Name: methodology for accurate detection of mitochondrial dna methylation
Uploaded: 2018-05-20T13:30:00.000+00:00
Duration: 12 min 11 s
Description: Watch this Scientific Journal Video about Methodology for Accurate Detection of Mitochondrial DNA Methylation at JoVE.com

The Novo Nordisk Foundation Centre for Basic Metabolic Research is an independent research center at the University of Copenhagen partially funded by an unrestricted donation from the Novo Nordisk Foundation.

1. Restriction Enzyme Treatment
<ol>
	<li>Linearize mtDNA by treating total human DNA with the restriction enzyme BamHI, that cuts at position 14258 in the human mitochondrial DNA. 
	NOTE: For mouse DNA, use the restriction enzyme BglII under identical conditions as below.</li>
	<li>For each sample where mtDNA methylation is to be assessed, prepare one 0.2 mL reaction tube and add the following mix:3 &#956;g genomic DNA (quantified by fluorometry), 15 &#956;L Buffer 3, 3 &#956;L BamHI and water up to of 150 &#956;L</li>
	<li>Place tubes in a thermal cycler for 4 h at 37 &#176;C.</li>
</ol>
2. Bisulfite Conversion
<ol>
	<li>Convert BamHI-treated DNA using sodium bisulfite as described elsewhere29.</li>
	<li>Use 200-500 ng BamHI-treated DNA for each conversion reaction in a total volume of 20 &#956;L. The DNA recovery is 50-70%.</li>
	<li>Elute the Bisulfite-converted DNA in 10 &#956;L elution buffer.</li>
	<li>Quantify the single-stranded DNA by fluorometry.</li>
	<li>Optional: Store bisulfite-converted DNA at -20 &#176;C before proceeding the remaining of the protocol. For long-term storage, store bisulfite-converted DNA at -80 &#176;C</li>
</ol>
3. Design of Bisulfite Sequencing Primers
<ol>
	<li>Design primers for bisulfite sequencing using the online tools Methprimer30 and BiSearch31,32. 
	NOTE: Methprimer and BiSearch allow to search for primer binding sequences on genomic sequences where cytosines are converted to thymines, similarly to post-bisulfite treatment.</li>
	<li>For optimal and unbiased amplification, avoid CpG dinucleotides in the primers and design the amplicon size between 100-300 bp.</li>
	<li>Ensure that designed primers are specific to the mitochondrial DNA using BiSearch&#39;s function Primer Search. Insert the already designed bisulfite converted primers, tick the bisulfite box and include a reference genome and PCR parameters. 
	NOTE: A list of possible PCR products will be displayed.</li>
	<li>Copy the top 1-5 primer sequences and paste them into an ordering form for oligonucleotide synthesis. 
	NOTE: A list of human and mouse mtDNA primer sequences that has been validated in the lab is displayed in Table 1.</li>
	<li>Test primers using bisulfite converted PCR following agarose gel electrophoresis as described in step 4. Test and optimize all primer pairs separately and ensure the correct amplicon size appears on the agarose gel. 
	NOTE: If multiplexing primers are needed, add multiple primers to one single PCR reaction and visualize the PCR products on agarose gel electrophoresis or, a more resolutive method such as polyacrylamide gel electrophoresis, to distinguish products of similar size.</li>
</ol>
4. Bisulfite Converted PCR and Gel Extraction
<ol>
	<li>To amplify the regions of interest, perform PCR using a hot start Taq polymerase. Briefly, mix 100 ng converted DNA, 500 &#181;M sense and anti-sense primers,&#160;1 &#181;L dNTP mix (10 &#181;M of each dNTP), and polymerase at 7.5 U/reaction in a total volume of 50 &#181;L. Run PCR with the following conditions: 5 min at 95 &#176;C (60 s 94 &#176;C; 60 s 55 &#176;C*; 60 s 72 &#176;C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg" /> 35 cycles; 10 min 72 &#176;C. Use primers either separately or multiplexed.</li>
	<li>Optional: When multiplexing primers, use 200 ng converted DNA and the following cycling conditions: 5 min 95 &#176;C (60 s 94 &#176;C; 90 s 55 &#176;C*; 90 s 72 &#176;C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg" /> 35 cycles; 10 min 72 &#176;C. 
	NOTE: Temperature may vary depending on the melting temperature of primers.</li>
	<li>Subject PCR products to gel electrophoresis on 2% agarose at 100 volts.</li>
	<li>Under gentle UV light, extract PCR products with a scalpel and add to microtubes. Do not expose PCR products to excessive UV light to avoid DNA damage. Avoid exposure time over 30 s.</li>
	<li>Purify the PCR products using gel purification as described previously3.</li>
	<li>Quantify the purified DNA from step 4.5 using fluorometry. Proceed to step 5 or store samples at -20&#176;C.</li>
</ol>
5. Bisulfite Sequencing Library Preparation
<ol>
	<li>Perform library preparation of bisulfite-converted PCR products. 
	Optional: multiplex PCR products at this stage.</li>
	<li>Perform end-repair using up to 100 ng of PCR product. Add 3 &#181;L End prep enzyme and 6.5 &#181;L End repair reaction buffer (10x) to 55.5 &#181;L PCR product in a 0.2 mL tube. Place and incubate tube in a thermal cycler for 30 min at 20 &#176;C followed by 30 min at 65 &#176;C.</li>
	<li>Ligate sequencing adaptors by mixing the end-repaired DNA with 15 &#181;L Blunt/TA ligase mix, 2.5 &#181;L Adaptor and 1 &#181;L Ligation enhancer. If using &#60;100 ng PCR product as input, dilute adaptor 10 times.</li>
	<li>Place the mix (step 5.3) in a thermal cycler and incubate 15 min at 20 &#176;C. Pause the thermal cycler and add 3 &#181;l USER Enzyme to the tube. Mix and place the tube back in the Thermal cycler and incubate 15 min at 37 &#176;C.</li>
	<li>Size select the adaptor-ligated DNA by using Solid Phase Reversible Immobilization (SPRI) beads with varying ratios of beads to DNA depending on PCR product size.</li>
	<li>Add 13.5 &#181;L H2O to adaptor-ligated DNA from step 5.4 and 55 &#181;L resuspended SPRI beads. Incubate at room temperature for 5 min and place tube on a magnetic stand. When the solution is clear, transfer the supernatant to a new tube and discard tube containing the beads. 
	NOTE: The supernatant contains the adaptor-ligated DNA and large unwanted fragments are bound to the discarded beads.</li>
	<li>Add 25 &#181;L resuspended SPRI beads to the supernatant from step 5.6, mix and incubate for 5 min at room temperature. Place the tube on the magnetic stand and discard the supernatant when the solution is clear. 
	NOTE: The discarded supernatant contains unwanted DNA, whereas the adaptor-ligated DNA is bound to beads.</li>
	<li>While the tube is on the magnetic stand, add 200 &#181;L 80% ethanol (freshly prepared) to wash the beads. Incubate 30 s and remove and discard the supernatant. Repeat this step for a total of 2 washes.</li>
	<li>Air dry beads for 5 min while the tube is on magnetic stand with an open lid.</li>
	<li>Remove the tube from the magnet, elute the DNA in 23 &#181;L elution buffer and mix. Incubate at room temperature for 2 min.</li>
	<li>Place the tube on a magnetic stand and when the solution is clear, transfer 2 &#181;L to a 96-well PCR plate for the pre-PCR amplification (step 5.14).</li>
	<li>Transfer the rest approximately 21 &#181;L to a new 0.2 mL tube for PCR amplification (step 5.17). 
	NOTE: Be sure NOT to transfer any beads as beads can inhibit enzymatic reactions of next steps.</li>
	<li>Proceed to step 5.14 or store samples at -20&#176;C.</li>
	<li>Perform pre-PCR amplification by RT-qPCR to estimate the number of cycles needed to amplify the adaptor-ligated DNA. Per reaction, add the following in the 96-well PCR plate containing 2 &#181;L DNA (step 5.11): 0.4 &#181;L Index primer, 0.4 &#181;L universal PCR primer, 7.2 &#181;L H2O, 10 &#181;L RT-qPCR master mix.</li>
	<li>Place the plate in a real-time PCR machine and subject the plate to the following conditions: 30 s at 98 &#176;C (10 s 98 &#176;C; 75 s 65 &#176;C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg" /> 20 cycles; 5 min 65 &#176;C.</li>
	<li>Estimate the number of amplification cycles needed for each sample by subtracting one Ct-value to the Ct-value of the pre-amplification RT-qPCR corresponding to the end of the linear phase of the PCR reaction.</li>
	<li>Amplify the adaptor-ligated DNA from step 5.12 by mixing: 21 &#181;L DNA, 25 &#181;L PCR master mix, 1 &#181;L Index primer, 1 &#181;L Universal PCR primer and 2 &#181;L H2O. In a thermal cycler, subject each sample to the following conditions: 30 s at 98 &#176;C (10 s 98 &#176;C; 75 s 65 &#176;C) <img alt="arrow" src="/files/ftp_upload/57772/57772eq2.jpg" /> [calculated Ct from step 5.16] cycles; 5 min 65 &#176;C. 
	NOTE: Remember to only use one Index primer per sample to allow for multiplexing. The index is inserted during the PCR.</li>
	<li>Purify the amplified DNA SPRI beads and elute in 22 &#181;L elution buffer.</li>
	<li>Control library quality by gel electrophoresis or alternative method. Look for correct library peak sizes (PCR product(s) size plus adaptor).</li>
	<li>Estimate the average base-pair size of the library product(s) by smear analysis: In advanced global settings, double-click on &#34;Table&#34; under smear analysis. Define the region from 100-1000 bp and click OK. Under Region Table, the defined region appears and library average size (bp) is calculated.</li>
	<li>Quantify libraries by fluorometry. Proceed to step 6 or store libraries at -20 &#176;C.</li>
</ol>
6. Next Generation Sequencing
<ol>
	<li>Calculate the nM concentration of libraries using the formula: 
	<img alt="Equation" src="/files/ftp_upload/57772/57772eq1.jpg" /></li>
	<li>Dilute libraries to the same nM concentration e.g. 2 nM (choose 4 nM, 2 nM, 1 nM, or 0.5 nM depending on library concentrations). Pool all libraries to achieve a pool of 2 nM libraries.</li>
	<li>Denature and dilute libraries following the sequencing instrument guide. In short: Denature the 2 nM pool by adding 0.2 N NaOH and incubate at room temperature for 5 min. Dilute the denatured pool to a final dilution of 10 pM. Denature and dilute a commercially available Control library to a final dilution of 12.5 pM. To a new tube, mix the 10 pM pool with 20% 12.5 pM Control library. 
	NOTE: Bisulfite conversion introduces very low complexity. 20% Control library spike-in will result in better sequencing quality.</li>
	<li>Run a 150 bp paired-end sequencing using a deep sequencing instrument.</li>
</ol>
7. Computational Analysis - Estimate Methylation Levels
<ol>
	<li>Generate .fastq files (here called sample1_R1.fastq.gz and sample1_R2.fastq.gz), generate a bismark index of the entire genome of interest (here in a folder called bismarkIndex) and make sure that the genomic sequence of chrM is available in fasta format (here in a folder called chrM).</li>
	<li>Pre-process reads to remove adapters and bias introduced by the primers: Use the tool Trim_galore33. Remove two nucleotides from the 5&#39; end of both the forward and reverse reads. 
	trim_galore --clip_R1 2 --clip_R2 2 -o ./ --trim1 --paired sample1_R1.fastq.gz sample1_R2.fastq.gz</li>
	<li>Align pre-processed reads to the entire genome using Bismark34 
	bismark --dovetail --bam -o ./ ./bismarkIndex / -1 ./sample1_R1_val_1.fq.gz -2 ./sample1_R2_val_2.fq.gz 
	NOTE: If another aligner is used, make sure that reads that cannot be uniquely aligned are discarded.</li>
	<li>Extract reads mapping to the chromosome M, here using Samtools35 
	samtools sort -l 0 -O BAM -o sample1_sorted.bam 
	sample1_R1_val_1_bismark_bt2_pe.bam 
	samtools index sample1_sorted.bam 
	samtools view -u sample1_sorted.bam chrM | samtools sort -n -O BAM -o sample1_chrM.bam</li>
	<li>Extract the methylation information 
	bismark_methylation_extractor -p --CX --cytosine_report --comprehensive --genome_folder ./chrM ./sample1_chrM.bam</li>
	<li>Use the .bedGraph, the .cov or the CX_report.txt files for further analysis. Use the sample1_chrM.CX_report.txt file for visualization and testing.</li>
	<li>Perform further clipping in the preprocessing step, if multiple regions are interrogated and a primer bias may be visible in the M-bias plots generated during the mapping. Refer to the Bismark documentation for more information.</li>
</ol>
8. Computational Analysis - Test of differences
<ol>
	<li>Ensure that the CX_report.txt file contains 7 columns, chromosome (here chrM), position, strand, number of methylated reads, number of unmethylated reads, C context and surrounding sequence, for every C on chromosome M.</li>
	<li>As the CX_report covers chrM in its entirety, check the subset to the region(s) which is amplified.</li>
	<li>Use non-parametric tests for differences between samples, such as a Fishers&#39;s exact test for individual C&#39;s or a sign-test for an entire region. 
	NOTE: Quantification will often be close to 0% methylation, which is the reason why assuming normality is not appropriate.</li>
	<li>Similarly, for visualization, either visualize quantiles or calculate binomial proportion confidence intervals.</li>
</ol>

<ol>
	<li>Falkenberg, M., Larsson, N. -. G., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+replication+and+transcription+in+mammalian+mitochondria.">DNA replication and transcription in mammalian mitochondria.</a> Annu Rev Biochem. 76, 679-699 (2007).</li><li>Kolesar, J. E., Wang, C. Y., Taguchi, Y. V., Chou, S. -. H., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+intact+mitochondrial+DNA+agarose+electrophoresis+reveals+the+structural+complexity+of+the+mammalian+mitochondrial+genome.">Two-dimensional intact mitochondrial DNA agarose electrophoresis reveals the structural complexity of the mammalian mitochondrial genome.</a> Nucleic Acids Res. 41 (4), e58 (2013).</li><li>Mechta, M., Ingerslev, L. R., Fabre, O., Picard, M., Barres, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+Suggesting+Absence+of+Mitochondrial+DNA+Methylation.">Evidence Suggesting Absence of Mitochondrial DNA Methylation.</a> Front Genet. 8, 166 (2017).</li><li>Ehrlich, M., Gama-Sosa, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amount+and+distribution+of+5-methylcytosine+in+human+DNA+from+different+types+of+tissues+of+cells.">Amount and distribution of 5-methylcytosine in human DNA from different types of tissues of cells.</a> Nucleic Acids Res. 10 (8), 2709-2721 (1982).</li><li>Lister, R., Pelizzola, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+DNA+methylomes+at+base+resolution+show+widespread+epigenomic+differences.">Human DNA methylomes at base resolution show widespread epigenomic differences.</a> Nature. 462 (7271), 315-322 (2009).</li><li>Yan, J., Zierath, J. R., Barres, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+non-CpG+methylation+in+mammals.">Evidence for non-CpG methylation in mammals.</a> Exp Cell Res. 317 (18), 2555-2561 (2011).</li><li>Patil, V., Ward, R. L., Hesson, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evidence+for+functional+non-CpG+methylation+in+mammalian+cells.">The evidence for functional non-CpG methylation in mammalian cells.</a> Epigenetics. 9 (6), 823-828 (2014).</li><li>Nass, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+methylation+of+mitochondrial+and+nuclear+DNA+in+cultured+mouse,+hamser+and+virus+trasnforemd+hamser+cells+in+vivo+and+in+vitro+methylation.">Differential methylation of mitochondrial and nuclear DNA in cultured mouse, hamser and virus trasnforemd hamser cells in vivo and in vitro methylation.</a> J Mol Biol. 80 (1), 155-175 (1973).</li><li>Shock, L. S., Thakkar, P. V., Peterson, E. J., Moran, R. G., Taylor, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+methyltransferase+1,+cytosine+methylation,+and+cytosine+hydroxymethylation+in+mammalian+mitochondria.">DNA methyltransferase 1, cytosine methylation, and cytosine hydroxymethylation in mammalian mitochondria.</a> PNAS. 108 (9), 3630-3635 (2011).</li><li>Bellizzi, D., D'Aquila, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Control+Region+of+Mitochondrial+DNA+Shows+an+Unusual+CpG+and+Non-CpG+Methylation+Pattern.">The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern.</a> DNA Res. 20 (6), 537-547 (2013).</li><li>Jia, Y., Li, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+Low-Protein+Diet+Affects+Epigenetic+Regulation+of+Hepatic+Mitochondrial+DNA+Transcription+in+a+Sex-Specific+Manner+in+Newborn+Piglets+Associated+with+GR+Binding+to+Its+Promoter.">Maternal Low-Protein Diet Affects Epigenetic Regulation of Hepatic Mitochondrial DNA Transcription in a Sex-Specific Manner in Newborn Piglets Associated with GR Binding to Its Promoter.</a> PLoS ONE. 8 (5), e63855 (2013).</li><li>Jia, Y., Song, H., Gao, G., Cai, D., Yang, X., Zhao, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+Betaine+Supplementation+during+Gestation+Enhances+Expression+of+mtDNA-Encoded+Genes+through+D-Loop+DNA+Hypomethylation+in+the+Skeletal+Muscle+of+Newborn+Piglets.">Maternal Betaine Supplementation during Gestation Enhances Expression of mtDNA-Encoded Genes through D-Loop DNA Hypomethylation in the Skeletal Muscle of Newborn Piglets.</a> J Agric Food Chem. 63 (46), 10152-10160 (2015).</li><li>Infantino, V., Castegna, A., Iacobazzi, F., Spera, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impairment+of+methyl+cycle+affects+mitochondrial+methyl+availability+and+glutathione+level+in+Down's+syndrome.">Impairment of methyl cycle affects mitochondrial methyl availability and glutathione level in Down's syndrome.</a> Mol Genet Metab. 102 (3), 378-382 (2011).</li><li>Chen, H., Dzitoyeva, S., Manev, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+valproic+acid+on+mitochondrial+epigenetics.">Effect of valproic acid on mitochondrial epigenetics.</a> Eur J Pharmacol. 690 (1-3), 51-59 (2012).</li><li>Dzitoyeva, S., Chen, H., Manev, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+aging+on+5-hydroxymethylcytosine+in+brain+mitochondria.">Effect of aging on 5-hydroxymethylcytosine in brain mitochondria.</a> Neurobiol Aging. 33 (12), 2881-2891 (2012).</li><li>Menga, A., Palmieri, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SLC25A26+overexpression+impairs+cell+function+via+mtDNA+hypermethylation+and+rewiring+of+methyl+metabolism.">SLC25A26 overexpression impairs cell function via mtDNA hypermethylation and rewiring of methyl metabolism.</a> FEBS J. 284 (6), 967-984 (2017).</li><li>Frommer, M., McDonald, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genomic+sequencing+protocol+that+yields+a+positive+display+of+5-methylcytosine+residues+in+individual+DNA+strands.">A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.</a> PNAS. 89 (5), 1827-1831 (1992).</li><li>Byun, H. -. M., Panni, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+airborne+pollutants+on+mitochondrial+DNA+Methylation.">Effects of airborne pollutants on mitochondrial DNA Methylation.</a> Part Fibre Toxicol. 10 (1), 1 (2013).</li><li>Janssen, B. G., Byun, H. -. M., Gyselaers, W., Lefebvre, W., Baccarelli, A. A., Nawrot, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Placental+mitochondrial+methylation+and+exposure+to+airborne+particulate+matter+in+the+early+life+environment:+An+ENVIRONAGE+birth+cohort+study.">Placental mitochondrial methylation and exposure to airborne particulate matter in the early life environment: An ENVIRONAGE birth cohort study.</a> Epigenetics. 10 (6), 536-544 (2015).</li><li>Zheng, L. D., Linarelli, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+resistance+is+associated+with+epigenetic+and+genetic+regulation+of+mitochondrial+DNA+in+obese+humans.">Insulin resistance is associated with epigenetic and genetic regulation of mitochondrial DNA in obese humans.</a> Clin Epigenetics. 7 (1), 1739 (2015).</li><li>Byun, H. -. M., Colicino, E., Trevisi, L., Fan, T., Christiani, D. C., Baccarelli, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Air+Pollution+and+Blood+Mitochondrial+DNA+Methylation+on+Markers+of+Heart+Rate+Variability.">Effects of Air Pollution and Blood Mitochondrial DNA Methylation on Markers of Heart Rate Variability.</a> J Am Heart Assoc. 5 (4), (2016).</li><li>Bianchessi, V., Vinci, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrion.">Mitochondrion.</a> MITOCH. 27 (C), 40-47 (2016).</li><li>Wijst, M. G. P., van Tilburg, A. Y., Ruiters, M. H. J., Rots, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+mitochondria-targeted+DNA+methylation+identifies+GpC+methylation,+not+CpG+methylation,+as+potential+regulator+of+mitochondrial+gene+expression.">Experimental mitochondria-targeted DNA methylation identifies GpC methylation, not CpG methylation, as potential regulator of mitochondrial gene expression.</a> Sci Rep. 7 (1), 177 (2017).</li><li>Wong, M., Gertz, B., Chestnut, B. A., Martin, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNMT3A+and+DNA+methylation+in+skeletal+muscle+and+CNS+of+transgenic+mouse+models+of+ALS.">Mitochondrial DNMT3A and DNA methylation in skeletal muscle and CNS of transgenic mouse models of ALS.</a> Front cellr Neurosci. 7, 279 (2013).</li><li>Dawid, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5-methylcytidylic+acid:+absence+from+mitochondrial+DNA+of+frogs+and+HeLa+cells.">5-methylcytidylic acid: absence from mitochondrial DNA of frogs and HeLa cells.</a> Science. 184 (4132), 80-81 (1974).</li><li>Gama-Sosa, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Levels and distribution of 5-methylcytosine in Chordate DNA. , 1-201 (1985).</li><li>Hong, E. E., Okitsu, C. Y., Smith, A. D., Hsieh, C. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regionally+specific+and+genome-wide+analyses+conclusively+demonstrate+the+absence+of+CpG+methylation+in+human+mitochondrial+DNA.">Regionally specific and genome-wide analyses conclusively demonstrate the absence of CpG methylation in human mitochondrial DNA.</a> Mol Cell Biol. 33 (14), 2683-2690 (2013).</li><li>Liu, B., Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CpG+methylation+patterns+ofhuman+mitochondrial+DNA.">CpG methylation patterns ofhuman mitochondrial DNA.</a> Nature Publishing Group. , 1-10 (2016).</li><li>Donkin, I., Versteyhe, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+and+Bariatric+Surgery+Drive+Epigenetic+Variation+of+Spermatozoa+in+Humans.">Obesity and Bariatric Surgery Drive Epigenetic Variation of Spermatozoa in Humans.</a> Cell Metab. 23 (2), 369-378 (2016).</li><li>Li, L. C., Dahiya, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MethPrimer:+designing+primers+for+methylation+PCRs.">MethPrimer: designing primers for methylation PCRs.</a> Bioinformatics. 18 (11), 1427-1431 (2002).</li><li>Tusn&#225;dy, G. E., Simon, I., V&#225;radi, A., Ar&#225;nyi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BiSearch:+primer-design+and+search+tool+for+PCR+on+bisulfite-treated+genomes.">BiSearch: primer-design and search tool for PCR on bisulfite-treated genomes.</a> Nucleic Acids Res. 33 (1), e9 (2005).</li><li>Ar&#225;nyi, T., V&#225;radi, A., Simon, I., Tusn&#225;dy, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BiSearch+web+server.">The BiSearch web server.</a> BMC bioinformatics. 7, 431 (2006).</li><li>Krueger, F., Andrews, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bismark:+a+flexible+aligner+and+methylation+caller+for+Bisulfite-Seq+applications.">Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications.</a> Bioinformatics. 27 (11), 1571-1572 (2011).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Ramos, A., Barbena, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+insertions+of+mitochondrial+origin:+Database+updating+and+usefulness+in+cancer+studies.">Nuclear insertions of mitochondrial origin: Database updating and usefulness in cancer studies.</a> Mitochondrion. 11 (6), 946-953 (2011).</li><li>Warnecke, P. M., Stirzaker, C., Song, J., Grunau, C., Melki, J. R., Clark, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+resolution+of+artifacts+in+bisulfite+sequencing.">Identification and resolution of artifacts in bisulfite sequencing.</a> Methods (San Diego, Calif). 27 (2), 101-107 (2002).</li></ol>

The authors have no competing financial interests to declare.

Here, we provide a bisulfite-sequencing protocol which is specifically designed to interrogate mtDNA methylation. The differences with bisulfite-sequencing protocols used for genomic DNA lies in the utilization of a prior restriction enzyme digestion step and a bioinformatic analysis ruling out false positive arising from NUMT sequences.
We provide a protocol to avoid bisulfite-sequencing artifacts when investigating mtDNA methylation. Bisulfite sequencing artifacts leading to false-positives were previously reported37. Insufficient removal of DNA accessory proteins by proteinase K has been described37. Incomplete denaturation or partial reannealing can lead to stretches of incomplete conversion, possibly by lowering access of bisulfite to single-stranded DNA37. The later artifact could be at play in mtDNA where a secondary structure would impair access to cytosines. To the best of our knowledge, the addition of a restriction enzyme digestion step prior to bisulfite conversion in the context of estimating mtDNA methylation has been first reported in 20163,28. In our hands too, prior digestion with a single-cutter restriction enzyme dramatically lowered detection of unconverted cytosines3,28.
Here, we provide a bioinformatic pipeline to analyze bisulfite sequencing results and to detect bisulfite sequencing artifacts in the context of whole mitochondrial genome bisulfite sequencing. This method originates from our observation that mtDNA non-conversion rate was inversely correlated with sequencing depth3,28. This observation suggests that the secondary and even tertiary structure of mtDNA impairs the fragmentation of mtDNA at specific regions during the construction of sequencing libraries and could also impair full access of sodium bisulfite to mtDNA. Since digestion with a one-cutter enzyme releases secondary and tertiary structures, our results indicate that mtDNA structure is a source of bisulfite artifact and validate the methods described herein for the quantification of cytosine methylation in mtDNA.
The inevitable contamination of nuclear DNA in mitochondrial preparation constitutes a challenge. This leads to contamination in NUMT sequences in sequencing reads, which may bias estimation of cytosine methylation in mtDNA, even when performing targeted and not whole mitochondrial genome bisulfite sequencing. To avoid such bias, the design of unique bisulfite sequencing primers allows to exclude contamination with methylation at NUMTs. NUMTs span certain regions of the human and mouse mitochondrial genome with 100% identity, and it is, therefore, impossible to design unique primers at certain mtDNA regions. When performing whole mitochondrial genome bisulfite sequencing, sequencing long reads can ease discrimination between mtDNA and NUMTs. Aligning reads to the whole genome and only use reads uniquely mapped to the mitochondrial genome can further ensure detection of mtDNA methylation.
Finally, this protocol can be used beyond mitochondrial genomes, for example, in other instances of bisulfite sequencing where the secondary structure of DNA represents a potential source of artifact. The association between methylation levels and sequencing depth can be investigated to assess the need for a digestion with a restriction enzyme prior to bisulfite sequencing of complex DNA sequences.

The mitochondrial genome is a circular, double-stranded structure of approximately 16.5-kilo base (kb) long, constituting of a heavy and a light strand. The mitochondrial genome is present in multiple copies within each cell, maternally-inherited, and encodes essential components of the respiratory chain complexes1. Similar to bacterial genomes and unlike the nuclear genome, the mitochondrial genome is organized in numerous secondary and tertiary structures, such as in coiled and supercoiled structures2, which can render access difficult during sequencing experiments3.
In the nucleus, methylation of the DNA is an extensively studied epigenetic mark that plays a role in numerous processes, notably in the regulation of gene expression. In mammalian genomes, DNA methylation occurs primarily on the 5-position of the pyrimidine ring of deoxycytidines, mostly on CG dinucleotides (or CpG). Cytosine methylation is found at 70% of all CpG in the genome of somatic cells and accounts for ~1% of total DNA bases4. DNA methylations has also been described in non-CpG contexts, such as CpA, CpT, and CpC and exist in various amounts in nuclear DNA, with values up to 25% of all methylated cytosines in embryonic stem cells5,6,7.
While cytosine methylation of the nuclear genome is widely accepted, the existence of mitochondrial DNA (mtDNA) methylation is still controversial. The first study investigating mtDNA methylation was performed in cultured cells where mtDNA methylation was readily detected, although at lower levels compared to nuclear DNA8. In both human and murine cells, mtDNA methylation was also detected at low levels (2-5%). Using assays relying on 5 methylcytosine capture such as methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR, mtDNA methylation was also detected in various mouse and human and cells lines9,10,11,12. Using antibodies against 5-methylcytosine in an ELISA assay or mass spectrometry, substantial levels of DNA methylation were detected from purified mitochondrial fractions13,14,15,16. However, most of the assays in the aforementioned studies used techniques that were not designed to provide absolute quantification of DNA methylation at the single base-resolution.
Quantitative and resolutive DNA methylation analysis can be achieved by a technique named &#34;bisulfite sequencing&#34;, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil in single-stranded DNA context17. Using bisulfite sequencing, a constellation of studies has detected the presence of cytosine methylation at various levels. Methylation mtDNA in the D-loop region, the 12S or the 16S region was readily detected in human18,19,20,21,22,23 and mouse24 tissues and cells, however, with an intriguing variability, of 1-20% of total cytosines across studies.
In comparison to these numerous studies, only a few studies, including from our group, have disputed the presence of mtDNA methylation3,25,26,27 or questioned the biological relevance of very low levels of mtDNA levels (below 2%)28. Recently, we reported the observation of a potential bisulfite-sequencing artifact in whole mitochondrial bisulfite sequencing3. We provided evidence that the secondary structure of mitochondrial DNA could lead to false positives in bisulfite sequencing, thereby overestimating methylation levels. We provide here a protocol to prevent an artifact of bisulfite-conversion of mtDNA. This protocol uses a simple enzymatic digestion of DNA to disrupt mtDNA secondary structures and allow full access to bisulfite following a bisulfite sequencing protocol. In addition, we provide an accompanying bioinformatic pipeline for the analysis of bisulfite sequencing.

<table><tbody><tr><td>BamHI</td><td>New England BioLabs</td><td># R0136</td><td></td></tr><tr><td>EZ DNA methylation-lightning kit</td><td>Zymo Research</td><td># D5030&amp;nbsp;</td><td></td></tr><tr><td>Qubit ssDNA assay</td><td>Thermo Fisher Scientific</td><td># Q10212</td><td></td></tr><tr><td>Qubit assay tubes</td><td>Thermo Fisher Scientific</td><td># Q32856</td><td></td></tr><tr><td>HotStarTaq plus DNA polymerase kit</td><td>Qiagen</td><td># 203603&amp;nbsp;</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td># 28704</td><td></td></tr><tr><td>NEBNext Ultra DNA Library Kit for Illumina</td><td>New England BioLabs</td><td># E7370S</td><td></td></tr><tr><td>NEBNext Multiplex Oligoes for Illumina</td><td>New England BioLabs</td><td># E7335S</td><td></td></tr><tr><td>AMPure XP Beads</td><td>Beckman Coulter</td><td># A63881</td><td></td></tr><tr><td>High Sensitivity DNA chip</td><td>Agilent</td><td># 5067-4626</td><td></td></tr><tr><td>Qubit high sensitivity dsDNA assay</td><td>Thermo Fisher Scientific</td><td># Q33230</td><td></td></tr><tr><td>MiSeq reagent kit v2 300 cycles</td><td>Illumina</td><td># MS-102-2003</td><td></td></tr><tr><td>PhiX control v3</td><td>Illumina</td><td># FC-110-3001</td><td></td></tr><tr><td>Sodium hydroxide&amp;nbsp;</td><td>Sigma</td><td># S5881</td><td></td></tr><tr><td>Thermal cycler C1000</td><td>Biorad</td><td># 1851148</td><td></td></tr><tr><td>CFX96 Real-Time PCR detection system</td><td>Biorad&amp;nbsp;</td><td>#1855195</td><td></td></tr><tr><td>Qubit Fluorometer</td><td>Thermo Fisher Scientific</td><td># Q33226</td><td></td></tr><tr><td>Bioanalyzer 2100</td><td>Agilent</td><td># G2939BA</td><td></td></tr><tr><td>MiSeq instrument</td><td>Illumina</td><td># SY-410-1003</td><td></td></tr></tbody></table>

methodology for accurate detection of mitochondrial dna methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Two steps in this protocol are crucial when investigating mtDNA methylation. 1) The opening of the secondary structure and 2) the design of mitochondrial DNA-specific primers.
By digesting the human genomic DNA with the restriction enzyme BamHI (Figure 1), the mitochondrial DNA structure will be cut at nucleotide position 14,258 and the secondary structure will be opened.
The possible impairment of bisulfite conversion with an intact mtDNA secondary structure is very likely to overestimate the mtDNA unconversion rate. By bisulfite sequencing, the mtDNA unconversion rate was investigated, in undigested and digested total DNA from human skeletal muscle cells, at 5 different regions of the mitochondrial genome: the displacement Loop (D-Loop), tRNA phenylalanine and 12S ribosome (tRNA-F+12S), 16S ribosome (16S), NADH dehydrogenase 5 (ND5) and cytochrome b (CYTB) mRNA-encoding gene (Figure 2). Unconversion rate&#160;ranged from 0 - 15.1% across all investigated regions for undigested mtDNA. However, when the DNA was digested prior to bisulfite conversion, the unconversion rate dropped to a maximum of 1% across all regions (Figure 3). Thus, illustrating the importance of BamHI digestion prior to bisulfite conversion to avoid overestimation of mtDNA methylation levels.
Contamination of nuclear DNA is inevitable when isolating the mitochondrial genome and since almost the entire mitochondrial genome has replicated into the nuclear genome, it has given rise to nuclear insertions of the mitochondrial genome termed NUclear MiTochondrial segments (NUMTs)36. To ensure that the analyzed DNA methylation levels correspond to mitochondrial DNA and not NUMTs, it is of outermost importance to design primers that are specific to the mitochondrial genome. Figure 4 shows how to check the primer specificity and Table 1 displays human and mouse mtDNA primer sequences.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="3">Sequence</td>
			<td>Position</td>
			<td>Amplicon size</td>
			<td>Annealing temperature</td>
			<td>Strand</td>
		</tr>
		<tr>
			<td>Human</td>
			<td colspan="3"></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>D-Loop</td>
			<td colspan="3">F: AAATCTATCACCCTATTAAC&#160;</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: GTGGAAATTTTTTGTTATGATGT&#160;</td>
			<td>6-298</td>
			<td>292</td>
			<td>55&#176;C</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>D-Loop</td>
			<td colspan="3">F: CATAACAAAAAATTTCCACCAAAC&#160;</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: GGGAAAATAATGTGTTAGTT&#160;</td>
			<td>279-458</td>
			<td>179</td>
			<td>55&#176;C</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>12S+TF</td>
			<td colspan="3">F: TTTATATAACTTACCTCCTC&#160;</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: GTGTTTGATGTTTGTTTTTTTTG</td>
			<td>577-765</td>
			<td>188</td>
			<td>55&#176;C</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>16S</td>
			<td colspan="3">F: AATAAATTTATAGGTTTTTAAATTATTAAAT&#160;</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: TAACTAATAAAATCTTAACATATACTACTC&#160;</td>
			<td>2763-2873</td>
			<td>110</td>
			<td>53&#176;C</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>CYTB</td>
			<td colspan="3">F: GGTATTATTTTTTTGTTTGTAATTATAGTA&#160;</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: CCTCAAATTCATTAAACTAAATCTATCC&#160;</td>
			<td>15091-15243</td>
			<td>152</td>
			<td>55&#176;C</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>Mouse</td>
			<td colspan="3"></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>12S</td>
			<td colspan="3">F: ACACATACAAACCTCCATAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: GAGGTATAATTTAGTTAAAT</td>
			<td>111-287</td>
			<td>176</td>
			<td>53&#176;C</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>16S</td>
			<td colspan="3">F: AAATTCCAATTCTCCAAACATAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: TTTGGATTTTTTTTTTAGGT</td>
			<td>1749-1896</td>
			<td>147</td>
			<td>53&#176;C</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>CYTB</td>
			<td colspan="3">F: CTACAAAAACACCTAATAACAAAC</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: AGTGTATGGTTAAGAAAAGA</td>
			<td>14129-14307</td>
			<td>178</td>
			<td>55&#176;C</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>16S</td>
			<td colspan="3">F: AGAGAAATAGAGTTATTTTATAAATAAG</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: CTAAAAACAAAATTTTAAATCTTAC</td>
			<td>2576-2727</td>
			<td>151</td>
			<td>55&#176;C</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>ND5</td>
			<td colspan="3">F: TTAAGTTAATTAGGTTTGATAATAGTGA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: TAAAACCCTATTAAAAATAATATTCCTATA</td>
			<td>12659-12910</td>
			<td>251</td>
			<td>55&#176;C</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>CYTB</td>
			<td colspan="3">F: TGGGTTTTTTTTAGGAGTTTGTTTA</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td colspan="3">R: CAATAAAAATACTCCAATATTTCAAATTTC</td>
			<td>14242-14504</td>
			<td>262</td>
			<td>55&#176;C</td>
			<td>Sense</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences for human and mouse mtDNA. Note that annealing temperatures of PCR primers vary due to differences in the melting temperature of primers.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57772/57772fig1.jpg" /> 
Figure 1: Gel electrophoresis of BamHI-digested, or undigested DNA. Genomic DNA from human skeletal muscle was untreated or treated with BamHI for 4h at 37&#176;C and gel electrophoresis was run on a 1.5% agarose gel. <a href="/files/ftp_upload/57772/57772fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57772/57772fig2.jpg" /> 
Figure 2: Map of the human mitochondrial genome. Regions of the mitochondrial genome investigated by bisulfite sequencing and the BamHI restriction enzyme site are displayed. The mitochondrial DNA contains 13 mRNAs, 2 ribosomal RNAs, and 22 transfer RNAs. Abbreviations: PH1: heavy-strand promoter 1; PH2: Heavy-strand promote 2; PL: Light-strand promoter; OH: Origin of replication from heavy-strand; OL: Origin of replication from light-strand. <a href="/files/ftp_upload/57772/57772fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57772/57772fig3v2.jpg" /> 
Figure 3: BamHI digestion prior to bisulfite conversion reduces the mtDNA unconversion rate&#160;in human skeletal muscle cells. By bisulfite sequencing, undigested and digested mitochondrial DNA unconversion percentage were interrogated at five different regions of the mitochondrial genome in human skeletal muscle cells (N=3). The full square represents CpG sites, and the open square represents non-CpG sites. Results are presented with a min-max interval and a sign test was used to test for significant unconversion differences. D-Loop (6-298) P= 1.83E-42; D-Loop (279-458): P= 4.55E-13; tRNA-F+12S: P= 8.38E-16; 16S: P= 5.91E-06; ND5: P=1.70E-05; CYTB: P= 2.69E-10. D-Loop (6-298) includes the origin of replication and tRNA-F+12S includes heavy strand promoter 2. These data have been published elsewhere 3. <a href="/files/ftp_upload/57772/57772fig3v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57772/57772fig4.jpg" /> 
Figure 4: The use of Bisearch to verify primer specificity towards the mitochondrial genome. A) Bisulfite-converted primer sequences are added to the BiSearch function Primer Search (http://bisearch.enzim.hu/?m=genompsearch). The bisulfite box is ticked, and a reference genome is selected. B) Example of potential PCR products generated on sense and antisense chains. <a href="/files/ftp_upload/57772/57772fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Methodology for Accurate Detection of Mitochondrial DNA Methylation at JoVE.com

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

methodology-for-accurate-detection-of-mitochondrial-dna-methylation

Nanyang Technological University

Research

JoVE Journal

Genetics

13.3K Views.  University of Copenhagen. Hier presenteren we een protocol zodat nauwkeurige kwantificering van mitochondriale methylation van DNA (mtDNA). In dit protocol beschrijven we een enzymatische spijsvertering van DNA met BamHI in combinatie met een bioinformatic analyse pijpleiding die kan worden gebruikt om te voorkomen dat overschatting van mtDNA methylering niveaus veroorzaakt door de secundaire structuur van mtDNA.

Video: Methodology for Accurate Detection of Mitochondrial DNA Methylation

Methylated DNA Immunoprecipitation

The identification of DNA methylation patterns is a common procedure in the study of epigenetics, as methylation is known to have significant effects on gene expression, and is involved with normal development as well as disease 1-4. Thus, the ability to discriminate between methylated DNA and non-methylated DNA is essential for generating methylation profiles for such studies. Methylated DNA immunoprecipitation (MeDIP) is an efficient technique for the extraction of methylated DNA from a sample of interest 5-7. A sample of as little as 200 ng of DNA is sufficient for the antibody, or immunoprecipitation (IP), reaction. DNA is sonicated into fragments ranging in size from 300-1000 bp, and is divided into immunoprecipitated (IP) and input (IN) portions. IP DNA is subsequently heat denatured and then incubated with anti-5'mC, allowing the monoclonal antibody to bind methylated DNA. After this, magnetic beads containing a secondary antibody with affinity for the primary antibody are added, and incubated. These bead-linked antibodies will bind the monoclonal antibody used in the first step. DNA bound to the antibody complex (methylated DNA) is separated from the rest of the DNA by using a magnet to pull the complexes out of solution. Several washes using IP buffer are then performed to remove the unbound, non-methylated DNA. The methylated DNA/antibody complexes are then digested with Proteinase K to digest the antibodies leaving only the methylated DNA intact. The enriched DNA is purified by phenol:chloroform extraction to remove the protein matter and then precipitated and resuspended in water for later use. PCR techniques can be used to validate the efficiency of the MeDIP procedure by analyzing the amplification products of IP and IN DNA for regions known to lack and known to contain methylated sequences. The purified methylated DNA can then be used for locus-specific (PCR) or genome-wide (microarray and sequencing) methylation studies, and is particularly useful when applied in conjunction with other research tools such as gene expression profiling and array comparative genome hybridization (CGH) 8. Further investigation into DNA methylation will lead to the discovery of new epigenetic targets, which in turn, may be useful in developing new therapeutic or prognostic research tools for diseases such as cancer that are characterized by aberrantly methylated DNA 2, 4, 9-11.

This video demonstrates the protocol for methylated DNA immunoprecipitation (MeDIP). MeDIP is a two day procedure that selectively extracts methylated DNA fragments from a genomic DNA sample using antibodies with specificity for 5 -methylcytosine (anti-5 mC).

The identification of DNA methylation patterns is a common procedure in the study of epigenetics, as methylation is known to have significant effects on ...

Biology

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to the display of physiological and behavioural phenotypes. Such environmental programming is likely to increase the susceptibility to metabolic, cardiovascular and mental diseases 3,4.
DNA methylation and histone modifications are considered key processes in the mediation of the gene-environment dialogue and appear also to underlay environmental programming 5. In mammals, DNA methylation typically comprises the covalent addition of a methyl group at the 5-position of cytosine within the context of CpG dinucleotides.
CpG methylation occurs in a highly tissue- and cell-specific manner making it a challenge to study discrete, small regions of the brain where cellular heterogeneity is high and tissue quantity limited. Moreover, because gene expression and methylation are closely linked events, increased value can be gained by comparing both parameters in the same sample.
Here, a step-by-step protocol (Figure 1) for the investigation of epigenetic programming in the brain is presented using the 'maternal separation' paradigm of early life adversity for illustrative purposes. The protocol describes the preparation of micropunches from differentially-aged mouse brains from which DNA and RNA can be simultaneously isolated, thus allowing DNA methylation and gene expression analyses in the same sample.

A streamlined workflow to study DNA methylation and gene expression changes upon early-life stress is shown. Starting from maternal separation of newborn mice and isolation of discrete brain tissues, we represent a protocol to simultaneously isolate DNA and RNA from brain tissue punches for subsequent bisulfite sequencing and RT-PCR analysis.

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

Neuroscience

Continuous Fluorescence-Based Endonuclease-Coupled DNA Methylation Assay to Screen for DNA Methyltransferase Inhibitors

DNA methylation, a form of epigenetic gene regulation, is important for normal cellular function. In cells, proteins called DNA methyltransferases (DNMTs) establish and maintain the DNA methylation pattern. Changes to the normal DNA methylation pattern are linked to cancer development and progression, making DNMTs potential cancer drug targets. Thus, identifying and characterizing novel small molecule inhibitors of these enzymes is of great importance. This paper presents a protocol that can be used to screen for DNA methyltransferase inhibitors. The continuous coupled kinetics assay allows for initial velocities of DNA methylation to be determined in the presence and absence of potential small molecule inhibitors. The assay uses the methyl-sensitive endonuclease Gla I to couple methylation of a hemimethylated DNA substrate to fluorescence generation.
This continuous assay allows for enzyme activity to be monitored in real time. Conducting the assay in small volumes in microtiter plates reduces the cost of reagents. Using this assay, a small example screen was conducted for inhibitors of DNMT1, the most abundant DNMT isozyme in humans. The highly substituted anthraquinone natural product, laccaic acid A, is a potent, DNA-competitive inhibitor of DNMT1. Here, we examine three potential small molecule inhibitors &#8212; anthraquinones or anthraquinone-like molecules with one to three substituents &#8212; at two concentrations to describe the assay protocol. Initial velocities are used to calculate the percent activity observed in the presence of each molecule. One of three compounds examined exhibits concentration-dependent inhibition of DNMT1 activity, indicating that it is a potential inhibitor of DNMT1.

DNA methyltransferases are potential cancer drug targets. Here, a protocol is presented to assess small molecules for DNA methyltransferase inhibition. This assay utilizes an endonuclease to couple DNA methylation to fluorescence generation and allows for enzyme activity to be monitored in real time.&#160;

DNA methylation, a form of epigenetic gene regulation, is important for normal cellular function. In cells, proteins called DNA methyltransferases (DNMTs) ...

Biochemistry

High-Throughput Quantification of the Synthesis and Distribution of mtDNA

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

Author Spotlight: High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution  

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

DNA Methylation: Bisulphite Modification and Analysis

Epigenetics describes the heritable changes in gene function that occur independently to the DNA sequence. The molecular basis of epigenetic gene regulation is complex, but essentially involves modifications to the DNA itself or the proteins with which DNA associates. The predominant epigenetic modification of DNA in mammalian genomes is methylation of cytosine nucleotides (5-MeC). DNA methylation provides instruction to gene expression machinery as to where and when the gene should be expressed. The primary target sequence for DNA methylation in mammals is 5'-CpG-3' dinucleotides (Figure 1). CpG dinucleotides are not uniformly distributed throughout the genome, but are concentrated in regions of repetitive genomic sequences and CpG "islands" commonly associated with gene promoters (Figure 1). DNA methylation patterns are established early in development, modulated during tissue specific differentiation and disrupted in many disease states including cancer. To understand the biological role of DNA methylation and its role in human disease, precise, efficient and reproducible methods are required to detect and quantify individual 5-MeCs.
This protocol for bisulphite conversion is the "gold standard" for DNA methylation analysis and facilitates identification and quantification of DNA methylation at single nucleotide resolution. The chemistry of cytosine deamination by sodium bisulphite involves three steps (Figure 2). (1) Sulphonation: The addition of bisulphite to the 5-6 double bond of cytosine (2) Hydrolic Deamination: hydrolytic deamination of the resulting cytosine-bisulphite derivative to give a uracil-bisulphite derivative (3) Alkali Desulphonation: Removal of the sulphonate group by an alkali treatment, to give uracil. Bisulphite preferentially deaminates cytosine to uracil in single stranded DNA, whereas 5-MeC, is refractory to bisulphite-mediated deamination. Upon PCR amplification, uracil is amplified as thymine while 5-MeC residues remain as cytosines, allowing methylated CpGs to be distinguished from unmethylated CpGs by presence of a cytosine "C" versus thymine "T" residue during sequencing.
DNA modification by bisulphite conversion is a well-established protocol that can be exploited for many methods of DNA methylation analysis. Since the detection of 5-MeC by bisulphite conversion was first demonstrated by Frommer et al.1 and Clark et al.2, methods based around bisulphite conversion of genomic DNA account for the majority of new data on DNA methylation. Different methods of post PCR analysis may be utilized, depending on the degree of specificity and resolution of methylation required. Cloning and sequencing is still the most readily available method that can give single nucleotide resolution for methylation across the DNA molecule.

The gold standard for DNA methylation analysis is genomic sequencing of bisulphite converted DNA. This method takes advantage of the increased sensitivity of cytosine compared with 5-methylcytosine (5-MeC) to bisulphite deamination under acidic conditions. Unmethylated cytosines can be distinguished from methylated cytosines after PCR amplification of the target genomic DNA.

Epigenetics describes the heritable changes in gene function that occur independently to the DNA sequence. The molecular basis of epigenetic gene ...

Enhanced Reduced Representation Bisulfite Sequencing for Assessment of DNA Methylation at Base Pair Resolution

DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine methylation patterns in cells. Reduced representation of whole genome bisulfite sequencing was developed to detect quantitative base pair resolution cytosine methylation patterns at GC-rich genomic loci. This is accomplished by combining the use of a restriction enzyme followed by bisulfite conversion. Enhanced Reduced Representation Bisulfite Sequencing (ERRBS) increases the biologically relevant genomic loci covered and has been used to profile cytosine methylation in DNA from human, mouse and other organisms. ERRBS initiates with restriction enzyme digestion of DNA to generate low molecular weight fragments for use in library preparation. These fragments are subjected to standard library construction for next generation sequencing. Bisulfite conversion of unmethylated cytosines prior to the final amplification step allows for quantitative base resolution of cytosine methylation levels in covered genomic loci. The protocol can be completed within four days. Despite low complexity in the first three bases sequenced, ERRBS libraries yield high quality data when using a designated sequencing control lane. Mapping and bioinformatics analysis is then performed and yields data that can be easily integrated with a variety of genome-wide platforms. ERRBS can utilize small input material quantities making it feasible to process human clinical samples and applicable in a range of research applications. The video produced demonstrates critical steps of the ERRBS protocol.

Enhanced Reduced Representation Bisulfite Sequencing is a method for the preparation of sequencing libraries for DNA methylation analysis based on restriction enzyme digestion combined with cytosine bisulfite conversion. This protocol requires 50 ng of starting material and yields base pair resolution data at GC-rich genomic regions.

DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Genotyping Single Nucleotide Polymorphisms in the Mitochondrial Genome by Pyrosequencing

Mutations in the mitochondrial genome (mtDNA) have been associated with maternally inherited genetic diseases. However, interest in mtDNA polymorphisms has increased in recent years due to the recently developed ability to produce models by mtDNA mutagenesis and a new appreciation of the association between mitochondrial genetic aberrations and common age-related diseases such as cancer, diabetes, and dementia. Pyrosequencing is a sequencing-by-synthesis technique that is widely employed across the mitochondrial field for routine genotyping experiments. Its relative affordability when compared to massive parallel sequencing methods and ease of implementation make it an invaluable technique in the field of mitochondrial genetics, allowing for the rapid quantification of heteroplasmy with increased flexibility. Despite the practicality of this method, its implementation as a means of mtDNA genotyping requires the observation of certain guidelines, specifically to avoid certain biases of biological or technical origin. This protocol outlines the necessary steps and precautions in designing and implementing pyrosequencing assays for use in the context of heteroplasmy measurement.

Pyrosequencing assays enable the robust and rapid genotyping of mitochondrial DNA single nucleotide polymorphisms in heteroplasmic cells or tissues.

Mutations in the mitochondrial genome (mtDNA) have been associated with maternally inherited genetic diseases. However, interest in mtDNA polymorphisms ...

Medicine

DNA Methylation Analysis

Methylation at CpG dinucleotides is a chemical modification of DNA hypothesized to play important roles in regulating gene expression. In particular, the methylation of clusters of methylation sites, called &#8220;CpG islands&#8221;, near promoters and other gene regulatory elements may contribute to the stable silencing of genes, for example, during epigenetic processes such as genomic imprinting and X-chromosome inactivation. At the same time, aberrant CpG methylation has been shown to be associated with cancer.In this video, the biological functions and mechanisms of DNA methylation will be presented, along with various techniques used to identify methylation sites in the genome. We will then examine the steps of bisulfite analysis, one of the most commonly used methods for detecting DNA methylation, as well as several applications of this technique.

Methylation at CpG dinucleotides is a chemical modification of DNA hypothesized to play important roles in regulating gene expression. In particular, the ...

Education

JoVE Science Education

Advanced Biology

5-Methylcytosine Dot Blot to Determine the Extent of DNA Methylation

Source: Jia, Z. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/55565">A 5-mC Dot Blot Assay Quantifying the DNA Methylation Level of Chondrocyte Dedifferentiation In Vitro.</a>&#160;J. Vis. Exp.&#160;(2017)
This video describes the technique of dot-blot to determine the level of DNA methylation in human chondrocytes in vitro via the blotting of DNA samples on a nylon membrane and the subsequent visualization using monoclonal antibodies. This helps to determine the chondrocytes&#39; phenotype at various stages in culture.

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video