relatively low-cost, and can be easily carried out in any cell biology laboratory.

Delivery of the Cas9/sgRNA Ribonucleoprotein Complex in Immortalized and Primary Cells via Virus-like Particles "Nanoblades"

We have developed a simple and inexpensive protocol to load Cas9/single-guide RNA (sgRNA) ribonucleoprotein complexes within virus-like particles. These particles, called "Nanoblades", allow efficient delivery of the Cas9/sgRNA complex in immortalized and primary cells as well as in vivo.

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system has democratized genome-editing in eukaryotic cells and led to the ...

Generation of a RIP1 Knockout U937 Cell Line Using the CRISPR-Cas9 System

This protocol outlines a procedure for knocking out the RIP1 gene using CRISPR/Cas9 in the human monocyte U937 cell line. The method utilizes designated guide RNA plasmids and lentiviral packaging plasmids to achieve RIP1 gene knockout. The protocol addresses challenges and improvements to traditional CRISPR methods, enabling its replication for future cell death studies. The resulting mutant cells can be used to investigate mechanistic changes in cell death, where functional RIP1 proteins would otherwise play a role. Viability assays demonstrated a significant reduction in cell death in knockout cells following necroptosis induction. Fluorescence microscopy revealed a marked decrease in mitochondrial reactive oxygen species (ROS) in knockout cells under the same conditions. Together, these functional assays confirm the loss of RIP1 protein. Optimized for use with U937 human monocytes, this procedure may also be adapted to target other key cell death regulators, yielding functional, non-lethal mutants. Potential pitfalls are addressed throughout to provide insights into challenges that may arise during mutant generation.

As CRISPR-related protocols become increasingly useful and accessible, complications and obstacles can still arise under specific experimental conditions. This protocol outlines the creation of a receptor-interacting serine/threonine-protein kinase 1 (RIPK1/RIP1) knockout human cell line using CRISPR/Cas9 and highlights potential challenges encountered during this process.

This protocol outlines a procedure for knocking out the RIP1 gene using CRISPR/Cas9 in the human monocyte U937 cell line. The method utilizes designated ...

A CRISPR-Cas9 Technique for Gene Editing in T Cells

Source: Agarwal, S., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/62299">Production of Human CRISPR-Engineered CAR-T Cells.</a> J. Vis. Exp. (2021).
This video demonstrates an assay for performing gene editing in human T cells using the CRISPR-Cas9 technology. A mixture of primary CD4+ and CD8+ T cells is combined with a CRISPR-Cas9 ribonucleoprotein complex, targeting specific genes for knockout. Upon electroporation, the sgRNA guides Cas9 to the target DNA sequence, creating precise cuts. These cuts are then repaired by the cell&#39;s non-homologous end-joining mechanism, leading to gene knockout.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Designing of sgRNAs and gene ...

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video