우리는 원고 편집에 그의 친절 한 도움에 대 한 브라이언 툴 리를 인정 합니다.

건강 한 기증자 버 피 코트에서 중앙 오하이오 지역 미국 적십자 소스 자료로 얻은 했다. 이 연구는 제도적 검토 보드의 전국 어린이 병원으로 면제 연구 될 결정 했다.
1. 인간 NK 세포 정화 및 확장
<ol><li>버 피 코트12에서 PBMCs를 격리 합니다.<ol>
<li>35 mL Ficoll-Paque의 15 mL에 버 피 코트 샘플의 레이어.</li>
		<li>브레이크 없이 20 분에 대 한 400 x g에서 centrifuge 고 인터페이스에서에서 PBMC를 수집 합니다.</li>
		<li>PBS의 적어도 동등한 볼륨을 추가 하 여 복구 된 PBMCs 세 번 씻고, 400 x g에서 5 분간 centrifuging와 PBC 발음 세척. NK 세포 RosettesSep13이 단계에서 격리 된 수 있습니다.</li>
	</ol>
</li>
	<li>비친 10 x 106 mbIL21-표현으로 자극 하 여 NK 세포를 확장 급지대 셀 0, 7, 14 일에. 10%를 포함 하는 신선한 RPMI 미디어 바꿉니다 FBS, 1% 글루타민, 1% 페니실린 스, 그리고 100 IU/mL의 일리노이-2 전체 미디어 볼륨 매일.</li>
</ol>2. gRNA 디자인 및 선택
<ol><li>대상, 온라인 도구, 예를 들면, NCBI, 앙상블을 사용 하 여 특정 게놈 loci를 선택 하십시오. 예를 들어. 설명: 변형 시키는 성장 인자 beta 수용 체 2 (TGFBRR2) ectodomain 기록 보기: PF08917 InterPro 보기: IPR015013 위치: 49-157 aa 대상된 시퀀스: 엑손 TGFBR2 유전자 (ENSG00000163513)의 4</li>
	<li>디자인은 gRNAs, http://crispr.mit.edu 등 'Benchling' CRISPR 디자인 웹 도구 사용 하 여<ol>
<li>2.1 단계에서 선택 하는 DNA 순서에 입력 합니다. 대상 게놈으로 인간 (hg 19)를 선택 합니다. CRISPR 가이드 (20 뉴클레오티드 팸 시퀀스 다음: NGG) 앞에서 입력 한 시퀀스에서 검색 됩니다. 그것은 또한 선택 된 게놈을 통해 가능한 오프 대상 일치를 표시합니다.</li>
		<li>최고의 3 gRNAs는 그들의 표적에 및 오프 대상 요금에 따라 가장 높은 점수를 선택 하십시오. 예를 들어 표 1 exon TGFBR2 유전자의 4 CRISPR 디자인 웹 도구에 의해 제안 된 대상으로 설계 된 CRISPR RNAs를 보여준다.</li>
	</ol>
</li>
	<li>합성 순서 특정 crRNAs로 CRISPR RNAs를 주문.</li>
	<li>보존, 주문 transactivating RNA (tracrRNA)는 crRNA와 부분 homology를 통해 상호 작용.</li>
</ol>3. 디자인 삭제 뇌관을 심사
<ol><li>T7E1 돌연변이 분석 결과 대 한 gRNA 분열 사이트를 확장 하는 뇌관 디자인.</li>
	<li>SgRNA 대상 사이트에서 작은 삽입-삭제 (indels) 되도록 예측된 분열 사이트에서 사용 뇌관 최소한 100 bp 돌연변이 분석 결과 따라 1.5 %agarose 젤에 표시 됩니다. 표 2 에서는 TGFBR2 ectodomain를 증폭 하는 데 사용 되는 뇌관을 보여 줍니다.</li>
</ol>4. 인간의 기본 및 확장 된 NK 세포의 변환
참고: NK에 Cas9/RNPs 요소의 변환 electroporation 4d 시스템을 사용 하 여 다음과 같이 하면 됩니다.
<ol><li>
셀 준비
	<ol>
<li>
기본 NK 세포에 대 한, 갓 고립 된 NK 세포 RPMI 매체 100 IU/mL 일리노이-2의 앞에 4 일 동안 품 어 하 고 하루 5 electroporation를 수행 합니다. 앞서 고 하루 변환 전에 설명한 대로 매일 미디어를 교체 합니다.</li>
		<li>
확장 된 NK 세포에 대 한, 하루 0 1: 1의 비율로 조사 피더 세포에서 세포를 자극 하 고 하루 5 또는 6 또는 7에서 electroporation를 수행 합니다. 앞서 고 하루 변환 전에 설명한 대로 매일 미디어를 교체 합니다.</li>
		<li>Electroporation 당일 100 IU/mL electroporation 및 습도 37 ° C, 5% CO2 인큐베이터에서 미리 incubate 플라스 크 셀 일리노이-2 포함 하는 신선한 RPMI의 8 mL 가득 T25 플라스 크를 준비 합니다. 참고: 해 동된 셀 이나 2차 또는 3rd 자극 받은 셀 수 있다 electroporated 설명 된 대로 복구 후 언제 든 지.</li>
		<li>변환 믹스의 26 µ L에 대 한 조건 당 3-4 × 106 셀을 가져가 라. 참고: Electroporation 솔루션에서 NK 세포의 매우 높은 농도 변환 속도를 향상 시킵니다.</li>
		<li>3 번 RNase 활동을 일반적으로 포함 된 모든 FBS를 제거 하려면 PBS 가진 세포를 씻어. 8 분 동안 300 x g에서 매번 그들을 회전 합니다. 참고: 7 electroporation Cas/RNPs에 대 한 단일 gRNA (gRNA1, gRNA2, gRNA3)로 및 2 개의 gRNAs (gRNA1 gRNA2, gRNA1 gRNA3, gRNA2 + + gRNA3)의 조합 및 아무 Cas9/RNPs 한 컨트롤을 고려 하십시오.</li>
	</ol>
</li>
	<li>
crRNA:tracerRNA을 형성 / 복잡 한
	<ol>
<li>200 μ M의 최종 농도에 테 솔루션 x 1에서 crRNAs (gRNA1, gRNA2, 및 gRNA3) 및 tracerRNA resuspend. 표 3에서 같이 200 μ M tracerRNA와 함께 각 200 μ M gRNA의 혼합 2.2 μ.</li>
		<li>샘플 5 분 동안 95 ° C에가 열 하 고 상 온 (15-25 ° C)를 벤치 위에 시원한 수 있습니다. 스토어 resuspended RNAs 및 crRNA: 나중 사용을 위해-20 ° C에서 tracerRNA/복잡 한.</li>
	</ol>
</li>
	<li>
RNP 복잡 한 형성 참고: 시간을 절약 하는 세척 동안 복잡 한 RNP 형성 단계 4.1.5.
	<ol>
<li>단일 crRNA:tracrRNA 이중 반응, 표 4에 있는 예제에서와 같이 36 μ M에 Cas9 endonuclease 희석.</li>
		<li>CrRNA:tracrRNA duplexes의 조합 변환, 희석 36 μ M에 Cas9 endonuclease에 예제에서와 같이 표 5.
</li>
		<li>피 펫 팁, 30 이상 소용돌이 동안 천천히 Cas9 endonuclease crRNA:tracrRNA 쌍 신 회로 추가 1 분에 s.</li>
		<li>15-20 분 동안 실내 온도에 혼합물을 품 어. 경우 부 화 후 혼합물을 사용 하 여 준비 하지, 사용까지 얼음에 혼합물을 유지.</li>
	</ol>
</li>
	<li>
Electroporation
	<ol>
<li>P3 electroporation 솔루션 전체 보충을 추가 하 고 실내 온도에서 보관.</li>
		<li>P3 기본 4 D electroporation 솔루션의 20 μ에 셀 펠 릿 (3-4 × 106 세포 단계 4.1.5)를 resuspend. Pipetting 동안 공기 방울을 피하십시오. 참고: 셀 P3 솔루션에 오랜 시간 동안 하지 맡겨야 한다.</li>
		<li>즉시 세포 현 탁 액에 RNP 복잡 한 (단계 4.3)의 5 µ L를 추가 합니다.</li>
		<li>Cas9/RNPs/셀 100 μ M Cas9 electroporation 증강의 1 μ 믹스를 추가 합니다.</li>
		<li>Cas9/RNPs/셀 믹스 20 μ electroporation 스트립으로 전송 합니다.</li>
		<li>부드럽게 샘플 스트립의 하단 커버 되도록 스트립을 누릅니다.</li>
		<li>4 D electroporation 시스템을 시작 하 고 EN-138 프로그램을 선택 합니다.</li>
	</ol>
</li>
</ol>5. 게시 변환
<ol><li>셀 스트립에서 3 분간 휴식 하자.</li>
	<li>에 베트를 미리 equilibrated 문화 미디어의 80 µ L을 추가 하 고 부드럽게 플라스 크에 샘플을 전송.</li>
	<li>변환, 후 48 시간 차단 유전자 삭제에 대 한 5 × 105 셀에서 게놈 DNA를 추출 합니다.</li>
	<li>Taq DNA 중 합 효소 키트와 함께 3.2 단계에서 설계 된 프라이 머를 사용 하 여 관심사의 유전자를 증폭.</li>
	<li>T7EI 소화에 대 한 PCR amplicon heteroduplexes를 형성 하 고 37 ° C에 T7EI 효소와 함께 30-60 분에 대 한 제품을 품 어 참고: 분석 결과 그것은 빠르고, 단순 하 고 제공으로 심사에 대 한 선호 T7EI 측량 분석 결과 사용 하 여에 비해 전기 영동 결과 청소 합니다. 그러나,이 방법은 삽입 및 삭제를 검색할 수 없습니다 < 비 동종 끝 결합 (NHEJ) 활동 Cas9 RNPs 실험14에 의해 생성 되는 2 기지.</li>
	<li>1.5%에 소화 DNA를 실행 agarose 젤 110 V 30 ~ 45 분, 15 분 마다 시각화 젤.</li>
	<li>MbIL21 표현으로 셀의 나머지 부분을 자극 1: 1의 비율로 피더 세포.</li>
	<li>자극 후 5 일 정량 Pcr를 사용 하 여 유전자 식 수준에 대 한 RNA를 추출 합니다.</li>
	<li>이전에 보고 된12calcein 분석 실험을 실시 합니다. 간단히, calcein 오전 (예, 3 µ g/mL/1000000 DAOY 셀 사용)에서 대상 셀을 로드 합니다. IL2에 밤새 껏 휴식 하 여 NK 세포 세포 독성 분석 실험에 대 한 준비 (100 IU/mL) 10 ng/mL 전후로 용 해 TGFβ. NK 세포는 하룻밤에 휴식 했다로 동일한 cytokines에 calcein 분석 실험을 실시 합니다.</li>
</ol>

<ol>
	<li>Guven, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+gene+transfer+into+primary+human+natural+killer+cells+by+retroviral+transduction.">Efficient gene transfer into primary human natural killer cells by retroviral transduction.</a> Experimental Hematology. 33 (11), 1320-1328 (2005).</li><li>Alici, E., Sutlu, T., Sirac Dilber, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+gene+transfer+into+primary+human+natural+killer+cells.">Retroviral gene transfer into primary human natural killer cells.</a> Methods in Molecular Biology. 508, 127-137 (2009).</li><li>Carlsten, M., Childs, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Manipulation+of+NK+Cells+for+Cancer+Immunotherapy:+Techniques+and+Clinical+Implications.">Genetic Manipulation of NK Cells for Cancer Immunotherapy: Techniques and Clinical Implications.</a> Frontiers in Immunology. 6, 266 (2015).</li><li>Mehta, R. S., Rezvani, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+Antigen+Receptor+Expressing+Natural+Killer+Cells+for+the+Immunotherapy+of+Cancer.">Chimeric Antigen Receptor Expressing Natural Killer Cells for the Immunotherapy of Cancer.</a> Frontiers in Immunology. 283, 9 (2018).</li><li>Zuris, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+lipid-mediated+delivery+of+proteins+enables+efficient+protein-based+genome+editing+in+vitro+and+in+vivo.">Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo.</a> Nature Biotechnology. 33 (1), 73-80 (2015).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+delivery+of+genome-editing+proteins+using+bioreducible+lipid+nanoparticles.">Efficient delivery of genome-editing proteins using bioreducible lipid nanoparticles.</a> PNAS. 113 (11), 2868-2873 (2016).</li><li>Liang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+DNA-free+genome+editing+of+bread+wheat+using+CRISPR/Cas9+ribonucleoprotein+complexes.">Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes.</a> Nature Communications. 8, 14261 (2017).</li><li>DeWitt, M. A., Corn, J. E., Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+via+delivery+of+Cas9+ribonucleoprotein.">Genome editing via delivery of Cas9 ribonucleoprotein.</a> Methods. , 9-15 (2017).</li><li>Rezvani, K., Rouce, R., Liu, E., Shpall, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+Natural+Killer+Cells+for+Cancer+Immunotherapy.">Engineering Natural Killer Cells for Cancer Immunotherapy.</a> Molecular Therapy. 25 (8), 1769-1781 (2017).</li><li>Sutlu, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+intracellular+antiviral+defense+mechanisms+augments+lentiviral+transduction+of+human+natural+killer+cells:+implications+for+gene+therapy.">Inhibition of intracellular antiviral defense mechanisms augments lentiviral transduction of human natural killer cells: implications for gene therapy.</a> Human Gene Therapy. 23 (10), 1090-1100 (2012).</li><li>Viel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta+inhibits+the+activation+and+functions+of+NK+cells+by+repressing+the+mTOR+pathway.">TGF-beta inhibits the activation and functions of NK cells by repressing the mTOR pathway.</a> Science Signaling. 9 (415), (2016).</li><li>Somanchi, S. S., Senyukov, V. V., Denman, C. J., Lee, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion,+purification,+and+functional+assessment+of+human+peripheral+blood+NK+cells.">Expansion, purification, and functional assessment of human peripheral blood NK cells.</a> JoVE. (48), (2011).</li><li>Lee, D. A., Verneris, M. R., Campana, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acquisition,+preparation,+and+functional+assessment+of+human+NK+cells+for+adoptive+immunotherapy.">Acquisition, preparation, and functional assessment of human NK cells for adoptive immunotherapy.</a> Methods in Molecular Biology. , 61-77 (2010).</li><li>Vouillot, L., Thelie, A., Pollet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+T7E1+and+surveyor+mismatch+cleavage+assays+to+detect+mutations+triggered+by+engineered+nucleases.">Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases.</a> G3. 5 (3), 407-415 (2015).</li><li>Eyquem, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+CAR+to+the+TRAC+locus+with+CRISPR/Cas9+enhances+tumour+rejection.">Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection.</a> Nature. 543 (7643), 113-117 (2017).</li><li>Liang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+highly+efficient+mammalian+cell+engineering+via+Cas9+protein+transfection.">Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.</a> Journal of Biotechnology. 208, 44-53 (2015).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chmielecki, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+Profiling+of+a+Large+Set+of+Diverse+Pediatric+Cancers+Identifies+Known+and+Novel+Mutations+across+Tumor+Spectra.">Genomic Profiling of a Large Set of Diverse Pediatric Cancers Identifies Known and Novel Mutations across Tumor Spectra.</a> Cancer Research. 77 (2), 509-519 (2017).</li><li>Schultz, L. M., Majzner, R., Davis, K. L., Mackall, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+immunotherapy+for+pediatric+solid+tumors.">New developments in immunotherapy for pediatric solid tumors.</a> Current Opinion in Pediatrics. 30 (1), 30-39 (2018).</li></ol>

DAL 에서는/택배 치료제, 흑 요 석 치료제, Intellia 치료제, 머 크 연구소, 및 Miltenyi Biotec 컨설턴트 역임 했다와 주식/리더십 CytoSen 치료제에 합니다.

NK 세포의 DNA-종속 수정4,9도전 하고있다. 우리는, 따라서, 도입 직접 종합적으로 미리 형성한 ribonucleoprotein (RNPs) 복잡 하 고 Cas9 단백질 순화 된 단백질으로 기본 및 확장 된 NK 세포8로. 이 방법은 미행, 상한, 제거를 허용 하 고 다른 transcriptional 및 변환 프로세스는 RNA 중 합 효소 II는 DNA 의존 변환 메서드에 연결 된 NK 세포 apoptosis를 발생할 수 있습니다 의해 시작.
또한, 보고 하는 방법 여기 사용 순화 Cas9 단백질에 complexed electroporation 직후 활성화 하 고 신속 하 게, 그로 인하여 증가에 대상 및 현재 프로토콜을 통해 감소 하는 대상에서 효과 저하는 Cas9/RNPs 5 , 6 , 7 , 16. 또한, 높은 효율으로 Cas9/RNP transduce 새로운 electroporation 접근을 최적화는 여기 소개 하는 또 다른 중요 한 단계는 관심의 다른 유전자에 적용 됩니다. 이 방법은 상용 큰 electroporation 큐 벳 (데이터 표시 되지 않음)를 사용 하 여 NK 세포의 큰 숫자의 수정에 대 한 확장할 수 있습니다.
요약 하자면, Cas9/RNPs 유전자 수정 암 immunotherapy 위의 설명된 방법을 활용에 대 한 인간의 기본 및 확장 된 NK 세포를 사용할 수 있습니다. 우리의 결과 또한 TGFBR2 ectodomain 유전자의 성공적인 녹아웃 되는 저항 하는 TGFβ111이 수정 된 NK 세포를 리드 설명 했다.
RNP 배달 템플릿 (예: 자연스럽 게 recombinogenic adeno 관련 바이러스 (AAV) 기증자 벡터) DNA의 소스와 결합 하 여 동종 재결합3,,1819 사이트 관련 유전자 삽입 사용 .

암 immunotherapy 최근 몇 년 동안에서 고급 되었습니다. 유전자 변형 공상 항 원 수용 체 (자동차) T 세포는 암 immunotherapy에 성공적으로 배포 하는 설계 된 면역 세포의 훌륭한 예입니다. 이 셀 최근에 대 한 처리를 위한 FDA에 의해 승인 되었다 CD19 + B 세포 악성 종양, 하지만 성공 지금까지 몇 대상 항, 베어링 질병에 국한 되었으며 같은 제한 된 항 원 레파토리를 대상으로 하는 것은 면역 탈출 하 여 실패 하는 경향이. 또한, 자동차 T 세포 이식-비교-호스트 질병 수용자 T 세포에 의해 발생의 헌 T 세포의 사용에 집중 되었습니다 했다. 반면, NK 세포는 종양 표적 항 원 독립적인 방식으로 죽 일 수 있으며 GvHD, 그들에 게 암 immunotherapy6,7,,89에 대 한 좋은 후보를 발생 하지 않습니다.
CRISPR/Cas9 기술 최근 엔지니어링 면역 세포에서 사용 되었습니다 하지만 NK 세포는 플라스 미드 유전자 재프로그래밍 항상 도전 하고있다. 이것은 lentiviral 및 retroviral 변환 상당한 절차 관련 된 NK 세포 apoptosis와 유전자 조작된 NK 세포4 의 제한 된 생산 유발 등 DNA 의존 방식에서 transgene 배달에 어려움으로 인해 되었습니다. , 9.
많은 타고 난 면역 세포 표현 병원 체 관련 된 분자 패턴에 대 한 수용 체의 상부와 같은 Retinoic 산을 유도할 수 있는 유전자 나 (장비-난), 어떤 외국 DNA의 과장 된 인식의 사용. 유전 수정10DNA 기반 방법을 사용 하 여 때 이러한 통로의 억제 NK 세포에 더 높은 변환 효율을 수 있게 되었습니다.
여기는 DNA 무료 게놈의 편집 기본 및 확장 된 인간 NK 세포 Cas9 ribonucleoprotein 복합물 (Cas9/RNPs)를 활용 하 여 사용 하기 위한 방법을 설명 합니다. Cas9/RNPs는 세 가지 구성 요소, 재조합 Cas9 단백질에 complexed 합성 단일 가이드 RNA complexed crRNA와 tracerRNA의 구성으로 이루어져 있습니다. 이러한 Cas9/RNPs 기능 복합물으로 그들의 배달으로 인해 외국 DNA 종속 접근 높은 효율으로 게놈 목표를 고착 할 수 있다. 또한, Cas9/RNPs 세포에서의 신속한 통관 apoptosis 유도 등 대상 오프 효과 줄일 수 있습니다. 따라서, 그들은 노크-아웃, 또는 동종 재결합6,7에 대 한 DNA와 결합 될 때 노크 기능 생성을 사용할 수 있습니다. 우리는 Cas9/RNPs의 그 electroporation 보였다 NK 세포에서 유전자 조작의 이전 제약을 극복 하는 간단 하 고 비교적 효율적인 방법입니다.
TGFβ는 활성화 및 NK 세포의 기능을 억제 하는 주요 면역 억제 사이토카인 이다. 그것은 TGFβ 통로 대상으로 면역 세포 기능을 높일 수 있습니다 제안 되었습니다. 우리 TGBR2 ectodomain TGFβ11. 을 바인딩하는 인코딩 지역 대상 대표 결과이 유전자의 mRNA 발현의 수준에 상당한 감소를 표시 하 고 추가 수정 된 NK 세포가 TGFβ에 저항력이 될 입증. 또한, 수정 된 셀 유지 생존 및 증식 잠재력, 그들은 확장 된 게시물 electroporation에 비친된 피더 세포. 을 사용 하 여 될 수 있다 따라서, 다음 메서드는 유전자에 대 한 NK 세포를 조작 하는 유망한 접근 방식을 추가 임상 또는 연구 목적.

<table>
	<tbody>
		<tr>
			<td>RosetteSep&#8482; Human NK Cell Enrichment Cocktail</td>
			<td>STEMCELL Technologies</td>
			<td>15065</td>
			<td>The RosetteSep&#8482; Human NK Cell Enrichment Cocktail is designed to isolate NK cells from whole blood by negative selection.</td>
		</tr>
		<tr>
			<td>Ficoll-Paque&#174; PLUS</td>
			<td>GE Healthcare - Life Sciences</td>
			<td>17-1440-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R&#174; CRISPR-Cas9 tracrRNA</td>
			<td>Integrated DNA Technologies</td>
			<td>1072532</td>
			<td>TracrRNA that contains proprietary chemical modifications conferring increased nuclease resistance. Hybridizes to crRNA to activate the Cas9 enzyme</td>
		</tr>
		<tr>
			<td>Alt-R&#174; CRISPR-Cas9 crRNA</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>Synthetically produced as Alt-R&#174; CRISPR-Cas9 crRNA, based on the sequence of designed gRNA targeting the gene of intrest</td>
		</tr>
		<tr>
			<td>Alt-R&#174; Genome Editing Detection Kit</td>
			<td>Integrated DNA Technologies</td>
			<td>1075931</td>
			<td>Each kit contains T7EI endonuclease, T7EI reaction buffer, and T7EI assay controls.</td>
		</tr>
		<tr>
			<td>Platinum&#174; Taq DNA Polymerase High Fidelity</td>
			<td>Invitrogen</td>
			<td>11304-011</td>
			<td></td>
		</tr>
		<tr>
			<td>4D-Nucleofector&#8482; System</td>
			<td>Lonza</td>
			<td>AAF-1002B</td>
			<td></td>
		</tr>
		<tr>
			<td>Human recombinant IL-2 Protein</td>
			<td>Novartis</td>
			<td>65483-0116-07</td>
			<td></td>
		</tr>
		<tr>
			<td>P3 Primary Cell 4D-Nucleofector&#8482; X Kit</td>
			<td>Lonza</td>
			<td>V4XP-3032</td>
			<td>Contains pmaxGFP&#8482; Vector, Nucleofector&#8482; Solution, Supplement, 16-well Nucleocuvette&#8482; Strips</td>
		</tr>
		<tr>
			<td>Non-targeting: Custom siRNA, Standard 0.05 2mol ON-TARGETplus</td>
			<td>Dharmacon</td>
			<td>CTM-360019</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R&#174; S.p. Cas9 Nuclease 3NLS</td>
			<td>Integrated DNA Technologies</td>
			<td>1074181</td>
			<td>Cas9 Nuclease</td>
		</tr>
		<tr>
			<td>DNeasy&#174; Blood &#38; Tissue Handbook</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcein AM</td>
			<td>ThermoFisher</td>
			<td>C3099</td>
			<td></td>
		</tr>
		<tr>
			<td>TGF&#946;</td>
			<td>Biolegend</td>
			<td>580706</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R&#174; CRISPR-Cas9 Control Kit, Human</td>
			<td>Integrated DNA Technologies</td>
			<td>1072554</td>
			<td>Includes tracrRNA, HPRT positive control crRNA, negative control crRNA#1, HPRT Primer Mix, and Nuclease-Free Duplex Buffer.</td>
		</tr>
		<tr>
			<td>IDTE pH 7.5 (1X TE Solution)</td>
			<td>Integrated DNA Technologies</td>
			<td>11-01-02-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R&#174; Cas9 Electroporation Enhancer</td>
			<td>Integrated DNA Technologies</td>
			<td>1075915</td>
			<td>Cas9 Electroporation Enhancer</td>
		</tr>
	</tbody>
</table>

generation of knock-out primary and expanded human nk cells using cas9 ribonucleoproteins

CRISPR/Cas9 기술 많은 세포 유형, 하지만 지금까지 유전자 배달에 게놈 엔지니어링 가속 되 고 안정적인 유전자 수정 기본 NK 세포에 도전 되었습니다. 예를 들어 transgene 배달 lentiviral 또는 retroviral 변환을 사용 하 여 실질적인 절차 관련 된 NK 세포 apoptosis 때문 NK 세포 유전자 조작의 제한 된 수율 결과. 여기 Cas9 ribonucleoprotein 복합물 (Cas9/RNPs)를 사용 하 여 인간의 기본 및 확장 된 NK 세포의 게놈 편집용 DNA 무료 방법을 설명 합니다. 이 메서드는 TGFBR2 와 의 효율적인 녹아웃 NK 세포에 HPRT1 유전자 허용. RT-PCR 데이터 유전자 식 수준에 중요 한 감소 그리고 대표적인 셀 제품의 세포 독성 분석 실험 제안 RNP 수정 NK 세포 TGFβ에 덜 민감한 되었다. 유전자 변형된 세포 조사 mbIL21 표현 된 자극에 의해 확장 된 게시물 electroporation 수 지류 세포.

Electroporation 효율
Cas9/RNPs의 electroporation 최적화, GFP 비 대상으로 siRNA와 DNA 플라스 미드의 NK 세포로 변환 된 16 가지 프로그램 테스트. 교류 cytometry 분석 결과 엉-138 셀 생존 및 변환 효율 (35% 라이브 GFP 긍정적인 세포) (그림 1 및 그림 2) 두 입자의 높은 비율을 했다 보여주었다. 흥미롭게도,이 프로그램을 사용 하 여 Cas9/RNPs electroporation에 대 한 효율성 높은 우리가 본 TGFBR2 mRNA 식 수준 (그림 5)에서 60% 감소 했다. 또한, 유전자 변형된 NK 세포 성장 하 고 확장에 대 한 일 cryopreserved (데이터 표시 되지 않음) 될 수 있습니다.
변이 분석 결과
Cas9/RNPs gRNA3 + gRNA2, gRNA1, gRNA2를 포함 하는 성공적인 TGFBR2 ectodomain 유전자 녹아웃, 했지만 gRNA1 혼자 어떤 T7E1 감지 indels (그림 3)을 하지 않았다. 또한, 그림 4 상업적으로 사용 하 여 확장 된 인간 NK 세포에 인간 HPRT1 (hypoxanthine phosphoribosyltransferase 1) 의 녹아웃 제공 gRNAs 성공적으로 나타냅니다. 밴드 densitometry 따라 비례 indel 요금 gRNA1 + gRNA2를 사용 하 여 결과 34% 밴드 TGFBR2 수정 NK 세포에 대 한, gRNA3에 대 한 25%와 81 %HPRT 유전자에 대 한 수정 NK 세포.
진 식 수준 분석 결과
우리의 결과의 대표로, 그림 5 는 TGFBR2 ectodomain, RT-PCR에 의해 분석의 mRNA 생산 수준에 Cas9/RNPs (gRNA1 + gRNA2)의 효과 보여줍니다. 그래프에서 보듯이 타겟된 유전자의 mRNA 식 수준이 크게 감소.
세포 독성
Cas9/RNPs TGFβ1, DAOY 세포; 공동 교양 있는 셀 수정 gRNA1 + gRNA2, gRNA2 및 gRNA3 잠복기 후 그림 6에서 보듯이 수정 된 셀 일리노이-2 미디어에서 하룻밤 했다 컨트롤 그룹에 비해 그들의 세포 독성 수준에 어떤 중요 한 감소를 보여주지 않았다. 이 결과 Cas9/RNPs 수정 셀 TGFβ1와 수정된 셀 TGFβ1 저항 된 쇼의 그들의 세포 독성 기능을 유지 하는 방법을 보여 줍니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58237/58237fig1.jpg"> 그림 1. 이러한 수치 표시 siRNA와 플라스 미드 DNA의 electroporation 효율 엉-138 프로그램을 사용 하 여 NK 세포에 GFP를 표현. 여기 본, NK 세포 생존 능력은 77.5%, 및 35% 라이브 셀의 GFP를 긍정 했다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58237/58237fig2.jpg"> 그림 2. 이 그림에 생존 능력의 그리고 효율성 16 프로그램 (DN-100) electroporation 최적화에 대 한 테스트의 하나입니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58237/58237fig3.jpg"> 그림 3. Cas9/RNPs-중재 TGFBR2 녹아웃 팽창한 (a) 1 차 NK 세포 (b) T7E1 돌연변이 시험에 의해 측정. T7E1 효소는 인식 하 고 일치 하지 않는 DNA를 앞. 각 작은 밴드 (파란색 화살표)는 indel 수행 소화 DNA 조각을 나타냅니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58237/58237fig4.jpg"> 그림 4. Cas9/RNPs-T7E1 돌연변이 시험에 의해 측정 하는 확장 된 NK 세포에 HPRT 장애 중재. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58237/58237fig5.jpg"> 그림 5. CRISPR에서 TGFBR2 ectodomain의 mRNA 식 수준 수정 Cas9/RNPs (gRNA1 + gRNA2)에 의해 도입 된 NK 세포 RT-PCR를 사용 하 여. GAPDH 생 제어 유전자로 사용 되었다. RNA 수준에 감소 TGFBR2 유전자의 파괴를 나타냅니다 (± SEM을 의미 P 값 < 0.0001). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/58237/58237fig6.jpg"> 그림 6. a. Cas9/RNPs의 대표 샘플을 사용 하 여 세포 독성 분석 결과 수정 (gRNA1 + gRNA2, gRNA2, 및 gRNA3) NK 세포 쇼는 TGFβ1에 포함 된 셀의 하룻밤 인큐베이션 감소 하지 않습니다 크게 DAOY 세포를 lyse 그들의 능력. b. 비 수정 NK 세포, Cas9/RNP 수정된 NK 세포 (gRNA2 및 gRNA3)에 비해 TGFβ1에 덜 민감합니다 (± SEM을 의미). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58237/58237fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>gRNA 호</td>
			<td colspan="2">gRNA 시퀀스</td>
			<td colspan="5">합성 crRNA로 주문</td>
		</tr>
<tr>
<td>gRNA1</td>
			<td colspan="2">5 CCCCTACCATGACTTTATTC 3</td>
			<td colspan="5">/ AltR1/rArGrUrCrArUrGrGrUrArGrGrGrGrArGrCrUrUrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2 /</td>
		</tr>
<tr>
<td>gRNA2</td>
			<td colspan="2">5 ATTGCACTCATCAGAGCTAC 3</td>
			<td colspan="5">/ AltR1/rArUrUrGrCrArCrUrCrArUrCrArGrArGrCrUrArCrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2 /</td>
		</tr>
<tr>
<td>gRNA3</td>
			<td colspan="2">5 AGTCATGGTAGGGGAGCTTG 3</td>
			<td colspan="5">/ AltR1/rArG rUrCrA rUrGrG rUrArGrGrGrG rArGrC rUrUrG rGrUrUrUrUrA rGrArG rCrUrA rUrGrCrU/AltR2 /</td>
		</tr>
</tbody></table>표 1입니다. 3 gRNAs 합성 crRNA로 TGFBR2 ectodomain의 exon 4를 대상으로 설계 되었습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>TGFBR 2 ectodomain 뇌관 FWD</td>
			<td>5 GTC TGC TCC AGG TGA TGT TTA T3</td>
		</tr>
<tr>
<td>TGFBR2 ectodomain 뇌관 레 브</td>
			<td>5 GGG CCT AAT CTG 고양이 온 3 개 그</td>
		</tr>
</tbody></table>표 2입니다. TGFBR2 ectodomain 유전자를 증폭 하는 데 사용 하는 뇌관
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>구성 요소</td>
			<td>금액 (uL)</td>
		</tr>
<tr>
<td>200 µ M crRNA</td>
			<td>2.2</td>
		</tr>
<tr>
<td>200 µ M 추적 RNA</td>
			<td>2.2</td>
		</tr>
<tr>
<td>IDTE 버퍼</td>
			<td>5.6</td>
		</tr>
<tr>
<td>최종 제품</td>
			<td>10</td>
		</tr>
</tbody></table>표 3입니다. 형태는 crRNA:tracerRNA / 200 µ M RNAs를 사용 하 여 복잡 한
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>구성 요소</td>
			<td>금액 (µ L)</td>
		</tr>
<tr>
<td>PBS</td>
			<td>1</td>
		</tr>
<tr>
<td>crRNA:tracrRNA (4.2 단계)에서 이중</td>
			<td>2 (200 pmol)</td>
		</tr>
<tr>
<td>Alt-R Cas9 endonuclease (61 µ M 주식)</td>
			<td>2</td>
		</tr>
<tr>
<td>총 볼륨</td>
			<td>5 ul</td>
		</tr>
</tbody></table>표 4입니다. 단일 crRNA:tracrRNA 이중 반응에 대 한 36 µ m Cas9 endonuclease 희석.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>구성 요소</td>
			<td>금액 (µ L)</td>
		</tr>
<tr>
<td>PBS</td>
			<td>1</td>
		</tr>
<tr>
<td>crRNA:tracrRNA 이중 (예: gRNA1)</td>
			<td>1 (100 pmol)</td>
		</tr>
<tr>
<td>crRNA:tracrRNA 이중 (예: gRNA2)</td>
			<td>1 (100 pmol)</td>
		</tr>
<tr>
<td>Alt-R Cas9 endonuclease</td>
			<td>2</td>
		</tr>
<tr>
<td>총 볼륨</td>
			<td>5 Μ L</td>
		</tr>
</tbody></table>표 5입니다. CrRNA:tracrRNA duplexes의 조합 변환에 대 한 36 µ m Cas9 endonuclease 희석.

Watch this Scientific Journal Video about Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins at JoVE.com

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

여기, 선물이 유전자 Cas9 Ribonucleoproteins (Cas9/RNPs)를 사용 하 여 기본 또는 확장 된 인간의 자연 킬러 (NK) 세포를 수정 하는 프로토콜. 이 프로토콜을 사용 하 여 인간 NK 세포 성장 인자-b 수용 체 2를 변형 (TGFBR2) 및 hypoxanthine phosphoribosyltransferase 1 (HPRT1)에 대 한 결핍을 생성 했습니다.

Cas9 Ribonucleoproteins를 사용 하 여 노크 아웃 기본 및 확장 된 인간 NK 세포의 생성

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging ...

generation-knock-out-primary-expanded-human-nk-cells-using-cas9

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

12.3K 조회수.  Nationwide Children's Hospital. 여기, 선물이 유전자 Cas9 Ribonucleoproteins (Cas9/RNPs)를 사용 하 여 기본 또는 확장 된 인간의 자연 킬러 (NK) 세포를 수정 하는 프로토콜. 이 프로토콜을 사용 하 여 인간 NK 세포 성장 인자-b 수용 체 2를 변형 (TGFBR2) 및 hypoxanthine phosphoribosyltransferase 1 (HPRT1)에 대 한 결핍을 생성 했습니다.

비디오: Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

Expansion, Purification, and Functional Assessment of Human Peripheral Blood NK Cells

Natural killer (NK) cells play an important role in immune surveillance against a variety of infectious microorganisms and tumors. Limited availability of NK cells and ability to expand in vitro has restricted development of NK cell immunotherapy. Here we describe a method to efficiently expand vast quantities of functional NK cells ex vivo using K562 cells expressing membrane-bound IL21, as an artificial antigen-presenting cell (aAPC).
NK cell adoptive therapies to date have utilized a cell product obtained by steady-state leukapheresis of the donor followed by depletion of T cells or positive selection of NK cells. The product is usually activated in IL-2 overnight and then administered the following day 1. Because of the low frequency of NK cells in peripheral blood, relatively small numbers of NK cells have been delivered in clinical trials.
The inability to propagate NK cells in vitro has been the limiting factor for generating sufficient cell numbers for optimal clinical outcome. Some expansion of NK cells (5-10 fold over 1-2 weeks) has be achieved through high-dose IL-2 alone 2. Activation of autologous T cells can mediate NK cell expansion, presumably also through release of local cytokine 3. Support with mesenchymal stroma or artificial antigen presenting cells (aAPCs) can support the expansion of NK cells from both peripheral blood and cord blood 4. Combined NKp46 and CD2 activation by antibody-coated beads is currently marketed for NK cell expansion (Miltenyi Biotec, Auburn CA), resulting in approximately 100-fold expansion in 21 days.
Clinical trials using aAPC-expanded or -activated NK cells are underway, one using leukemic cell line CTV-1 to prime and activate NK cells5 without significant expansion. A second trial utilizes EBV-LCL for NK cell expansion, achieving a mean 490-fold expansion in 21 days6. The third utilizes a K562-based aAPC transduced with 4-1BBL (CD137L) and membrane-bound IL-15 (mIL-15)7, which achieved a mean NK expansion 277-fold in 21 days. Although, the NK cells expanded using K562-41BBL-mIL15 aAPC are highly cytotoxic in vitro and in vivo compared to unexpanded NK cells, and participate in ADCC, their proliferation is limited by senescence attributed to telomere shortening8. More recently a 350-fold expansion of NK cells was reported using K562 expressing MICA, 4-1BBL and IL159.
Our method of NK cell expansion described herein produces rapid proliferation of NK cells without senescence achieving a median 21,000-fold expansion in 21 days.

Here we describe a method to efficiently expand and purify large numbers of human NK cells and assess their function.

확장, 정화, 그리고 사람 말초혈 NK 세포 기능 평가

Natural killer (NK) cells play an important role in immune surveillance against a variety of infectious microorganisms and tumors. Limited availability of ...

연구

면역학 및 감염병학

Generation of Organotypic Raft Cultures from Primary Human Keratinocytes

The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)1. The life cycle of HPV is tightly linked to the differentiation of squamous epithelium2. Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production3,4,5. In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras6 and modified by Kopan et al.7, the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies8. Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as well as adenoviruses, parvoviruses, and poxviruses9. Organotypic raft cultures can thus be adapted to examine viral pathogenesis, and are the only means to test novel antiviral agents for those viruses that are not cultivable in permanent cell lines.

An in vitro method to mimic in vivo epithelial differentiation is described. Many viruses target epithelial cells as part of their viral life cycle, and this method provides a means of examining virus:host interactions that more closely resembles that which occurs in vivo. This technique can be used with primary keratinocytes, established cell lines, as well as normal or diseased biopsy tissue.

기본 인적 Keratinocytes에서 Organotypic 뗏목 문화의 생성

The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates ...

Generation of Induced Regulatory T Cells from Primary Human Na&iuml;ve and Memory T Cells

The development and maintenance of immunosuppressive CD4+ regulatory T cells (Tregs) contribute to the peripheral tolerance needed to remain in immunologic homeostasis with the vast amount of self and commensal antigens in and on the human body. Perturbations in the balance between Tregs and inflammatory conventional T cells can result in immunopathology or cancer. Although therapeutic injection of Tregs has been shown to be efficacious in murine models of colitis1 , type I diabetes2 , rheumatoid arthritis and graft versus host disease,4 several fundamental differences in human versus mouse Treg biology5 has thus far precluded clinical use. The lack of sufficient number, purity, stability and homing specificity of therapeutic Tregs necessitated a dynamic platform of human Treg development on which to optimize conditions for their ex vivo expansion6.
Here we describe a method for the differentiation of induced Tregs (iTregs) from a single human peripheral blood donor which can be broken down into four stages: isolation of peripheral blood mononuclear cells, magnetic selection of CD4+ T cells, in vitro cell culture and fluorescence activated cell sorting (FACS) of T cell subsets. Since the Treg signature transcription factor forkhead box P3 (FoxP3) is an activation-induced transcription factor in humans7 and no other unique marker exists, a combinatorial panel of markers must be used to identify T cells with suppressor activity. After six days in culture, cells in our system can be demarcated into na&iuml;ve T cells, memory T cells or iTregs based on their relative expression of CD25 and CD45RA. As memory and na&iuml;ve T cells have different reported polarization requirements and plasticities8 , pre-sorting of the initial T cell population into CD45RA+ and CD45RO+ subsets can be used to examine these discrepancies. Consistent with others, our CD25HiCD45RA- iTregs express high levels of FoxP39 , GITR and CTLA-411 and low levels of CD12712 . Following FACS of each population, resultant cells can be used in a suppressor assay which evaluates the relative ability to retard the proliferation of carboxyfluorescein succinimidyl ester (CFSE)-labeled autologous T cells.

Generation of Induced Regulatory T Cells from Primary Human Na&#239;ve and Memory T Cells

We describe a method for generating regulatory, memory and na&#239;ve T cells from a single human blood donor. Polarized Tregs can be then compared to other subsets in a variety of genetic and functional applications with genetic homogeneity, including a suppression assay also detailed here.

기본 인적 나이브 및 메모리 T의 세포로부터 유도된 규제 T 세포의 생성

The development and maintenance of immunosuppressive CD4+ regulatory T cells (Tregs) contribute to the peripheral tolerance needed to remain in ...

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

기본 인간 T 세포 piggyBac Transposon 시스템 변경

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide antigens presented by MHC (human ortholog HLA) molecules through the T cell receptor (TCR) in a highly sensitive and specific manner. While the primary function of T cells is to mediate protective immune responses to foreign antigens presented by self-MHC, T cells respond robustly to antigenic differences in allogeneic tissues. T cell responses to alloantigens can be described as either direct or indirect alloreactivity. In alloreactivity, the T cell responds through highly specific recognition of both the presented peptide and the MHC molecule. The robust oligoclonal response of T cells to allogeneic stimulation reflects the large number of potentially stimulatory alloantigens present in allogeneic tissues. While the breadth of alloreactive T cell responses is an important factor in initiating and mediating the pathology associated with biologically-relevant alloreactive responses such as graft versus host disease and allograft rejection, it can preclude analysis of T cell responses to allogeneic ligands. To this end, this protocol describes a method for generating alloreactive T cells from naive human peripheral blood leukocytes (PBL) that respond to known peptide-MHC (pMHC) alloantigens. The protocol applies pMHC multimer labeling, magnetic bead enrichment and flow cytometry to single cell in vitro culture methods for the generation of alloantigen-specific T cell clones. This enables studies of the biochemistry and function of T cells responding to allogeneic stimulation.

This article describes a method for the generation and propagation of human T cell clones that specifically respond to a defined alloantigen. This protocol can be adapted for cloning human T cells specific for a variety of peptide-MHC ligands.

말초 혈액에서 인간 Alloantigen 특정 T 세포의 생성

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

정렬 된 불멸화 된 B 세포로부터 재조합 인간 IgG 단일 클론 항체의 생성

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition receptors (PRRs) expressed on their cell surface and thereby activate and regulate immunity. 
The major function of DCs is the induction of adaptive immunity in the lymph nodes by presenting antigens via MHC I and MHC II molecules to na&#239;ve T lymphocytes. Therefore, DCs have to migrate from the periphery to the lymph nodes after the recognition of pathogens at the sites of infection. For in vitro experiments or DC vaccination strategies, monocyte-derived DCs are routinely used. These cells show similarities in physiology, morphology, and function to conventional myeloid dendritic cells. They are generated by interleukin 4 (IL-4) and granulocyte-macrophage colony-stimulating factor (GM-CSF) stimulation of monocytes isolated from healthy donors. Here, we demonstrate how monocytes are isolated and stimulated from anti-coagulated human blood after peripheral blood mononuclear cell (PBMC) enrichment by density gradient centrifugation. Human monocytes are differentiated into immature DCs and are ready for experimental procedures in a non-clinical setting after 5 days of incubation.

Here, we demonstrate how monocytes are isolated by magnetic bead separation from peripheral blood mononuclear cells after density gradient centrifugation of human anti-coagulated blood. Following incubation for 5 days, human monocytes are differentiated into immature dendritic cells and are ready for experimental procedures in a non-clinical setting.

전혈로부터 인간 단핵구 유래 수지상 세포의 생성

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining the role of the gene of interest in the development, differentiation, and function of NK cells. Recent advances related to chimeric antigen receptors (CARs) in cancer immunotherapy accentuate the need for an efficient method to deliver exogenous genes to effector lymphocytes. The efficiencies of lentiviral-mediated gene transductions into primary human or mouse NK cells remain significantly low, which is a major limiting factor. Recent advances using cationic polymers, such as polybrene, show an improved gene transduction efficiency in T cells. However, these products failed to improve the transduction efficiencies of NK cells. This work shows that dextran, a branched glucan polysaccharide, significantly improves the transduction efficiency of human and mouse primary NK cells. This highly reproducible transduction methodology provides a competent tool for transducing human primary NK cells, which can vastly improve clinical gene delivery applications and thus NK cell-based cancer immunotherapy.

The goal of this study was to formulate technologies that allow for successful gene transduction in primary natural killer (NK) cells. The dextran-mediated lentiviral transduction of human or mouse primary NK cells results in higher gene expression efficiencies. This method of gene transduction will vastly improve NK cell genetic manipulation.

Dextran Murine 및 인간의 기본 NK 세포의 Lentiviral 변환 효율 향상

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated from na&#239;ve CD4+ T cells in vitro by activating them in the presence of the polarizing cytokines IL-1&#946;, IL-6, IL-23, and TGF&#946;. Th17 cells orchestrate immunity against extracellular bacteria and fungi, but their aberrant activity has also been associated with several autoimmune and inflammatory diseases. Th17 cells are identified by the chemokine receptor CCR6 and defined by their master transcription factor, ROR&#947;t, and characteristic effector cytokine, IL-17A. Optimized culture conditions for Th17 cell differentiation facilitate mechanistic studies of human T cell biology in a controlled environment. They also provide a setting for studying the importance of specific genes and gene expression programs through RNA interference or the introduction of microRNA (miRNA) mimics or inhibitors. This protocol provides an easy to use, reproducible, and highly efficient method for transient transfection of differentiating primary human Th17 cells with small RNAs using a next generation electroporation device.

Next generation electroporation is an efficient method for transfecting human Th17 cells with small RNAs to alter gene expression and cell behavior.

차세대 일렉트로 차 인간 Th17 세포 작은 RNA 형질

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...

A Flow Cytometry-Based Cytotoxicity Assay for the Assessment of Human NK Cell Activity

Within the innate immune system, effector lymphocytes known as natural killer (NK) cells play an essential role in host defense against aberrant cells, specifically eliminating tumoral and virally infected cells. Approximately 30 known monogenic defects, together with a host of other pathological conditions, cause either functional or classic NK cell deficiency, manifesting in reduced or absent cytotoxic activity. Historically, cytotoxicity has been investigated with radioactive methods, which are cumbersome, expensive and potentially hazardous. This article describes a streamlined, clinically applicable flow cytometry-based method to quantify NK cell cytotoxic activity. In this assay, peripheral blood mononuclear cells (PBMCs) or purified NK cell preparations are co-incubated at different ratios with a target tumor cell line known to be sensitive to NK cell-mediated cytotoxicity (NKCC). The target cells are pre-labeled with a fluorescent dye to allow their discrimination from the effector cells (NK cells). After the incubation period, killed target cells are identified by a nucleic acid stain, which specifically permeates dead cells. This method is amenable to both diagnostic and research applications and, thanks to the multi-parameter capabilities of flow cytometry, has the added advantage of potentially enabling a deeper analysis of NK cell phenotype and function.

A flow cytometry-based method to quantitatively determine the cytotoxic activity of human natural killer cells is shown here.

인간 NK 세포 활동의 평가 대 한 흐름 Cytometry 기반 세포 독성 분석 실험

Within the innate immune system, effector lymphocytes known as natural killer (NK) cells play an essential role in host defense against aberrant cells, ...