Funding of this work is provided in part by a grant from NSF Plant Genome Research (IOS-1127155).

NOTE: Figure 1 shows the five steps for the array CGH protocol. They are: 1) Preparation of plant materials; 2) Isolation of high quality DNA samples; 3) Labeling and purification of DNA samples; 4) Hybridization, washing, and scanning of whole genome arrays; and 5) CGH data analysis. M. truncatula whole genome tiling arrays contain a total of 971,041 unique oligo probes targeting more than 50,000 genes or gene models in the genome (See Table of Materials). The unique probes are spaced approximately every 150 base pairs (bp) in exonic regions and 261 bp in intronic regions of the M. truncatula genome.
1. Preparation of Plant Materials
<ol>
	<li>Scarify wild type (WT; M. truncatula cv Jemalong A17) and FN6191 mutant seeds with concentrated sulfuric acid for 8 min (see Table of Materials). Remove and discard sulfuric acid to a liquid waste container.</li>
	<li>Rinse seeds with autoclaved deionized water three times.</li>
	<li>Surface sterilize seeds with 20% bleach solution for 10 min.</li>
	<li>Rinse seeds with autoclaved deionized water three times.</li>
	<li>Store seeds at 4 &#176;C for 3 days. After vernalization, transfer and germinate seeds in soil for one week in a growth chamber with 16 h/8 h light/dark cycle and 150 &#181;E/m2/s light intensity.</li>
	<li>Transplant seedlings to 1 gallon pots and grow them in a greenhouse with 16 h/8 h light/dark cycle, 150 &#181;E/m2/s light intensity for three to four weeks. Collect young leaf samples from the plants for DNA isolation.</li>
</ol>
2. Isolation of High Quality DNA Samples
<ol>
	<li>Take 1 g of young leaf tissue from a single plant and freeze it in liquid nitrogen immediately.</li>
	<li>Grind frozen leaf tissue in liquid nitrogen with a mortar and pestle to fine powder.</li>
	<li>Isolate genomic DNA with a DNA isolation kit (see Table of Materials).</li>
	<li>Resuspend purified DNA samples in 50 &#181;L of autoclaved double deionized H2O (ddH2O) or 1x TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.0).</li>
	<li>Measure DNA concentrations with a spectrophotometer (see Table of Materials).</li>
	<li>Evaluate 260 nm/280 nm and 260 nm/230 nm ratios of DNA samples. 
	NOTE: High quality DNA samples should have a 260 nm/280 nm ratio &#8805;1.8 and a 260 nm/230 nm ratio &#8805;2.0.</li>
	<li>Further evaluate DNA samples by running them in 1% agarose gels. 
	NOTE: High quality DNA samples should have high molecular weight and should not be contaminated by RNA. Ideally, the final concentration of DNA samples should be ~150 ng/&#181;L.</li>
</ol>
3. DNA Labeling and Purification
<ol>
	<li>Dilute 1 &#181;g of genomic DNA samples with ddH2O to a final volume of 20 &#181;L in a 500 &#181;L centrifuge tube.</li>
	<li>Add 5 &#181;L of a random primer (see Table of Materials) to the tube.</li>
	<li>Vortex the tube briefly and put it into a thermocycler to incubate and denature DNA at 98 &#176;C for 10 min.</li>
	<li>Take the tube out of the thermocycler and put it immediately on ice water to chill for 5 min.</li>
	<li>Prepare two labeling mixes as shown in Table 1.</li>
	<li>Add 25 &#181;L of labeling mixes 1 and 2 to reference DNA and sample DNA tubes, respectively.</li>
	<li>Mix the labeling mix and DNA by pipetting three times and spin the tubes briefly.</li>
	<li>Put the tubes into a thermocycler to incubate at 37 &#176;C for 2 h and then at 65 &#176;C for 20 min to inactivate the exo-Klenow enzyme (see Table of Materials).</li>
	<li>Add 430 &#181;L of 1x&#160;TE buffer to each tube.</li>
	<li>Mix the contents and spin the tubes briefly.</li>
	<li>Transfer the solution in the tube into a purification column with a 2 mL collection tube (see Table of Materials).</li>
	<li>Centrifuge the purification column at 14,000 x g for 10 min.</li>
	<li>Discard the pass through solution.</li>
	<li>Add 480 &#181;L 1x&#160;TE buffer to each column.</li>
	<li>Centrifuge the column again at 14,000 x g for 10 min.</li>
	<li>Discard the pass-through solution.</li>
	<li>Transfer the labeled DNA sample that remains at the bottom portion of the column to a new centrifuge tube.</li>
	<li>Measure the volume of the labeled DNA sample using a pipette and bring the final volume to 80 &#181;L with 1x TE buffer.</li>
	<li>Measure the concentration of the labeled DNA sample using a spectrophotometer (see Table of Materials).</li>
	<li>Mix an equal amount of labeled sample DNA and reference DNA and bring the final volume to 160 &#181;L with&#160;1x TE buffer.</li>
	<li>Add 256 &#181;L of 2x hybridization buffer, 50 &#181;L of human Cot-1 DNA and 50 &#181;L of 10&#215; aCGH blocking agent (see Table of Materials) and mix them well by pipetting for three times.</li>
	<li>Spin the tubes briefly and put them into a thermocycler to incubate at 98 &#176;C for 10 min.</li>
	<li>Incubate the tubes at 37 &#176;C for 20 min.</li>
</ol>
4. Hybridization, Washing, and Scanning of the Genome Arrays
<ol>
	<li>Pre-warm the hybridization oven to 67 &#176;C at least 4 h before hybridization starts.</li>
	<li>Place a gasket slide onto the base of a hybridization chamber.</li>
	<li>Load 490 &#181;L of hybridization solution from Step 3.23 onto the gasket slide.</li>
	<li>Cover the gasket slide with a Medicago truncatula genome microarray chip to form a hybridization chamber.</li>
	<li>Put on the hybridization chamber covers and tighten the chamber firmly with clamps.</li>
	<li>Put the assembled hybridization chamber into the hybridization oven and incubate at 67 &#176;C for 40 - 48 h.</li>
	<li>Prepare three slide washing dishes: two with 250 mL washing buffer I kept at room temperature, and one with washing buffer II kept at 37 &#176;C.</li>
	<li>Prepare two slide washing jars: one with 70 mL acetonitrile and one with 70 mL stabilization and drying solution; keep both in a fume hood at room temperature (see Table of Materials).</li>
	<li>Remove the hybridization chamber from the oven and remove the chamber clamps and cover.</li>
	<li>Move the microarray chip and gasket slide to a slide washing dish with wash buffer I and separate the chip from the cover slide.</li>
	<li>Move the microarray chip to the second slide washing dish with wash buffer I and gently circulate the solution with a stir bar on a magnetic stir plate at room temperature for 5 min.</li>
	<li>Transfer the microarray chip to the third slide washing dish with pre-warmed washing buffer II and wash it gently with a stir bar on a magnetic stir plate at 37 &#176;C for 1 min.</li>
	<li>Transfer the microarray chip to a slide washing jar with acetonitrile in a fume hood and wash it for 30 s.</li>
	<li>Transfer the microarray chip to a slide washing jar with stabilization and drying solution and wash it for 30 s.</li>
	<li>Take out the chip slowly and dry it for 1 min.</li>
	<li>Scan the microarray chip using a scanner (see Table of Materials) under 2 &#181;m resolution. Set parameters to save multiple images and whole slide scans. Set channels 1 and 2 gains to 100% and cancel the auto gain.</li>
</ol>
5. CGH Data Analysis
<ol>
	<li>Extract the Cy3 and Cy5 fluorescence intensities for each probe on the array using scanning software (see Table of Materials).</li>
	<li>Use segmentation analysis of the software to detect copy number variations (CNVs) between the sample DNA and reference DNA. Use a threshold of the segment mean log2 sample/reference ratio &#177; 2.5 standard deviations for determining CNVs.</li>
	<li>Inspect the distribution of log2 sample/reference ratios across the whole genome using a signal mapping software (see Table of Materials).</li>
</ol>

<ol><li>Tang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+improved+genome+release+%28version+Mt4.0%29+for+the+model+legume+Medicago+truncatula%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">An improved genome release (version Mt4.0) for the model legume Medicago truncatula.</a> BMC Genomics. 15, 312(2014).</li>
<li>Young, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Medicago+genome+provides+insight+into+the+evolution+of+rhizobial+symbioses%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The Medicago genome provides insight into the evolution of rhizobial symbioses.</a> Nature. 480 (7378), 520-524 (2011).</li>
<li>Wang, H., Li, G., Chen, R. Fast neutron bombardment (FNB) induced deletion mutagenesis for forward and reverse genetic studies in plants. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aWang%2C+H+%22Floriculture%2C+Ornamental+and+Plant+Biotechnology%3A+Advances+and+Topical+Issues%22">Floriculture, Ornamental and Plant Biotechnology: Advances and Topical Issues</a>. da Silva, J. T. , 1st ed, Global Science Books. Isleworth, UK. 629-639 (2006).</li>
<li>Rogers, C., Wen, J., Chen, R., Oldroyd, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deletion-based+reverse+genetics+in+Medicago+truncatula%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">Deletion-based reverse genetics in Medicago truncatula.</a> Plant Physiol. 151 (3), 1077-1086 (2009).</li>
<li>Alonso, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Five+components+of+the+ethylene-response+pathway+identified+in+a+screen+for+weak+ethylene-insensitive+mutants+in+Arabidopsis%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis.</a> Proc Natl Acad Sci U S A. 100 (5), 2992-2997 (2003).</li>
<li>Silverstone, A. L., Ciampaglio, C. N., Sun, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Arabidopsis+RGA+gene+encodes+a+transcriptional+regulator+repressing+the+gibberellin+signal+transduction+pathway%5BTitle%5D)+AND+%22Plant+Cell%22%5BJournal%5D)">The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway.</a> Plant Cell. 10 (2), 155-169 (1998).</li>
<li>Li, X., Lassner, M., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deleteagene%3A+a+fast+neutron+deletion+mutagenesis-based+gene+knockout+system+for+plants%5BTitle%5D)+AND+%22Comp+Funct+Genomics%22%5BJournal%5D)">Deleteagene: a fast neutron deletion mutagenesis-based gene knockout system for plants.</a> Comp Funct Genomics. 3 (2), 158-160 (2002).</li>
<li>Bolon, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Phenotypic+and+genomic+analyses+of+a+fast+neutron+mutant+population+resource+in+soybean%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">Phenotypic and genomic analyses of a fast neutron mutant population resource in soybean.</a> Plant Physiol. 156 (1), 240-253 (2011).</li>
<li>Men, A. E., et al. <a target="_blank" href="https://www.researchgate.net/publication/43443373_Fast_Neutron_Mutagenesis_of_Soybean_Glycine_soja_L_Produces_a_Supernodulating_Mutant_Containing_a_Large_Deletion_in_Linkage_Group_H">Fast Neutron Mutagenesis of Soybean (Glycine soja L.) Produces a Supernodulating Mutant Containing a Large Deletion in Linkage Group H.</a> Genome Letters. 1 (3), 147-155 (2002).</li>
<li>Hoffmann, D., Jiang, Q., Men, A., Kinkema, M., Gresshoff, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nodulation+deficiency+caused+by+fast+neutron+mutagenesis+of+the+model+legume+Lotus+japonicus%5BTitle%5D)+AND+%22J+Plant+Physiol%22%5BJournal%5D)">Nodulation deficiency caused by fast neutron mutagenesis of the model legume Lotus japonicus.</a> J Plant Physiol. 164 (4), 460-469 (2007).</li>
<li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+fast+neutron+deletion+mutagenesis-based+reverse+genetics+system+for+plants%5BTitle%5D)+AND+%22Plant+J%22%5BJournal%5D)">A fast neutron deletion mutagenesis-based reverse genetics system for plants.</a> Plant J. 27 (3), 235-242 (2001).</li>
<li>Bourcy, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Medicago+truncatula+DNF2+is+a+PI-PLC-XD-containing+protein+required+for+bacteroid+persistence+and+prevention+of+nodule+early+senescence+and+defense-like+reactions%5BTitle%5D)+AND+%22New+phytol%22%5BJournal%5D)">Medicago truncatula DNF2 is a PI-PLC-XD-containing protein required for bacteroid persistence and prevention of nodule early senescence and defense-like reactions.</a> New phytol. 197 (4), 1250-1261 (2013).</li>
<li>Chen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Control+of+dissected+leaf+morphology+by+a+Cys%282%29His%282%29+zinc+finger+transcription+factor+in+the+model+legume+Medicago+truncatula%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Control of dissected leaf morphology by a Cys(2)His(2) zinc finger transcription factor in the model legume Medicago truncatula.</a> Proc Natl Acad Sci U S A. 107 (23), 10754-10759 (2010).</li>
<li>Ge, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Increasing+seed+size+and+quality+by+manipulating+BIG+SEEDS1+in+legume+species%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Increasing seed size and quality by manipulating BIG SEEDS1 in legume species.</a> Proc Natl Acad Sci U S A. 113 (44), 12414-12419 (2016).</li>
<li>Kalo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nodulation+signaling+in+legumes+requires+NSP2%2C+a+member+of+the+GRAS+family+of+transcriptional+regulators%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators.</a> Science. 308 (5729), 1786-1789 (2005).</li>
<li>Oldroyd, G. E., Long, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+characterization+of+nodulation-signaling+pathway+2%2C+a+gene+of+Medicago+truncatula+involved+in+Nod+actor+signaling%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">Identification and characterization of nodulation-signaling pathway 2, a gene of Medicago truncatula involved in Nod actor signaling.</a> Plant Physiol. 131 (3), 1027-1032 (2003).</li>
<li>Peng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regulation+of+compound+leaf+development+in+Medicago+truncatula+by+fused+compound+leaf1%2C+a+class+M+KNOX+gene%5BTitle%5D)+AND+%22Plant+Cell%22%5BJournal%5D)">Regulation of compound leaf development in Medicago truncatula by fused compound leaf1, a class M KNOX gene.</a> Plant Cell. 23 (11), 3929-3943 (2011).</li>
<li>Tsujimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Arabidopsis+TOBAMOVIRUS+MULTIPLICATION+%28TOM%29+2+locus+encodes+a+transmembrane+protein+that+interacts+with+TOM1%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Arabidopsis TOBAMOVIRUS MULTIPLICATION (TOM) 2 locus encodes a transmembrane protein that interacts with TOM1.</a> EMBO J. 22 (2), 335-343 (2003).</li>
<li>Wang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+nodule-specific+protein+secretory+pathway+required+for+nitrogen-fixing+symbiosis%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A nodule-specific protein secretory pathway required for nitrogen-fixing symbiosis.</a> Science. 327 (5969), 1126-1129 (2010).</li>
<li>Bejjani, B. A., Shaffer, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Application+of+array-based+comparative+genomic+hybridization+to+clinical+diagnostics%5BTitle%5D)+AND+%22J+Mol+Diagn%22%5BJournal%5D)">Application of array-based comparative genomic hybridization to clinical diagnostics.</a> J Mol Diagn. 8 (5), 528-533 (2006).</li>
<li>Emerson, J. J., Cardoso-Moreira, M., Borevitz, J. O., Long, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Natural+selection+shapes+genome-wide+patterns+of+copy-number+polymorphism+in+Drosophila+melanogaster%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Natural selection shapes genome-wide patterns of copy-number polymorphism in Drosophila melanogaster.</a> Science. 320 (5883), 1629-1631 (2008).</li>
<li>Gong, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microarray-based+rapid+cloning+of+an+ion+accumulation+deletion+mutant+in+Arabidopsis+thaliana%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Microarray-based rapid cloning of an ion accumulation deletion mutant in Arabidopsis thaliana.</a> Proc Natl Acad Sci U S A. 101 (43), 15404-15409 (2004).</li>
<li>Guryev, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distribution+and+functional+impact+of+DNA+copy+number+variation+in+the+rat%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">Distribution and functional impact of DNA copy number variation in the rat.</a> Nat Genet. 40 (5), 538-545 (2008).</li>
<li>Haun, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+composition+and+origins+of+genomic+variation+among+individuals+of+the+soybean+reference+cultivar+Williams+82%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">The composition and origins of genomic variation among individuals of the soybean reference cultivar Williams 82.</a> Plant Physiol. 155 (2), 645-655 (2011).</li>
<li>Infante, J. J., Dombek, K. M., Rebordinos, L., Cantoral, J. M., Young, E. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+amplifications+caused+by+chromosomal+rearrangements+play+a+major+role+in+the+adaptive+evolution+of+natural+yeast%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Genome-wide amplifications caused by chromosomal rearrangements play a major role in the adaptive evolution of natural yeast.</a> Genetics. 165 (4), 1745-1759 (2003).</li>
<li>Jones, M. R., Maydan, J. S., Flibotte, S., Moerman, D. G., Baillie, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oligonucleotide+Array+Comparative+Genomic+Hybridization+%28oaCGH%29+based+characterization+of+genetic+deficiencies+as+an+aid+to+gene+mapping+in+Caenorhabditis+elegans%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">Oligonucleotide Array Comparative Genomic Hybridization (oaCGH) based characterization of genetic deficiencies as an aid to gene mapping in Caenorhabditis elegans.</a> BMC Genomics. 8, 402(2007).</li>
<li>Lakshmi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mouse+genomic+representational+oligonucleotide+microarray+analysis%3A+detection+of+copy+number+variations+in+normal+and+tumor+specimens%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Mouse genomic representational oligonucleotide microarray analysis: detection of copy number variations in normal and tumor specimens.</a> Proc Natl Acad Sci U S A. 103 (30), 11234-11239 (2006).</li>
<li>Mitra, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Ca2%2B%2Fcalmodulin-dependent+protein+kinase+required+for+symbiotic+nodule+development%3A+Gene+identification+by+transcript-based+cloning%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning.</a> Proc Natl Acad Sci U S A. 101 (13), 4701-4705 (2004).</li>
<li>Rios, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+hemizygous+deletions+in+citrus+using+array-comparative+genomic+hybridization+and+microsynteny+comparisons+with+the+poplar+genome%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">Characterization of hemizygous deletions in citrus using array-comparative genomic hybridization and microsynteny comparisons with the poplar genome.</a> BMC Genomics. 9, 381(2008).</li>
<li>Skvortsov, D., Abdueva, D., Stitzer, M. E., Finkel, S. E., Tavare, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Using+expression+arrays+for+copy+number+detection%3A+an+example+from+E.+coli%5BTitle%5D)+AND+%22BMC+Bioinformatics%22%5BJournal%5D)">Using expression arrays for copy number detection: an example from E. coli.</a> BMC Bioinformatics. 8, 203(2007).</li>
<li>Werner, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+trait+locus+mapping+and+DNA+array+hybridization+identify+an+FLM+deletion+as+a+cause+for+natural+flowering-time+variation%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Quantitative trait locus mapping and DNA array hybridization identify an FLM deletion as a cause for natural flowering-time variation.</a> Proc Natl Acad Sci U S A. 102 (7), 2460-2465 (2005).</li>
<li>Xi, J., Chen, Y., Nakashima, J., Wang, S. M., Chen, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Medicago+truncatula+esn1+defines+a+genetic+locus+involved+in+nodule+senescence+and+symbiotic+nitrogen+fixation%5BTitle%5D)+AND+%22Mol+Plant+Microbe+Interact%22%5BJournal%5D)">Medicago truncatula esn1 defines a genetic locus involved in nodule senescence and symbiotic nitrogen fixation.</a> Mol Plant Microbe Interact. 26 (8), 893-902 (2013).</li>
<li>Schnabel, E., Journet, E. P., de Carvalho-Niebel, F., Duc, G., Frugoli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Medicago+truncatula+SUNN+gene+encodes+a+CLV1-like+leucine-rich+repeat+receptor+kinase+that+regulates+nodule+number+and+root+length%5BTitle%5D)+AND+%22Plant+Mol+Biol%22%5BJournal%5D)">The Medicago truncatula SUNN gene encodes a CLV1-like leucine-rich repeat receptor kinase that regulates nodule number and root length.</a> Plant Mol Biol. 58 (6), 809-822 (2005).</li>
<li>Horvath, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Loss+of+the+nodule-specific+cysteine+rich+peptide%2C+NCR169%2C+abolishes+symbiotic+nitrogen+fixation+in+the+Medicago+truncatula+dnf7+mutant%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Loss of the nodule-specific cysteine rich peptide, NCR169, abolishes symbiotic nitrogen fixation in the Medicago truncatula dnf7 mutant.</a> Proc Natl Acad Sci U S A. 112 (49), 15232-15237 (2015).</li>
<li>Kim, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+antimicrobial+peptide+essential+for+bacterial+survival+in+the+nitrogen-fixing+symbiosis%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">An antimicrobial peptide essential for bacterial survival in the nitrogen-fixing symbiosis.</a> Proc Natl Acad Sci U S A. 112 (49), 15238-15243 (2015).</li>
<li>Noble Research Institute. Medicago truncatula Mutant Database. , Available from:
 <a target="_blank" href="https://medicago-mutant.noble.org/mutant/FNB.php">https://medicago-mutant.noble.org/mutant/FNB.php</a> (2017).</li>
<li>Burton, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SNP+genotyping+with+the+next+generation+of+CGH+microarray%5BTitle%5D)+AND+%22MLO+Med+Lab+Obs%22%5BJournal%5D)">SNP genotyping with the next generation of CGH microarray.</a> MLO Med Lab Obs. 45 (7), (2013).</li>
</ol>

The authors declare no competing financial interests.

We have developed an array-based CGH platform for the detection and characterization of fast neutron bombardment (FNB)-induced mutants in M. truncatula cv. Jemalong A17. To demonstrate the use of the array CGH method in detecting gene mutations, we performed aCGH analysis of the mutant FN6191, which exhibited a hyper-nodulation phenotype in contrast to wild type plants, when inoculated with S. meliloti Sm1021. For segmentation analysis, a segment was deemed significant if the log2 ratio mean of the probes within the segment was above the upper threshold or below the lower threshold for that given array comparison. The upper threshold for each comparison was determined to be the log2 ratio value of the 95th percentile of all data points. The lower threshold for each comparison was determined to be the log2 ratio value of the 5th percentile of all data points24.
Our analysis showed that significant copy number changes can be determined by retrieving segments with an average normalized log2 ratio greater than the average by 2.5 SD (duplication) or less than the average by 2.5 SD (deletion). Based on CGH analysis, we detected a deletion region with an estimated size of 22 kb on chromosome 4, encompassing the SUNN gene33. Sequencing results confirmed that the deletion size was 26.67 kb based on M. truncatula genome release v3.5. It has been shown that SUNN encodes a CLV1-like leucine-rich repeat receptor kinase that controls the nodule number in M. truncatula33. Our CGH results suggest that FN6191 is a new SUNN allele. Based on these results, we reasoned that the CGH method coupled with phenotypic and genetic analysis can be successfully used to rapidly identify candidate genes in FNB deletion mutants. Over the past several years, we have used this platform in identifying and characterizing numerous FNB mutants for gene functional studies in M. truncatula34,35. We have generated a database of copy number variations (CNVs) associated with FNB mutant lines36. In this database, deleted sequences from CGH analyses of over 100 confirmed symbiotic nodulation mutants have been mapped to the M. truncatula genome. A blast server has been set up to facilitate the search for deleted sequences in the mutant collection. The development and further expansion of the deletion database would be highly valuable for functional genomics research using M. truncatula FNB mutant resources.
The aCGH protocol has five major steps. Although all steps are important and should be carried out carefully as described earlier, the followings are especially critical: (1) DNA samples should not be degraded and should not be contaminated by RNA during the preparation step; (2) Test and reference DNA samples should be equally well prepared so that the labeled samples are of the same high quality; (3) Labeled DNA samples should not be exposed to a high intensity of light and a high level of ozone; and (4) it is important to keep Washing Buffer II at 37 &#176;C during the washing step.
The coverage of the current M. truncatula genome array is primarily on the exonic regions and less on the intronic regions, and not at all in intergenic regions. The coverage in the latter regions can be improved if lesions in these regions are important for mutant phenotypes. On the other hand, the current probe design has less power in identifying small mutations and single nucleotide polymorphisms (SNPs). This limitation can be overcome by using CGH+SNP microarray design37. Overall, the genome array-based comparative genomic hybridization (aCGH) platform is a powerful tool for the analysis of copy number and structural variations in M. truncatula FNB mutants.

Legumes (Fabaceae) are the third largest family of flowering plants, with many economically important species such as soybean (Glycine max) and alfalfa (Medicago sativa). Legume plants can interact with nitrogen-fixing soil bacteria, generally called Rhizobia to develop root nodules in which the atmospheric dinitrogen is reduced to ammonia for use by the host plant. As such, cultivation of legume crops requires little input of nitrogen fertilizers and thus contributes to sustainable agriculture. Legume crops produce leaves and seeds with high protein content, serving as excellent forage and grain crops. However, cultivated legume species generally have complex genome structures, making functional studies of genes that play key roles in legume-specific processes cumbersome. Medicago truncatula has been widely adopted as a model species for legume studies primarily because (1) it has a diploid genome with a relatively small haploid genome size (~550 Mbp); (2) plants can be stably transformed for gene functional studies; and (3) it is closely related to alfalfa (M. sativa), the queen of forages, and many other economically important crops for translational studies. Recently, the genome sequence of M. truncatula cv Jemalong A17 has been released1,2. Annotation of the genome shows that there are more than 50,000 predicted genes or gene models in the genome. To determine the function of most of the genes in the M. truncatula genome is a challenging task. To facilitate functional studies of genes, a comprehensive collection of mutants in the range of over 150,000 M1 lines has been generated using fast neutron bombardment (FNB) mutagenesis in M. truncatula cv Jemalong A173,4. Fast neutron, a high energy ionization mutagen, has been used in generating mutants in many plant species including Arabidopsis5,6, rice (Oryza sativa)7, tomato (Solanum lycopersicum), soybean (Glycine soja; G. max)8,9, barley (Hordeum vulgare), and Lotus japonicus10. A large portion of mutations derived from FNB mutagenesis are due to DNA deletions that range in size from a few base pairs to mega base pairs9,11. Many phenotype-associated genes have been successfully identified and characterized4,12,13,14,15,16,17,18,19. Previously, molecular cloning of the underlying genes from FNB mutants relied on a map-based approach, which is time consuming and limits the number of mutants to be characterized at the molecular level. Recently, several complimentary approaches including transcript-based methods, genome tiling array-based comparative genomic hybridization (CGH) for DNA copy number variation detection, and whole genome sequencing, have been employed to facilitate the characterization of deletion mutants in diverse organisms including animals and plants20,21,22,23,24,25,26,27,28,29,30,31.
To facilitate the characterization of FNB mutants in M. truncatula, a whole-genome array-based comparative genomic hybridization (CGH) platform has been developed and validated. As reported in animal systems, the array-based CGH platform allows detection of copy number variations (CNVs) at the whole genome level in M. truncatula FNB mutants. Furthermore, lesions can be confirmed by PCR and deletion borders can be identified by sequencing. Overall, the array CGH platform is an efficient and effective tool in identifying lesions in M. truncatula FNB mutants. Here, the array CGH procedure and PCR characterization of deletion borders in an M. truncatula FNB mutant are illustrated.
The following protocol provides experimental steps and information about reagents, equipment and analysis tools for researchers who are interested in carrying out whole genome array-based comparative genomic hybridization (CGH) analysis of copy number variations in plants. As an example, Medicago truncatula FN6191 mutant was used to identify deletion regions and candidate genes associated with mutant phenotypes. M. truncatula FN6191 mutant, originally isolated from a fast neutron bombardment-induced deletion mutant collection32 (see Table of Materials), exhibited a hyper-nodulation phenotype after inoculation with the soil bacterium, Sihorhizobium meliloti Sm1021, in contrast to wild type plants.

<table><tbody><tr><td>&lt;em&gt;Medicago truncatula&lt;/em&gt; genome array, 1 x 1 M</td><td>Agilent</td><td>G4123A</td><td></td></tr><tr><td>&lt;em&gt;Medicago truncatula&lt;/em&gt; FN6191 (mutant)</td><td>In house</td><td>FN6191</td><td></td></tr><tr><td>&lt;em&gt;Medicago truncatula&lt;/em&gt; Jemalong A17 (reference)</td><td>In house</td><td>A17</td><td></td></tr><tr><td>Sulfuric acid</td><td>Sigma-Aldrich</td><td>320501</td><td></td></tr><tr><td>DNeasy Plant Mini Kit</td><td>Qiagen</td><td>69104</td><td></td></tr><tr><td>Nanodrop Spectrophotometer</td><td>Thermo Scientific</td><td>1000D</td><td></td></tr><tr><td>SureTag DNA Labeling Kit</td><td>Agilent</td><td>5190-3400</td><td></td></tr><tr><td>Random primer</td><td>Agilent</td><td>5190-3399</td><td></td></tr><tr><td>Acetonitrile</td><td>Sigma-Aldrich</td><td>271004-1L</td><td></td></tr><tr><td>Thermocycler</td><td>MJ research</td><td>PTC-200</td><td></td></tr><tr><td>Centrifuge</td><td>Labnet international Inc</td><td>Spectrafuge 24D</td><td></td></tr><tr><td>Stabilization and Drying Solution</td><td>Agilent</td><td>5185-5979</td><td></td></tr><tr><td>Oligo aCGH/ChIP-on-chip Hybridization Kit</td><td>Agilent</td><td>5188-5380</td><td></td></tr><tr><td>Hybridization Chamber gasket slides</td><td>Agilent</td><td>G2505</td><td></td></tr><tr><td>Human Cot-1 DNA</td><td>Agilent</td><td>5190-3393</td><td></td></tr><tr><td>Oligo aCGH/ChIP-on-chip Wash Buffer 1 and 2</td><td>Agilent</td><td>5188-5221</td><td></td></tr><tr><td>Hybridization Chamber, stainless</td><td>Agilent</td><td>G2534A</td><td></td></tr><tr><td>Hybridization oven</td><td>Agilent</td><td>G2545A</td><td></td></tr><tr><td>Purification Columns</td><td>Agilent</td><td>5190-3391</td><td></td></tr><tr><td>Laser scanner</td><td>Roche</td><td>MS200</td><td></td></tr><tr><td>NimbleScan 2.6</td><td>Roche Nimblegen</td><td>5225035001</td><td></td></tr><tr><td>Signal Map 1.9</td><td>Roche Nimblegen</td><td>Signalmap1.9</td><td></td></tr></tbody></table>

an array-based comparative genomic hybridization platform for efficient detection of copy number variations in fast neutron-induced medicago truncatula mutants

Mutants are invaluable genetic resources for gene function studies. To generate mutant collections, three types of mutagens can be utilized, including biological such as T-DNA or transposon, chemical such as ethyl methanesulfonate (EMS), or physical such as ionization radiation. The type of mutation observed varies depending on the mutagen used. For ionization radiation induced mutants, mutations include deletion, duplication, or rearrangement. While T-DNA or transposon-based mutagenesis is limited to species that are susceptible to transformation, chemical or physical mutagenesis can be applied to a broad range of species. However, the characterization of mutations derived from chemical or physical mutagenesis traditionally relies on a map-based cloning approach, which is labor intensive and time consuming. Here, we show that a high-density genome array-based comparative genomic hybridization (aCGH) platform can be applied to efficiently detect and characterize copy number variations (CNVs) in mutants derived from fast neutron bombardment (FNB) mutagenesis in Medicago truncatula, a legume species. Whole genome sequence analysis shows that there are more than 50,000 genes or gene models in M. truncatula. At present, FNB-induced mutants in M. truncatula are derived from more than 150,000 M1 lines, representing invaluable genetic resources for functional studies of genes in the genome. The aCGH platform described here is an efficient tool for characterizing FNB-induced mutants in M. truncatula.

Figure 2 shows the distribution of normalized log2 ratios of mutant versus WT signals across the whole genome. Analysis of CGH data revealed an approximate 22 kb deletion on chromosome 4 that encompasses the entire SUNN gene33 and several other annotated genes in FN6191 mutant (Figure 2, Figure 3). The candidate deleted region was covered by 73 consecutive probes on the array with the mean normalized log2 ratios less than -2.5 (Supplemental Table 1). An inspection of deletion borders suggested that the putative deletion in this mutant is flanked by probes located between coordinates 22,313,168 and 22,334,934 on chromosome 4 (Figure 3). To confirm the deletion borders, PCR primers were designed to be approximately 1,500 bp apart from the predicted deletion borders (FN6191-DB-F: GCTAGCAAGGGTCTGCGCAAGTT; FN6191-DB-R: GTATCGAGAAGGTCTTATAGCAGC) and PCR amplification was performed with these primers and the following parameters: 94 &#176;C, 5 min; 94 &#176;C, 45 s, 55 &#176;C, 30 s, 72 &#176;C, 1.5 min; for 35 cycles; 72 &#176;C, 10 min and then 10 &#176;C indefinitely. As expected, a single PCR product of approximately 1.5 kb was successfully amplified from the FN6191 mutant, but not WT (Figure 4A). Based on the M. truncatula genome release v3.5, the size of the deletion in FN 6191 was estimated to be 26.67 kb (Figure 4B). The CGH results showed that no other abnormal segments are present in the FN6191 mutant genome (Figure 2).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56470/56470fig1.jpg" /> 
Figure 1: Workflow of array comparative genomic hybridization (aCGH) analysis of M. truncatula mutant. (A) Preparation of plant materials: M. truncatula wild type (Jemalong A17) and FN6191 mutant were grown for three to four weeks in greenhouse. (B) Isolation of high quality genomic DNA: One gram of young leaves from single plants was used to isolate genomic DNA. DNA quality was determined using a spectrophotometer and gel electrophoresis. (C) DNA labeling and purification. Genomic DNAs of reference and experimental samples were labeled with Cyanine 3 (Cy3) and Cy5 using a DNA labeling kit and purified using a purification column. (D) Hybridization, washing, and scanning of 1 x 1 M M. truncatula CGH array. (E) CGH analysis: Log2 ratios of experimental/reference signals that are less than or equal to -2.5 or greater than or equal to 2.5 are considered as putative deletions and duplications, respectively. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56470/56470fig2.jpg" /> 
Figure 2: Array based comparative genomic hybridization analysis of copy number variations in M. truncatula hyper nodulation mutant FN6191. Shown are log2 mutant/wild type ratios of probes on all eight chromosomes. A consecutive 73-probe region on chromosome 4 was identified as the deleted region in the mutant (arrow). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56470/56470fig3.jpg" /> 
Figure 3. Identification of the deleted region in M. truncatula FN6191 mutant. A close-up view of the region on chromosome 4, in which 73 microarray probes exhibited significantly reduced log2 mutant/wild type ratios, and six mapped genes including SUNN (Medtr4g070970). Arrows indicate the location and direction of primers for PCR amplification of deletion borders. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56470/56470fig4.jpg" /> 
Figure 4: Confirmation of deletion borders in M. truncatula FN6191 mutant. (A) PCR amplification of deletion borders: A 1.5 kb product was amplified from the FN6191 mutant using primers flanking the deletion borders (lane 1; Mu). The same set of primers did not amplify any products from WT (M. truncatula Jemalong A17) due to a size limitation of PCR (lane 2; Wt). Lane M, 1 kb ladder. (B) Sequences of the deletion junction in the FN6191 mutant. An arrow denotes the deletion junction. (C) Sequencing results showed that the deletion borders (arrows) are located at the coordinates 22309163 and 22335836 on chromosome 4. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Labeling mix 1</td>
			<td>Per reaction x sample # (&#956;L)</td>
			<td>Labeling mix 2</td>
			<td>Per reaction x reference # (&#956;L)</td>
		</tr>
		<tr>
			<td>ddH2O</td>
			<td>6.0 x</td>
			<td>ddH2O</td>
			<td>6.0 x</td>
		</tr>
		<tr>
			<td>5x Buffer</td>
			<td>10.0 x</td>
			<td>5x Buffer</td>
			<td>10.0 x</td>
		</tr>
		<tr>
			<td>10x dNTPs</td>
			<td>5.0 x</td>
			<td>10x dNTPs</td>
			<td>5.0 x</td>
		</tr>
		<tr>
			<td>Cyanine 5</td>
			<td>3.0 x</td>
			<td>Cyanine 3&#160;</td>
			<td>3.0 x</td>
		</tr>
		<tr>
			<td>Exo-Klenow</td>
			<td>1.0 x</td>
			<td>Exo-Klenow</td>
			<td>1.0 x</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>25 x</td>
			<td>Total</td>
			<td>25 x</td>
		</tr>
	</tbody>
</table>
Table 1: Labeling Mixes.
Supplemental Table 1: Probe sequences deleted in M. truncatula FN6191 mutant. 
<a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/Supplemental_Table1.xlsx">Please click here to download this file.</a>

Watch this Scientific Journal Video about An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutant

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

This protocol provides experimental steps and information about reagents, equipment, and analysis tools for researchers who are interested in carrying out whole genome array-based comparative genomic hybridization (CGH) analysis of copy number variations in plants.

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

Mutants are invaluable genetic resources for gene function studies. To generate mutant collections, three types of mutagens can be utilized, including ...

an-array-based-comparative-genomic-hybridization-platform-for

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Genetics

Unit 2

Genomes and Evolution

SCIENTISTS IN ACTION

7.8K Views.  Noble Research Institute. Dit protocol biedt experimentele stappen en informatie over reagentia, apparatuur en analysetools voor onderzoekers die geïnteresseerd zijn in het hele genoom arraygebaseerd vergelijkende genomic hybridisatie (CGH) analyse van kopie nummer variaties in uit te voeren planten.

Video: An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generating Transgenic Plants with Single-copy Insertions Using BIBAC-GW Binary Vector

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the transgene, as multi-copy integrations are often subjected to gene silencing. The Gateway-compatible binary vector based on bacterial artificial chromosomes (pBIBAC-GW), like other pBIBAC derivatives, allows the insertion of single-copy transgenes with high efficiency. As an improvement to the original pBIBAC, a Gateway cassette has been cloned into pBIBAC-GW, so that the sequences of interest can now be easily incorporated into the vector transfer DNA (T-DNA) by Gateway cloning. Commonly, the transformation with pBIBAC-GW results in an efficiency of 0.2&#8211;0.5%, whereby half of the transgenics carry an intact single-copy integration of the T-DNA. The pBIBAC-GW vectors are available with resistance to Glufosinate-ammonium or DsRed fluorescence in seed coats for selection in plants, and with resistance to kanamycin as a selection in bacteria. Here, a series of protocols is presented that guide the reader through the process of generating transgenic plants using pBIBAC-GW: starting from recombining the sequences of interest into the pBIBAC-GW vector of choice, to plant transformation with Agrobacterium, selection of the transgenics, and testing the plants for intactness and copy number of the inserts using DNA blotting. Attention is given to designing a DNA blotting strategy to recognize single- and multi-copy integrations at single and multiple loci.

Using a pBIBAC-GW binary vector makes generating transgenic plants with intact single-copy insertions, an easy process. Here, a series of protocols is presented that guide the reader through the process of generating transgenic Arabidopsis plants, and testing the plants for intactness and copy number of the inserts.

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

Here, we present a method to engineer the genome of C. elegans using CRISPR-Cas9 ribonucleoproteins and homology dependent repair templates.

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Identifying Mutations by High Resolution Melting in a TILLING Population of Rice

Target Induced Local Lesions In Genomes (TILLING) is a strategy of reverse genetics for the high-throughput screening of induced mutations. However, the TILLING system has less applicability for insertion/deletion (Indel) detection and traditional TILLING needs more complex steps, like CEL I nuclease digestion and gel electrophoresis. To improve the throughput and selection efficiency, and to make the screening of both Indels and single base substitions (SBSs) possible, a new high-resolution melting (HRM)-based TILLING system is developed. Here, we present a detailed HRM-TILLING protocol and show its application in mutation screening. This method can analyze the mutations of PCR amplicons by measuring the denaturation of double-stranded DNA at high temperatures. HRM analysis is directly performed post-PCR without additional processing. Moreover, a simple, safe and fast (SSF) DNA extraction method is integrated with HRM-TILLING to identify both Indels and SBSs. Its simplicity, robustness and high throughput make it potentially useful for mutation scanning in rice and other crops.

In this article, we present the protocol that is described as high-resolution melting analysis (HRM)-based Target Induced Local Lesions In Genomes (TILLING). This method utilizes fluorescence changes during the melting of the DNA duplex and is suitable for high-throughput screening of both insertion/deletion (Indel) and single base substition (SBS).

Target Induced Local Lesions In Genomes (TILLING) is a strategy of reverse genetics for the high-throughput screening of induced mutations. However, the ...

Development of Targeting Induced Local Lesions IN Genomes (TILLING) Populations in Small Grain Crops by Ethyl Methanesulfonate Mutagenesis

Targeting Induced Local Lesions IN Genomes (TILLING) is a powerful reverse genetics tool that includes chemical mutagenesis and detection of sequence variation in target genes. TILLING is a highly valuable functional genomics tool for gene validation, especially in small grains in which transformation-based approaches hold serious limitations. Developing a robust mutagenized population is key to determining the efficiency of a TILLING-based gene validation study. A TILLING population with a low overall mutation frequency indicates that an impractically large population must be screened to find desired mutations, whereas a high mutagen concentration leads to high mortality in the population, leading to an insufficient number of mutagenized individuals. Once an effective population is developed, there are multiple ways to detect mutations in a gene of interest, and the choice of platform depends upon the experimental scale and availability of resources. The Cel-1 assay and agarose gel-based approach for mutant identification is convenient, reproducible, and a less resource-intensive platform. It is advantageous in that it is simple, requiring no computational knowledge, and it is especially suitable for validation of a small number of genes with basic lab equipment. In the present article, described are the methods for development of a good TILLING population, including preparation of the dosage curve, mutagenesis and maintenance of the mutant population, and screening of the mutant population using the PCR-based Cel-1 assay.

Development of Targeting Induced Local Lesions IN Genomes TILLING Populations in Small Grain Crops by Ethyl Methanesulfonate Mutagenesis

Described is a protocol for developing a Targeting Induced Local Lesions IN Genomes (TILLING) population in small grain crops with use of ethyl methanesulfonate (EMS) as a mutagen. Also provided is a protocol for mutation detection using the Cel-1 assay.

Targeting Induced Local Lesions IN Genomes (TILLING) is a powerful reverse genetics tool that includes chemical mutagenesis and detection of sequence ...

Developmental Biology

Competitive Genomic Screens of Barcoded Yeast Libraries

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment.

We have developed comprehensive, unbiased genome-wide screens to understand gene-drug and gene-environment interactions. Methods for screening these mutant collections are presented.

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Biology

Fluorescence-microscopy Screening and Next-generation Sequencing: Useful Tools for the Identification of Genes Involved in Organelle Integrity

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the subcellular distribution of a specific tagged fluorescent marker in the secretory pathway. Arabidopsis is a powerful biological model for genetic studies because of its genome size, generation time, and conservation of molecular mechanisms among kingdoms. The array genotyping as an approach to map the mutation in alternative to the traditional method based on molecular markers is advantageous because it is relatively faster and may allow the mapping of several mutants in a really short time frame. This method allows the identification of proteins that can influence the integrity of any organelle in plants. Here, as an example, we propose a screen to map genes important for the integrity of the endoplasmic reticulum (ER). Our approach, however, can be easily extended to other plant cell organelles (for example see1,2), and thus represents an important step toward understanding the molecular basis governing other subcellular structures.

A fundamental quest in cell biology is to define the mechanisms that underlie the identity of the organelles that make eukaryotic cells. Here we propose a method to identify the genes responsible for the morphological and functional integrity of plant organelles using fluorescence microscopy and next-generation sequencing tools.

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the ...

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Array Comparative Genomic Hybridization (Array CGH) for Detection of Genomic Copy Number Variants

Array CGH for the detection of genomic copy number variants has replaced G-banded karyotype analysis. This paper describes the technology and its application in a clinical diagnostic service laboratory. DNA extracted from a patient&#8217;s sample (blood, saliva or other tissue types) is labeled with a fluorochrome (either cyanine 5 or cyanine 3). A reference DNA sample is labeled with the opposite fluorochrome. There follows a cleanup step to remove unincorporated nucleotides before the labeled DNAs are mixed and resuspended in a hybridization buffer and applied to an array comprising ~60,000 oligonucleotide probes from loci across the genome, with high probe density in clinically important areas. Following hybridization, the arrays are washed, then scanned and the resulting images are analyzed to measure the red and green fluorescence for each probe. Software is used to assess the quality of each probe measurement, calculate the ratio of red to green fluorescence and detect potential copy number variants.

Array Comparative Genomic Hybridization Array CGH for Detection of Genomic Copy Number Variants

Array CGH for the detection of genomic copy number variants has replaced G-banded karyotype analysis. This paper describes the technology and its application in a diagnostic service laboratory.

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

Samenvatting

Meer video's verkennen