Name: methods for skin wounding and assays for wound responses in c. elegans
Uploaded: 2014-12-03T13:00:00.000+00:00
Duration: 9 min 6 s
Description: Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Needle wounding methods for C. elegans were first developed by Nathalie Pujol and Jonathan Ewbank; we thank Nathalie Pujol for comments on the manuscript. Work in our laboratory on C. elegans epidermal wound repair is supported by a grant from the NIH to A.D.C. (R01 GM054657).

The following protocols describe the detailed procedure for C. elegans skin wounding and for assaying wound responses.
1. Needle Wounding3,4
<ol>
	<li>Grow healthy unstarved worms on standard NGM (nematode growth medium) plates with E. coli OP50 bacteria as food, maintained in a 20 &#176;C incubator. 
	NOTE: Methods for NGM agar plates and routine cultivation of C. elegans can be found at www.wormbook.org6.</li>
	<li>Pick 25 L4 stage worms to a freshly seeded plate 1 day before wounding and culture at 20 &#176;C O/N.</li>
	<li>Before wounding, pull needles from capillaries using a needle puller. The needles used in wounding are identical to those used for microinjection of C. elegans.</li>
	<li>Ensure that all the worms are at young adult stage. Place the plate of worms on ice for about 30 min. Cooling causes the animals to be sluggish, facilitating needle wounding. 
	NOTE: Within 5 min of removal from the ice, the worms will start to move normally. It is possible but challenging to wound moving worms. With experience, 5 min is enough time to wound 25 worms. Immobilize with drugs such as levamisole (as used in laser wounding, see below), although animals will take longer to recover.</li>
	<li>Remove the agar plate from the ice to a dissecting stereomicroscope. Using a worm pick, move 25 worms into the center of the agar plate.</li>
	<li>Place the needle into a 100 &#181;l pipette tip to more easily hold the needle. Puncture the anterior or posterior part of the body of the worm with the needle, avoiding the gonad. In general, attempt to wound between the posterior pharynx and anterior gonad, or between the posterior gonad and the rectum. Re-use needles many times, until they break. 
	NOTE: Ensure the wounds are brief, gentle pricks that puncture the cuticle and skin, penetrating ~5-10 &#181;m into the animal. The needle should enter the animal at approximately a right angle to the skin. The wounds should not cause obvious damage to internal organs, or immediate rupture of the body. Observe a small amount of cytoplasm oozing out for a few seconds after the wound; however, if cellular contents leak out over a prolonged time the animals will not survive. For optimal imaging, wound the lateral epidermal syncytium (hyp7) or the lateral seam. 
	NOTE: This procedure includes the use of a glass needle.</li>
	<li>Allow worms to recover at RT&#160;then culture at 20 &#176;C. Judge the success of needle wounding by a number of assays described below. Greater than 95% of wild type animals survive 24 hr after needle wounding in the young adult stage. The effect of wounding in larvae or older adults has not yet been extensively analyzed.</li>
</ol>
2. Laser Wounding3
Use femtosecond laser irradiation (800 nm) to perform more precise wounding.
<ol>
	<li>Prepare agar pads on a glass slide with melted 2% agar7. Ensure the pads are similar to the agar pads used for live imaging of C. elegans.</li>
	<li>Transfer 10 young adult worms onto the agarose pad with worm pick, and add a 2 &#181;l drop of 12 mM Levamisole solution. Cover the animals and the liquid with a cover slip. Wait 1-2 min for the worms to paralyze.</li>
	<li>Place the glass slide onto a spinning disk confocal microscope. Move the stage to find the worms and focus on the lateral anterior or posterior syncytial epidermis with a 100X&#160;objective (NA 1.4-1.46).</li>
	<li>Set the power of the femtosecond laser to 140 mW (measured before the objective). Use the femtosecond laser at a repetition rate of 80 MHz. 
	NOTE: Two pulses of 200 msec each (separated by 20 msec) are sufficient for wounding in our hands.</li>
	<li>Focus on the apical surface of the epidermal cell and wound the epidermis. Observe local disruption of the cytoplasm (bubbling), or local bleaching of any fluorescent marker used. 
	NOTE: Follow appropriate laser safety procedures when using the femtosecond laser. Line or point scans using femtosecond lasers such as those in two photon microscopes should provide sufficient power for laser wounding. 
	NOTE: While we do not have direct experience of using other lasers, in principle wounding should be possible using conventional UV lasers (as used in C. elegans cell ablations). Optionally, use a Fluorescence Recovery After Photobleaching (FRAP) module on spinning disk confocal to wound the epidermis (N. Pujol, personal communication).</li>
</ol>
3. Visualization of Epidermal Ca2+&#160;Responses to Wounding
<ol>
	<li>Use transgenic C. elegans strains that express Ca2+ sensors (such as those of the GCaMP series) in the epidermis, under the control of the adult epidermal specific promoter col-19 (Figure 1A; transgenes are listed in Table 1). Use a transgene expressing a red fluorescent protein such as tdTomato as an internal control for transgene expression level. 
	NOTE: We have used tdTomato as an internal control for transgene expression as epidermal tdTomato fluorescence is relatively stable and does not interfere with GCaMP imaging.</li>
	<li>Both needle and laser wounding trigger Ca2+ elevation in the epidermis. However, as needle wounding cannot be readily performed on a spinning disk confocal, laser wounding is preferable for quantitative analysis of the Ca2+ response (Figure 1).</li>
	<li>Acquire time lapse images in multi-dimensional acquisition mode (interval time 2 sec with 114 msec excitation laser exposure) using a spinning disk confocal with 100X&#160;objective (NA 1.4-1.46) and appropriate filter sets (GFP filters will work for GCaMP3). 
	NOTE: Acquire time-lapse images every 30 sec for about 2 hr&#160;to examine the Ca2+ response to wounding over a longer time course.</li>
	<li>Using image analysis software measure the average GCaMP fluorescence in ten equivalent regions of interest (ROI), five of which are centered on the epidermal cell cytosol and five in the background.</li>
	<li>Obtain baseline fluorescence (F0) by averaging fluorescence in 5 ROIs in the epidermis then subtracting the average of 5 ROIs in the background before injury. Express the change in fluorescence &#916;F as the ratio of change with respect to the baseline [(Ft-F0)/F0].</li>
</ol>
4. Visualization of F-actin Dynamics After Wounding
<ol>
	<li>NOTE: In response to needle wounding, observe an actin ring at the wound site that gradually closes around the wound. This protocol section assays wound closure by measuring the actin ring diameter.</li>
	<li>Generate transgenic worms that express an F-actin marker such as the Drosophila moesin actin binding domain fused to GFP, expressed under the control of an epidermal specific promoter such as col-19 (Figure 2A) (transgene juIs352). 
	NOTE: We have obtained similar results using other actin binding domain markers such as Lifeact or F-tractin (unpublished results).</li>
	<li>Perform needle wounding on Pcol-19-GFP-moesin transgenic worms. After needle wounding, observe a ring of GFP-moesin around the wound site by ~5 min. The actin ring becomes smaller in diameter and eventually closes 2-3 hr post wounding in wild type animals (Figure 2A).</li>
	<li>Prepare a 2% agar pad on a glass slide and transfer 10 worms onto the pad in 2 &#181;l 12 mM Levamisole solution. Image the GFP-moesin rings 1 hr after wounding using conventional confocal microscopy. 
	NOTE: Use confocal microscopy to acquire z-stacks (13 x 0.5 &#181;m) of actin rings 1 hr after wounding.</li>
	<li>Measure the actin ring diameter after wounding. To quantitate epidermal GFP-moesin, first make a maximum intensity projection of the z-stack and then draw 4 line scans (at 45&#176; to each other) over the GFP-moesin ring. Ring diameter is defined as the average peak to peak distance of the four line scans (Figure 2B). For rings that have already closed, the diameter is defined as 0 &#181;m. 
	NOTE: F-actin rings are conveniently measured 1 hr post wounding as this is approximately half way through the wound closure process in the wild type. F-actin rings can also be measured at multiple time points to derive a time course of wound closure. Time lapse movies of wound closure can be acquired using levamisole-immobilized worms and spinning disk confocal microscopy.</li>
</ol>
5. Assay Induction of Epidermal Antimicrobial Peptides

NOTE: Wounding also triggers innate immune responses in the C. elegans skin. Transcription of genes encoding antimicrobial peptides (AMPs) is induced in the epidermis. The nlp-29 (neuropeptide-like protein) AMP is strongly induced by wounding4. To assay how the epidermis controls AMP expression after wounding, use transgenic reporters or real-time PCR to detect individual AMP transcript levels.
<ol>
	<li>Transgenic reporter assay for innate immune response to wounding4.</li>
	<li>Perform needle wounding (as in protocol 1) on adult animals expressing the transgenic reporter frIs7, which contains Pnlp-29-GFPand Pcol-12-DsRed as an internal control. Observe unwounded adult animals as dark red or orange in a GFP long pass filter. 
	NOTE: Wounding wild-type worms will induce Pnlp-29-GFP expression but will not affect Pcol-12-dsRed, resulting in worms that appear orange, yellow, or green under GFP long pass illumination. Loss of function of genes in the p38 MAPK pathway, such as pmk-1 or nsy-1 will block nlp-29-GFP induction after wounding4. Pnlp-29-GFP is expressed at high levels in larval stages</li>
	<li>Perform AMP induction assays in young adult animals. Ensure that unwounded control animals have low levels of GFP. 
	NOTE:Pnlp-29-GFP expression is also induced by osmotic stress8, and may be sensitive to other environmental stresses.</li>
	<li>6 hr after wounding, score the numbers of worms that have Pnlp-29-GFP induction (Figure 3)9 using a fluorescence dissecting scope with GFP long-pass filter. 
	NOTE: At 1 hr post-wounding Pnlp-29-GFP is visibly induced, reaching a peak about 6 hr post-wounding and then remaining elevated up to 24 hr post wounding. Quantify expression by visual scoring4,9. Alternatively, quantify expression levels using a fluorescence activated worm sorter4. For the worm sorter, at least 50 animals need to be wounded.</li>
	<li>Real-time PCR assay for quantitating transcript levels of the individual AMP genes. Assay transcript levels for several genes: nlp-29, nlp-30, cnc-1, and cnc-5.</li>
	<li>Perform needle wounding on wild-type or mutant worms (see protocol 1)</li>
	<li>Collect 50 wounded worms and 50 unwounded worms at the desired times (e.g. 3, 6, 24 hr) post-wounding.</li>
	<li>Extract RNA using a commercial kit following the manufacturer&#8217;s instructions.</li>
	<li>Perform reverse transcription to get total 20 &#181;l cDNA using a commercial reverse transcriptase kit.</li>
	<li>For RT-PCR, use 0.2 &#181;l cDNA (1/40) from each sample in combination with a green supermix with fluorescein and 0.2 &#181;M primers. To compare RNA quality, use ama-1 or snb-1 RT-PCR as reference; compare the AMP relative expression level by normalizing to internal control (ama-1 or snb-1), or compare fold induction post-wounding (AMP induction in wounded worms/unwounded worms) by normalizing to internal control. 
	NOTE: cnc-1 and cnc-5 are caenacin family antimicrobial peptides whose transcription is activated by wounding10. Typically, needle wounding induces expression (~500 fold for cnc-1) over a time course of 4 hr10. Primers used in published work are listed in Table 2.</li>
</ol>
6. Assay Survival After Wounding
<ol>
	<li>NOTE: Wounding activates at least two independent signaling pathways in the epidermis: the Ca2+ dependent wound repair pathway and the innate immune response pathway. Both pathways are required for full survival of sterile wounding. To test whether a mutant or RNAi treatment affects wound healing, measure survival at 24-48 hr post wounding. Optionally, use conventional lifespan assays to determine the effect of wounding on longevity4,9.</li>
	<li>Perform needle wounding on young adult (L4 + 24 hr) worms (50 worms, repeat several times) following protocol 1 above. Maintain an equivalent number of unwounded worms as controls.</li>
	<li>Check survival every 24 hr (transfer wounded worms to a new agar plate every 24 hr). Observe ~50% survival 24 hr after wounding in mutants that are defective in wound repair such as gtl-2 or tir-1, when normalized to unwounded control animals. Death is defined as a lack of locomotor response to touch by worm pick.</li>
</ol>

<ol>
	<li>Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair+and+regeneration.">Wound repair and regeneration.</a> Nature. 453, 314-321 (2008).</li><li>Sonnemann, K. J., Bement, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair:+toward+understanding+and+integration+of+single-cell+and+multicellular+wound+responses.">Wound repair: toward understanding and integration of single-cell and multicellular wound responses.</a> Annu Rev Cell Dev Biol. 27, 237-263 (2011).</li><li>Xu, S., Chisholm, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+G&#945;q-Ca2++signaling+pathway+promotes+actin-mediated+epidermal+wound+closure+in+C.+elegans.">A G&#945;q-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.</a> Curr Biol. 21, 1960-1967 (2011).</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+innate+immune+responses+to+infection+and+wounding+in+the+C.+elegans+epidermis.">Distinct innate immune responses to infection and wounding in the C. elegans epidermis.</a> Curr Biol. 18, 481-489 (2008).</li><li>Chisholm, A. D., Xu, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Caenorhabditis+elegans+epidermis+as+a+model+skin.+II:+differentiation+and+physiological+roles.">The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles.</a> Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook : the online review of C. elegans biology. , 1-11 .</li><li>Bargmann, C. I., Avery, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+killing+of+cells+in+Caenorhabditis+elegans.+Methods+in+cell+biology.">Laser killing of cells in Caenorhabditis elegans. Methods in cell biology.</a> 48, 225-250 .</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-fungal+innate+immunity+in+C.+elegans+is+enhanced+by+evolutionary+diversification+of+antimicrobial+peptides.">Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides.</a> PLoS Pathog. 4, (2008).</li><li>Tong, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+regulation+of+Caenorhabditis+elegans+epidermal+damage+responses+by+death-associated+protein+kinase.">Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase.</a> Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).</li><li>Zugasti, O., Ewbank, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroimmune+regulation+of+antimicrobial+peptide+expression+by+a+noncanonical+TGF-beta+signaling+pathway+in+Caenorhabditis+elegans+epidermis.">Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis.</a> Nat Immunol. 10, 249-256 (2009).</li><li>Zhao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip-based+C.+elegans+microinjection+system+for+investigating+cell-cell+communication+in+vivo.">Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo.</a> Biosensor., &amp; Bioelectronics. 50, 28-34 (2013).</li><li>Jansson, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adhesion+of+Conidia+of+Drechmeria+coniospora+to+Caenorhabditis+elegans+Wild+Type+and+Mutants.">Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants.</a> J Nematol. 26, 430-435 (1994).</li><li>Hodgkin, J., Kuwabara, P. E., Corneliussen, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+bacterial+pathogen,+Microbacterium+nematophilum,+induces+morphological+change+in+the+nematode+C.+elegans.">A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans.</a> Curr Biol. 10, 1615-1618 (2000).</li><li>Hochbaum, D., Ferguson, A. A., Fisher, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+C.+elegans+by+biolistic+transformation.">Generation of transgenic C. elegans by biolistic transformation.</a> J Vis Exp. (42), (2010).</li><li>Hashmi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+nematodes+using+arrays+of+micromechanical+piercing+structures.">Genetic transformation of nematodes using arrays of micromechanical piercing structures.</a> BioTechniques. 19, 766-770 (1995).</li></ol>

The authors are not aware of any competing interests.

The methods presented here for needle and laser wounding provide complementary approaches for assessing the ability of the epidermal epithelium to repair damage. Laser wounding is relatively localized and (depending on laser configuration) can be confined to the epidermis, whereas needle wounding disrupts the epidermis, cuticle, and likely internal basement membranes. Needle wounding may more accurately resemble wounds inflicted by pathogens or mechanical damage in the natural environment. As a rule, needle wounding requires more practice to achieve precise wounds that are compatible with animal survival. The cellular responses to needle and laser wounding display many similarities. However it should be noted that formation of actin rings is not reproducibly observed after femtosecond laser wounding.
A limitation of needle puncture is that it is not a precise wound: the needle also damages internal tissues whose contributions to worm survival have not been investigated. A possible modification of this protocol would be to combine microfluidic-based microinjection system11 and fluorescent reporters to perform more precise physical wounding.
The needle and laser wounding methods detailed here are simple yet fairly labor intensive, and at best medium-throughput, making it challenging to use genomic or biochemical approaches to characterization of the wound response. Cuticle penetrating pathogens such as fungi or protozoa12,13 can be delivered to larger populations of animals, and may trigger responses that overlap with the response to wounding, yet introduce additional complexities of pathogen specific responses. Further work will be required to explore whether other abiotic methods such as ballistic bombardment14 or arrays of micromechanical piercing structures15 can be adapted for large-scale wounding.

Skin wound healing mechanisms are of basic biological interest and relevant to human health. Wound healing in vertebrates and mammals comprises a complex series of coordinated responses of multiple tissues and signaling1. Many simple genetic model organisms are also capable of healing skin wounds2. It is therefore of interest to analyze genetically tractable models of skin wound repair. We and others have begun to use Caenorhabditis elegans as new model for skin wound healing3,4. The goal of this protocol is to enable a broader set of researchers to use C. elegans as a tool to investigate molecular and cellular mechanisms of epidermal wound healing.
The C. elegans skin comprises the epidermis (also known as hypodermis) and the extracellular cuticle5. The adult epidermis is formed from a small number of multinucleate syncytia, of which the largest is the syncytium known as hyp7. The epidermis is a simple epithelium that secretes the cuticle on its apical surface. The skin can actively defend against skin-penetrating pathogens and repair small wounds4. Wound repair of the C. elegans skin is robust, as almost all wild type animals survive can survive small puncture wounds caused by needles, or local skin damage caused by laser irradiation. C. elegans skin wounding triggers a suite of responses, including an epidermal innate immune response, wound closure, and scar formation4. The adult epidermis is post-mitotic, and wound healing involves local cellular responses as opposed to epidermal proliferation or cell migration. We have shown that skin wounding triggers a large and sustained increase in epidermal Ca2+, requiring the membrane TRPM channel GTL-2 and internal Ca2+ stores3. The epidermal Ca2+ signal is required for formation and closure of F-actin rings at the wound site. Wounding also induces innate immune responses that activate the transcription of AMPs such as nlp-29. The wounding-induced transcription of AMPs is dependent on a TIR-1/PMK-1 p38 MAP kinase cascade acting autonomously in the epidermis4. Defects in either the Ca2+ signaling pathway or in the innate immune response will lead to lower survival post-wounding. The relatively simple structure of the C. elegans epidermis, its genetic tractability and advantages for in vivo imaging make it an excellent system to study multiple aspects of wound repair.
Here we present protocols for the two common methods of wounding: needle wounding and laser wounding. Needle wounding requires no specialized equipment (other than the needle puller), and with experience can be performed on hundreds of worms per day. Needle wounding is performed on animals growing on agar plates. In contrast, laser wounding is performed on anesthetized animals mounted on agar pads under a coverslip, and is suited for live imaging of the cellular responses to damage.

<table><tbody><tr><td>Agarose</td><td>Denville Scientific</td><td>CA3510-8</td><td></td></tr><tr><td>Plastic Petri plate</td><td>Tritech Research</td><td>T3308</td><td>60 mm</td></tr><tr><td>Levamisole</td><td>Sigma</td><td>L9756</td><td>12 mM</td></tr><tr><td>Borosilicate glass capillary</td><td>World Precision Instruments</td><td>1B100F-4</td><td></td></tr><tr><td>Needle puller</td><td>Sutter Instrument&amp;nbsp;</td><td>P-2000</td><td></td></tr><tr><td>Worm pick (platinum wire)</td><td>Tritech Research</td><td>PT-9010</td><td></td></tr><tr><td>M9 solution</td><td>Home-made</td><td></td><td>3 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 6 g Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;, 5 g NaCl, 1 ml 1 M MgSO&lt;sub&gt;4&lt;/sub&gt;, H&lt;sub&gt;2&lt;/sub&gt;O to 1 liter. Sterilize by autoclaving</td></tr><tr><td>Trizol</td><td>Invitrogen</td><td>15596026</td><td>Use 500 ml for 50 worms</td></tr><tr><td>iQ SYBR Green</td><td>Bio-Rad</td><td>1708882</td><td></td></tr><tr><td>SuperScript III</td><td>Invitrogen</td><td>18080-051</td><td></td></tr><tr><td>PCR machine</td><td>Bio-Rad</td><td>C1000/CFX96</td><td></td></tr><tr><td>96-well PCR tubes</td><td>Bio-Rad</td><td>MLL9601</td><td></td></tr><tr><td>Image analysis software</td><td>Molecular Devices</td><td>Metamorph</td><td></td></tr></tbody></table>

methods for skin wounding and assays for wound responses in c. elegans

The C. elegans epidermis and cuticle form a simple yet sophisticated skin layer that can repair localized damage resulting from wounding. Studies of wound responses and repair in this model have illuminated our understanding of the cytoskeletal and genomic responses to tissue damage. The two most commonly used methods to wound the C. elegans adult skin are pricks with microinjection needles, and local laser irradiation. Needle wounding locally disrupts the cuticle, epidermis, and associated extracellular matrix, and may also damage internal tissues. Laser irradiation results in more localized damage. Wounding triggers a succession of readily assayed responses including elevated epidermal Ca2+ (seconds-minutes), formation and closure of an actin-containing ring at the wound site (1-2 hr), elevated transcription of antimicrobial peptide genes (2-24 hr), and scar formation. Essentially all wild type adult animals survive wounding, whereas mutants defective in wound repair or other responses show decreased survival. Detailed protocols for needle and laser wounding, and assays for quantitation and visualization of wound responses and repair processes (Ca dynamics, actin dynamics, antimicrobial peptide induction, and survival) are presented.

Laser or needle wounding will trigger rapid and sustained elevation in epidermal Ca levels, as visualized with Ca sensors such as GCaMPs (Figure 1). The Ca elevation occurs within seconds, and remains elevated for tens of minutes. Needle wounding reproducibly results in the formation of F-actin rings at wound sites (Figure 2); these appear within minutes, and gradually close over 1-2 hr&#160;after wounding. Actin rings are less often formed after more precise laser wounding. Both needle and laser wounding induce expression of epidermal antimicrobial peptides (AMPs) such as nlp-29, detected with transcriptional reporters (Figure 3). AMP induction is apparent within 2-4 hr after wounding and lasts approximately 24 hr. Needle wounding of the wild type should not significantly affect viability (measured at 24 hr after wounding) or life span.
<img alt="Figure 1" src="/files/ftp_upload/51959/51959fig1highres.jpg" /> 
Figure 1. Laser wounding triggers a Ca2+ response in the C. elegans epidermis. (A)&#160;Epidermal GCaMP3 fluorescence (Pcol-19-GCaMP3 (juIs319)) levels after femtosecond laser wounding. Lateral view of epidermis in anterior-body; x, laser wound; N, epidermal nucleus. Spinning disk confocal images, intensity code. UW: unwounded, W: wounded. (B)&#160;Quantitation of GCaMP3 &#916;F/F0 at 20, 40, and 60 &#956;m from wound site; representative trace. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51959/51959fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/51959/51959fig2highres.jpg" /> 
Figure 2. Needle wounding triggers actin polymerization around wound site. (A)&#160;Epidermal needle wounds trigger formation of actin rings at the wound margin, visualized with Pcol-19-GFP-moesin (juIs352). Scale: 10 &#956;m. UW: unwounded, W: wounded. (B)&#160;Quantitation of actin ring diameter from line scans, 4 line scans per animal (dotted red lines in panel (A), WT). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51959/51959fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/51959/51959fig3highres.jpg" /> 
Figure 3. Epidermal wounding activates innate immune response. Representative images (WT unwounded, WT wounded + 3 hr) of Pnlp-29-GFP(frIs7) induction after needle wounding. Scale: 200 &#956;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51959/51959fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Reporter</td>
			<td>Transgene</td>
			<td>Fluorescence</td>
			<td>Allele</td>
		</tr>
		<tr>
			<td>Calcium</td>
			<td>Pcol-19-GCaMP3;Pcol-19-tdTomato</td>
			<td>GFP/tdTomato</td>
			<td>juIs319 X</td>
		</tr>
		<tr>
			<td>Actin</td>
			<td>Pcol-19-GFP::moesin</td>
			<td>GFP</td>
			<td>juIs352 I</td>
		</tr>
		<tr>
			<td>nlp-29</td>
			<td>Pnlp-29-GFP/Pcol-12-DsRed</td>
			<td>GFP/DsRed</td>
			<td>frIs7 IV</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Transgenes used in wound response assays. This table lists chromosomally integrated transgenes available at the Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc).
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Gene name</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>nlp-29</td>
			<td>F: cttctcgcctgcttcatggc</td>
		</tr>
		<tr>
			<td>R: gtccgtatccaccatatcctcc</td>
		</tr>
		<tr>
			<td>nlp-30</td>
			<td>F: TTCTTCTCGCCTGCTTCATGG</td>
		</tr>
		<tr>
			<td>R: CATAACCTCTACCATATCCACCG</td>
		</tr>
		<tr>
			<td>cnc-1</td>
			<td>F: gccattgtcgccatttcctc&#160;</td>
		</tr>
		<tr>
			<td>R: cctccatacattggatatcctc</td>
		</tr>
		<tr>
			<td>cnc-5</td>
			<td>F: CTTCTTCTAGCAATGCTCGCTC</td>
		</tr>
		<tr>
			<td>R: GTATCCTCCACCATACCCTCC</td>
		</tr>
		<tr>
			<td>ama-1</td>
			<td>F: ACTCAGATGACACTCAACAC</td>
		</tr>
		<tr>
			<td>R: GAATACAGTCAACGACGGAG</td>
		</tr>
		<tr>
			<td>snb-1</td>
			<td>F: tccagcagacacaagctcagg</td>
		</tr>
		<tr>
			<td>R: gagacaacttctgatcacgctc</td>
		</tr>
	</tbody>
</table>
Table 2.&#160;Primers used for RT-PCR of AMP transcripts. Working concentration is 0.2 &#181;M. snb-1 serves as internal control.

Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity.

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

The C. elegans epidermis and cuticle form a simple yet sophisticated skin layer that can repair localized damage resulting from wounding. Studies of wound ...

methods-for-skin-wounding-and-assays-for-wound-responses-in-c-elegans

Nanyang Technological University

Research

JoVE Journal

Biology

10.3K Views.  University of California, San Diego. The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity. 

Video: Methods for Skin Wounding and Assays for Wound Responses in C. elegans

In vivo Laser Axotomy in C. elegans

Neurons communicate with other cells via axons and dendrites, slender membrane extensions that contain pre- or post-synaptic specializations. If a neuron is damaged by injury or disease, it may regenerate. Cell-intrinsic and extrinsic factors influence the ability of a neuron to regenerate and restore function. Recently, the nematode C. elegans has emerged as an excellent model organism to identify genes and signaling pathways that influence the regeneration of neurons1-6. The main way to initiate neuronal regeneration in C. elegans is laser-mediated cutting, or axotomy. During axotomy, a fluorescently-labeled neuronal process is severed using high-energy pulses. Initially, neuronal regeneration in C. elegans was examined using an amplified femtosecond laser5. However, subsequent regeneration studies have shown that a conventional pulsed laser can be used to accurately sever neurons in vivo and elicit a similar regenerative response1,3,7.
We present a protocol for performing in vivo laser axotomy in the worm using a MicroPoint pulsed laser, a turnkey system that is readily available and that has been widely used for targeted cell ablation. We describe aligning the laser, mounting the worms, cutting specific neurons, and assessing subsequent regeneration. The system provides the ability to cut large numbers of neurons in multiple worms during one experiment. Thus, laser axotomy as described herein is an efficient system for initiating and analyzing the process of regeneration.

In vivo Laser Axotomy in C. elegans

A protocol to cut neurons in C. elegans with a MicroPoint pulsed laser is presented. We describe setting up the system, immobilizing worms, and severing labeled neurons. Advantages include a relatively low-cost system and the ability to sever neuronal processes or ablate cells in vivo.

Neurons communicate with other cells via axons and dendrites, slender membrane extensions that contain pre- or post-synaptic specializations. If a neuron ...

Neuroscience

Microinjection Wound Assay and In vivo Localization of Epidermal Wound Response Reporters in Drosophila Embryos.

The Drosophila embryo develops a robust epidermal layer that serves both to protect the internal cells from a harsh external environment as well as to maintain cellular homeostasis. Puncture injury with glass needles provides a direct method to trigger a rapid epidermal wound response that activates wound transcriptional reporters, which can be visualized by a localized reporter signal in living embryos or larvae. Puncture or laser injury also provides signals that promote the recruitment of hemocytes to the wound site. Surprisingly, severe (through and through) puncture injury in late stage embryos only rarely disrupts normal embryonic development, as greater than 90% of such wounded embryos survive to adulthood when embryos are injected in an oil medium that minimizes immediate leakage of hemolymph from puncture sites. The wound procedure does require micromanipulation of the Drosophila embryos, including manual alignment of the embryos on agar plates and transfer of the aligned embryos to microscope slides. The Drosophila epidermal wound response assay provides a quick system to test the genetic requirements of a variety of biological functions that promote wound healing, as well as a way to screen for potential chemical compounds that promote wound healing. The short life cycle and easy culturing routine make Drosophila a powerful model organism. Drosophila clean wound healing appears to coordinate the epidermal regenerative response, with the innate immune response, in ways that are still under investigation, which provides an excellent system to find conserved regulatory mechanisms common to Drosophila and mammalian epidermal wounding.

Microinjection Wound Assay and In vivo Localization of Epidermal Wound Response Reporters in Drosophila Embryos.

The embryonic epidermis of very late stage Drosophila embryos provides an in vivo system for rapid puncture wound response analysis and can be combined with genetic manipulations or chemical microinjection treatments to advance studies in wound healing for translation into mammalian models.

The Drosophila embryo develops a robust epidermal layer that serves both to protect the internal cells from a harsh external environment as well as to ...

Bioengineering

Automated Analysis of a Nematode Population-based Chemosensory Preference Assay

The nematode, Caenorhabditis elegans' compact nervous system of only 302 neurons underlies a diverse repertoire of behaviors. To facilitate the dissection of the neural circuits underlying these behaviors, the development of robust and reproducible behavioral assays is necessary. Previous C. elegans behavioral studies have used variations of a "drop test", a "chemotaxis assay", and a "retention assay" to investigate the response of C. elegans to soluble compounds. The method described in this article seeks to combine the complementary strengths of the three aforementioned assays. Briefly, a small circle in the middle of each assay plate is divided into four quadrants with the control and experimental solutions alternately placed. After the addition of the worms, the assay plates are loaded into a behavior chamber where microscope cameras record the worms' encounters with the treated regions. Automated video analysis is then performed and a preference index (PI) value for each video is generated. The video acquisition and automated analysis features of this method minimizes the experimenter's involvement and any associated errors. Furthermore, minute amounts of the experimental compound are used per assay and the behavior chamber's multi-camera setup increases experimental throughput. This method is particularly useful for conducting behavioral screens of genetic mutants and novel chemical compounds. However, this method is not appropriate for studying stimulus gradient navigation due to the close proximity of the control and experimental solution regions. It should also not be used when only a small population of worms is available. While suitable for assaying responses only to soluble compounds in its current form, this method can be easily modified to accommodate multimodal sensory interaction and optogenetic studies. This method can also be adapted to assay the chemosensory responses of other nematode species.

We present a behavior recording setup and protocol that enables automated analysis of the nematode, Caenorhabditis elegans' preference for soluble compounds in a population-based assay. This article describes the construction of a behavior chamber, the behavioral assay protocol, and video analysis software usage.

The nematode, Caenorhabditis elegans' compact nervous system of only 302 neurons underlies a diverse repertoire of behaviors. To facilitate the dissection ...

Behavior

A Device for Performing Cell Migration/Wound Healing in a 96-Well Plate

The cell migration/wounding assay is a commonly used method to study cell migration and other biological processes, such as angiogenesis and tumor metastasis. In this assay, cells are grown to form a confluent monolayer and a mechanical wound is created by scratching with a device. Then the migration rate of the cells towards the denuded area can be monitored by imaging. Our 8-channel mechanical wounder is designed to tackle most of the problems associated with the cell migration assay. Firstly, our wounder can be easily sterilized by autoclaving or with common disinfectants. Secondly, the individual adjustable pins allow even contact with the cell culture plate so that sharp and reproducible wounds can be created. Thirdly, the guiding bars on both sides of the wounder ensure consistent wounding position in each well. The use of disposable plastic pipette tips for wounding can further provide better handling of the wounder as well as to minimize cross-contamination. In conclusion, our cell wounder can provide researchers with a user friendly and reproducible device for performing the cell migration assay using the standard 96-well culture plate.

Here, we present a protocol to perform a semi-high throughput cell migration assay on a 96-well cell culture plate. This protocol is a fast, simple and economical method to create consistent scratch wounds on a cell monolayer.

The cell migration/wounding assay is a commonly used method to study cell migration and other biological processes, such as angiogenesis and tumor ...

Developmental Biology

A Drosophila Model to Study Wound-induced Polyploidization

Polyploidy is a frequent phenomenon whose impact on organismal health and disease is still poorly understood. A cell is defined as polyploid if it contains more than the diploid copy of its chromosomes, which is a result of endoreplication or cell fusion. In tissue repair, wound-induced polyploidization (WIP) has been found to be a conserved healing strategy from fruit flies to vertebrates. WIP has several advantages over cell proliferation, including resistance to oncogenic growth and genotoxic stress. The challenge has been to identify why polyploid cells arise and how these unique cells function. Provided is a detailed protocol to study WIP in the adult fruit fly epithelium where polyploid cells are generated within 2 days after a puncture wound. Taking advantage of D. melanogaster&#39;s extensive genetic tool kit, the genes required to initiate and regulate WIP, including Myc, have begun to be identified. Continued studies using this method can reveal how other genetic and physiological variables including sex, diet, and age regulate and influence WIP&#39;s function.

A Drosophila Model to Study Wound-induced Polyploidization

Wound-induced polyploidization is a conserved tissue repair strategy where cells grow in size instead of dividing to compensate for cell loss. Here is a detailed protocol on how to use the fruit fly as a model to measure ploidy and its genetic regulation in epithelial wound repair.

Polyploidy is a frequent phenomenon whose impact on organismal health and disease is still poorly understood. A cell is defined as polyploid if it ...

Using a Microfluidics Device for Mechanical Stimulation and High Resolution Imaging of C. elegans

One central goal of mechanobiology is to understand the reciprocal effect of mechanical stress on proteins and cells. Despite its importance, the influence of mechanical stress on cellular function is still poorly understood. In part, this knowledge gap exists because few tools enable simultaneous deformation of tissue and cells, imaging of cellular activity in live animals, and efficient restriction of motility in otherwise highly mobile model organisms, such as the nematode Caenorhabditis elegans. The small size of C. elegans makes them an excellent match to microfluidics-based research devices, and solutions for immobilization have been presented using microfluidic devices. Although these devices allow for high-resolution imaging, the animal is fully encased in polydimethylsiloxane (PDMS) and glass, limiting physical access for delivery of mechanical force or electrophysiological recordings. Recently, we created a device that integrates pneumatic actuators with a trapping design that is compatible with high-resolution fluorescence microscopy. The actuation channel is separated from the worm-trapping channel by a thin PDMS diaphragm. This diaphragm is deflected into the side of a worm by applying pressure from an external source. The device can target individual mechanosensitive neurons. The activation of these neurons is imaged at high-resolution with genetically-encoded calcium indicators. This article presents the general method using C. elegans strains expressing calcium-sensitive activity indicator (GCaMP6s) in their touch receptor neurons (TRNs). The method, however, is not limited to TRNs nor to calcium sensors as a probe, but can be expanded to other mechanically-sensitive cells or sensors.

Using a Microfluidics Device for Mechanical Stimulation and High Resolution Imaging of C. elegans

New tools for mechanobiology research are needed to understand how mechanical stress activates biochemical pathways and elicits biological responses. Here, we showcase a new method for selective mechanical stimulation of immobilized animals with a microfluidic trap allowing high-resolution imaging of cellular responses.

One central goal of mechanobiology is to understand the reciprocal effect of mechanical stress on proteins and cells. Despite its importance, the ...

Assessment of Acute Wound Healing using the Dorsal Subcutaneous Polyvinyl Alcohol Sponge Implantation and Excisional Tail Skin Wound Models.

Wound healing is a complex process that requires the orderly progression of inflammation, granulation tissue formation, fibrosis, and resolution. Murine models provide valuable mechanistic insight into these processes; however, no single model fully addresses all aspects of the wound healing response. Instead, it is ideal to use multiple models to address the different aspects of wound healing. Here, two different methods that address diverse aspects of the wound healing response are described. In the first model, polyvinyl alcohol sponges are subcutaneously implanted along the mouse dorsum. Following sponge retrieval, cells can be isolated by mechanical disruption, and fluids can be extracted by centrifugation, thus allowing for a detailed characterization of cellular and cytokine responses in the acute wound environment. A limitation of this model is the inability to assess the rate of wound closure. For this, a tail skin excision model is utilized. In this model, a 10 mm x 3 mm rectangular piece of tail skin is excised along the dorsal surface, near the base of the tail. This model can be easily photographed for planimetric analysis to determine healing rates and can be excised for histological analysis. Both described methods can be utilized in genetically altered mouse strains, or in conjunction with models of comorbid conditions, such as diabetes, aging, or secondary infection, in order to elucidate wound healing mechanisms.

Here, two murine wound healing models are described, one designed to assess cellular and cytokine wound healing responses and the other to quantify the rate of wound closure. These methods can be used with complex disease models such as diabetes to determine mechanisms of various aspects of poor wound healing.

Wound healing is a complex process that requires the orderly progression of inflammation, granulation tissue formation, fibrosis, and resolution. Murine ...

Immunology and Infection

Scratch Migration Assay and Dorsal Skinfold Chamber for In Vitro and In Vivo Analysis of Wound Healing

Impaired cutaneous wound healing is a major concern for patients suffering from diabetes and for elderly people, and there is a need for an effective treatment. Appropriate in vitro and in vivo approaches are essential for the identification of new target molecules for drug treatments to improve the skin wound healing process. We identified the &#946;3 subunit of voltage-gated calcium channels (Cav&#946;3) as a potential target molecule to influence the wound healing in two independent assays, i.e., the in vitro scratch migration assay and the in vivo dorsal skinfold chamber model. Primary mouse embryonic fibroblasts (MEFs) acutely isolated from wild-type (WT) and Cav&#946;3-deficient mice (Cav&#946;3 KO) or fibroblasts acutely isolated from WT mice treated with siRNA to down-regulate the expression of the Cacnb3 gene, encoding Cav&#946;3, were used. A scratch was applied on a confluent cell monolayer and the gap closure was followed by taking microscopic images at defined time points until complete repopulation of the gap by the migrating cells. These images were analyzed, and the cell migration rate was determined for each condition. In an in vivo assay, we implanted a dorsal skinfold chamber on WT and Cav&#946;3 KO mice, applied a defined circular wound of 2 mm diameter, covered the wound with a glass coverslip to protect it from infections and desiccation, and monitored the macroscopic wound closure over time. Wound closure was significantly faster in Cacnb3-gene-deficient mice. Because the results of the in vivo and the in vitro assays correlate well, the in vitro assay may be useful for the high-throughput screening before validating the in vitro hits by the in vivo wound healing model. What we have shown here for wild-type and Cav&#946;3-deficient mice or cells might also be applicable for specific molecules other than Cav&#946;3.

Here, we present a protocol for an in vitro scratch assay using primary fibroblasts and for an in vivo skin wound healing assay in mice. Both assays are straightforward methods to assess in vitro and in vivo wound healing.

Impaired cutaneous wound healing is a major concern for patients suffering from diabetes and for elderly people, and there is a need for an effective ...

Medicine

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed under anoxia for 20 hr&#160;(simulated ischemia), and subsequently moved to a normal atmosphere with food (simulated reperfusion). This experimental paradigm results in increased death and neuronal damage, and techniques are presented to assess organism viability, alterations to the morphology of touch neuron processes, as well as touch sensitivity, which represents the behavioral output of neuronal function. Finally, a method for constructing hypoxic incubators using common kitchen storage containers is described. The addition of a mass flow control unit allows for alterations to be made to the gas mixture in the custom incubators, and a circulating water bath allows for both temperature control and makes it easy to identify leaks. This method provides a low cost alternative to commercially available units.

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

A protocol is described that uses anoxia/starvation in C. elegans to model ischemia/reperfusion. Functional outcomes include increased mortality, visible abnormalities in GFP-labeled neuronal processes, and impaired behavioral responses that require neuronal function.

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed ...

Characterizing Epithelial Wound Healing In Vivo Using the Cnidarian Model Organism Clytia hemisphaerica

All animal organs, from the skin to eyes to intestines, are covered with sheets of epithelial cells that allow them to maintain homeostasis while protecting them from infection. Therefore, it is not surprising that the ability to repair epithelial wounds is critical to all metazoans. Epithelial wound healing in vertebrates involves overlapping processes, including inflammatory responses, vascularization, and re-epithelialization. Regulation of these processes involves complex interactions between epithelial cells, neighboring cells, and the extracellular matrix (ECM); the ECM contains structural proteins, regulatory proteins, and active small molecules. This complexity, together with the fact that most animals have opaque tissues and inaccessible ECMs, makes wound healing difficult to study in live animals. Much work on epithelial wound healing is therefore performed in tissue culture systems, with a single epithelial cell-type plated as a monolayer on an artificial matrix. Clytia hemisphaerica (Clytia) provides a unique and exciting complement to these studies, allowing epithelial wound healing to be studied in an intact animal with an authentic ECM. The ectodermal epithelium of Clytia is a single layer of large squamous epithelial cells, allowing high-resolution imaging using differential interfering contrast (DIC) microscopy in living animals. The absence of migratory fibroblasts, vasculature, or inflammatory responses makes it possible to dissect the critical events in re-epithelialization in vivo. The healing of various types of wounds can be analyzed, including single-cell microwounds, small and large epithelial wounds, and wounds that damage the basement membrane. Lamellipodia formation, purse string contraction, cell stretching, and collective cell migration can all be observed in this system. Furthermore, pharmacological agents can be introduced via the ECM to modify cell:ECM interactions and cellular processes in vivo. This work shows methods for creating wounds in live Clytia, capturing movies of healing, and probing healing mechanisms by microinjecting reagents into the ECM.

Characterizing Epithelial Wound Healing In Vivo Using the Cnidarian Model Organism Clytia hemisphaerica

This paper describes a method to create wounds in the epithelium of a live Clytia hemisphaerica medusa and image wound healing at a high resolution in vivo. Additionally, a technique to introduce dyes and drugs to perturb signaling processes in the epithelial cells and extracellular matrix during wound healing is presented.

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video