Needle wounding methods for C. elegans were first developed by Nathalie Pujol and Jonathan Ewbank; we thank Nathalie Pujol for comments on the manuscript. Work in our laboratory on C. elegans epidermal wound repair is supported by a grant from the NIH to A.D.C. (R01 GM054657).

Los siguientes protocolos describen el procedimiento detallado para C. piel elegans hiriendo y para analizar las respuestas de la herida. 1. Aguja hiriente 3,4 <ol><li> Crecer gusanos unstarved saludables en placas con E. estándar NGM (medio de crecimiento de nematodos) bacterias coli OP50 como alimentos, mantenidos en una incubadora a 20 °. NOTA: Los métodos para placas de agar NGM y el cultivo de rutina de C. elegans se puede encontrar en www.wormbook.org 6. </li><li> Escoja 25 L4 etapa gusanos a un recién sembrado placa 1 día antes de herir y de la cultura a 20 ° CO / N. </li><li> Antes de herir, tire agujas de los capilares utilizando un extractor de aguja. Las agujas utilizadas en la herida son idénticos a los utilizados para la microinyección de C. elegans. </li><li> Asegúrese de que todos los gusanos están en etapa adulta joven. Colocar la placa de gusanos en hielo durante aproximadamente 30 min. El enfriamiento provoca que los animales sean lentos, facilitando heridas aguja. <br /&gt; NOTA: A 5 minutos de la salida de los hielos, los gusanos comenzarán a moverse con normalidad. Es posible, pero difícil de la herida gusanos en movimiento. Con la experiencia, 5 min es suficiente tiempo para heridas 25 gusanos. Inmovilizar con fármacos como el levamisol (como se usa en heridas láser, ver más abajo), aunque los animales tardan más en recuperarse. </li><li> Retire la placa de agar del hielo a un microscopio estereoscópico de disección. Usando una selección gusano, mover 25 gusanos en el centro de la placa de agar. </li><li> Coloque la aguja en una punta de pipeta 100 l para mantener más fácilmente la aguja. Perforar la parte anterior o posterior del cuerpo del gusano con la aguja, evitando la gónada. En general, tratar de la herida entre la faringe posterior y anterior de las gónadas, o entre la gónada posterior y el recto. Reutilice las agujas muchas veces, hasta que se rompen. NOTA: Asegúrese de que las heridas son breves, pinchazos suaves que perforan la cutícula y la piel, penetrando ~ 5-10 micras en el animal. La aguja debe entrar en el animal aproximadamente a un ángulo recto a la piel. Las heridas no deben causar daños evidentes a los órganos internos, o ruptura inmediata del cuerpo. Observar una pequeña cantidad de citoplasma que rezuma durante unos segundos después de la herida; Sin embargo, si el contenido celular de fugas a lo largo de un tiempo prolongado los animales no sobrevivirán. Para imágenes óptima, la herida del sincitio lateral epidérmico (hyp7) o la costura lateral. Nota: Este procedimiento incluye el uso de una aguja de cristal. </li><li> Permitir que los gusanos se recuperen a TA entonces la cultura a 20 ° C. Juzgar el éxito de la herida de la aguja por una serie de ensayos descritos a continuación. Más del 95% de los animales de tipo salvaje sobrevive 24 horas después de la aguja hiriendo en la etapa adulta joven. El efecto de herir en larvas o adultos mayores que aún no ha sido ampliamente analizado. </li></ol> 2. Láser Heridas 3 Utilice la irradiación láser de femtosegundo (800 nm) para realizar las heridas más preciso. <ol><li> Preparar p agaranuncios en un portaobjetos de vidrio derretido con agar al 2% 7. Asegúrese de que las almohadillas son similares a las pastillas de agar utilizados para imágenes en vivo de C. elegans. </li><li> Transfiera 10 gusanos adultos jóvenes en la almohadilla de agarosa con recogida gusano, y añadir una gota 2 l de 12 mM solución Levamisol. Cubra los animales y el líquido con una hoja de la cubierta. Espere 1-2 minutos para que los gusanos paralizan. </li><li> Colocar el portaobjetos en un microscopio confocal de disco giratorio. Mueva el escenario para encontrar los gusanos y se centran en la parte anterior o posterior sincicial epidermis laterales con un objetivo 100X (NA 1,4 a 1,46). </li><li> Ajustar la potencia del láser de femtosegundo a 140 mW (medido antes de que el objetivo). Utilizar el láser de femtosegundos a una velocidad de repetición de 80 MHz. NOTA: Dos pulsos de 200 ms cada uno (separados por 20 ms) son suficientes para herir en nuestras manos. </li><li> Centrarse en la superficie apical de la célula epidérmica y la herida de la epidermis. Observe interrupción local del citoplasma (burbujeo), o o blanqueo localesf cualquier marcador fluorescente usada. NOTA: Siga los procedimientos de seguridad láser apropiadas cuando se utiliza el láser de femtosegundo. Línea o un punto de exploraciones mediante rayos láser de femtosegundos, como los de dos microscopios de fotones deben proporcionar suficiente energía para herir láser. NOTA: Si bien no tenemos experiencia directa de la utilización de otros láseres, en principio herida debe ser posible el uso de láser UV convencionales (como se usa en C. elegans ablaciones celulares). Opcionalmente, utilice un FRAP (FRAP) Módulo de hilado confocal de disco para herir la epidermis (N. Pujol, comunicación personal). </li></ol> 3. Visualización de Respuestas epidérmico Ca 2+ a heridas <ol><li> Utilice transgénico C. elegans cepas que expresan Ca 2+ sensores (tales como los de la serie GCaMP) en la epidermis, bajo el control del promotor específico de epidérmica adulto col-19 (Figura 1A; transgenes se enumeran en <strong&gt; Tabla 1). Utilice un transgén que expresa una proteína fluorescente de color rojo tales como tdTomato como un control interno para el nivel de expresión de los transgenes. NOTA: Hemos utilizado tdTomato como control interno para la expresión transgénica como fluorescencia tdTomato epidérmica es relativamente estable y no interfiere con imágenes GCaMP. </li><li> Tanto la aguja y el láser hiriendo gatillo Ca 2+ elevación en la epidermis. Sin embargo, como la herida de la aguja no se puede realizar fácilmente en un disco giratorio confocal, heridas láser es preferible para el análisis cuantitativo de la Ca 2 + respuesta (Figura 1). </li><li> Adquirir imágenes de lapso de tiempo en el modo de adquisición multidimensional (tiempo de intervalo de 2 segundos con 114 ms exposición láser de excitación) utilizando un confocal hilado disco con objetivo de 100X (NA 1,4 a 1,46) y conjuntos de filtros adecuados (filtros GFP trabajarán para GCaMP3). NOTA: Adquirir imágenes de lapso de tiempo cada 30 segundos durante aproximadamente 2 horas para examinar el Ca 2+ respOnse a hiriendo a más de un curso de tiempo más largo. </li><li> El uso de software de análisis de imágenes medir la fluorescencia media GCaMP en diez regiones equivalentes de interés (ROI), cinco de los cuales se centran en el citoplasma de las células epidérmicas y cinco en el fondo. </li><li> Obtener la fluorescencia de línea de base (F 0) por un promedio de fluorescencia en 5 ROIs en la epidermis luego restando la media de 5 ROIs en el fondo antes de la lesión. Expresar el cambio en la fluorescencia Delta F como la relación de cambio con respecto a la línea de base [(F t -F 0) / F 0]. </li></ol> 4. Visualización de Dynamics F-actina después de la herida <ol><li> NOTA: En respuesta a heridas de la aguja, observar un anillo de actina en el sitio de la herida que se cierra poco a poco alrededor de la herida. Esta sección protocolo ensayos de cierre de la herida mediante la medición del diámetro del anillo de actina. </li><li> Generar gusanos transgénicos que expresan un marcador de F-actina como el dominio de unión a actina moesina Drosophila fusionado aGFP, expresa bajo el control de un promotor específico epidérmico tales como col-19 (Figura 2A) (transgén juIs352). NOTA: Hemos obtenido resultados similares utilizando otros marcadores vinculante de dominio como Lifeact o F-tractin (resultados no publicados) actina. </li><li> Realizar aguja hiriendo en P col-19- gusanos transgénicos-GFP moesina. Después de las heridas de aguja, observar un anillo de GFP-moesina alrededor del sitio de la herida por ~ 5 min. El anillo de actina se hace más pequeño en diámetro y, finalmente, se cierra 2-3 h después de heridas en animales de tipo salvaje (Figura 2a). </li><li> Preparar una almohadilla de agar 2% en un portaobjetos de vidrio y transferir 10 gusanos en la almohadilla en 2 l solución 12 mM Levamisol. Imagen de los anillos de GFP-Moesin 1 hora después de la herida mediante microscopía confocal convencional. NOTA: El uso de microscopía confocal para adquirir z-pilas (13 x 0,5 m) de los anillos de actina 1 hora después de la herida. </li><li> Mida el diámetro del anillo de actina después de la herida. Para cuantificar epidérmica GFP-moesina, primero hacer una proyección de máxima intensidad de la z-pila y luego dibujar 4 exploraciones de línea (a 45 ° entre sí) sobre el anillo de GFP-moesina. Diámetro del anillo se define como la distancia media de pico pico de las cuatro exploraciones de línea (Figura 2B). Para anillos que ya han cerrado, el diámetro se define como 0 m. NOTA: F-actina anillos se miden convenientemente 1 h después de herir, ya que es aproximadamente la mitad del proceso de cierre de la herida en el tipo silvestre. Anillos de F-actina se pueden medir también en varios puntos de tiempo para derivar un transcurso de tiempo de cierre de la herida. Tiempo películas de lapso de cierre de la herida pueden ser adquiridos usando gusanos levamisol inmovilizada y girando microscopía confocal de disco. </li></ol> 5. ensayo de inducción de péptidos antimicrobianos epidérmicas NOTA: Heridas también desencadena la respuesta inmune innata en la C. piel elegans. La transcripción de los genes que codifican péptidos antimicrobianos (AMP) es induced en la epidermis. La PNL-29 (proteína-neuropéptido similares) AMP está fuertemente inducida por hiriendo a 4. Para ensayar cómo la epidermis controla la expresión AMP después de la herida, utilizar reporteros transgénicos o PCR en tiempo real para detectar los niveles individuales de transcripción AMP. <ol><li> Reportero de ensayo transgénico para la respuesta inmune innata a hiriendo a 4. </li><li> Realizar la herida de la aguja (como en el protocolo 1) en los animales adultos que expresan el reportero transgénico frIs7, que contiene P PNL-29- GFP y col P-12 DsRed como un control interno. Observar los animales adultos no heridos rojos tan oscuro o naranja en un filtro de paso largo GFP. NOTA: Herir gusanos de tipo salvaje inducirán P PNL-29-GFP expresión, pero no afectarán P col-12 -dsRed, resultando en gusanos que aparecen de color naranja, amarillo o verde bajo GFP iluminación pase largo. Pérdida de la función de genes en la vía MAPK p38, tales como PMK-1 o NSY-1 bloqueará PNL-29-GFPinducción después de herir 4. GFP P PNL-29- se expresa en altos niveles en los estadios larvarios </li><li> Realizar ensayos de inducción de AMP en animales adultos jóvenes. Asegúrese de que los animales de control no heridos tienen bajos niveles de las buenas prácticas agrarias. NOTA: P PNL-29- expresión de GFP también es inducida por estrés osmótico 8, y puede ser sensible a otras tensiones ambientales. </li><li> 6 horas después de la herida, la puntuación de los números de gusanos que tienen P PNL-29-GFP inducción (Figura 3) 9 utilizando una fluorescencia de disección alcance con filtro de paso largo GFP. NOTA: En 1 hora después de la herida P PNL-29- GFP se induce visiblemente, alcanzando un pico de aproximadamente 6 horas después de la herida y luego permanecer elevada hasta después de la curación 24 hr. Cuantificar la expresión de un 4,9 de puntuación visual. Alternativamente, cuantificar los niveles de expresión utilizando una fluorescencia activada gusano clasificador 4. Para el clasificador de gusano, al menos 50 animales necesitan ser heridos. </li><li> Ensayo de PCR en tiempo real para quantitating niveles de transcripción de los genes AMP individuales. Niveles de transcripción de ensayo para varios genes: PNL-29, PNL-30, cnc-1, y cnc-5. </li><li> Realizar aguja hiriendo en de tipo salvaje o gusanos mutantes (véase el protocolo 1) </li><li> Recoge 50 gusanos heridos y 50 gusanos no heridos en los tiempos deseados (por ejemplo, 3, 6, 24 horas) después de la herida. </li><li> Extracto de ARN utilizando un kit comercial siguiendo las instrucciones del fabricante. </li><li> Realizar la transcripción inversa para obtener cDNA total de 20 l usando un kit comercial de la transcriptasa inversa. </li><li> Para RT-PCR, utilice 0,2 l de cDNA (1/40) de cada muestra en combinación con un Supermix verde con fluoresceína y 0,2 mM cebadores. Para comparar la calidad del ARN, utilice ama-1 o snb-1 RT-PCR como referencia; comparar el nivel de expresión relativa AMP mediante la normalización de control interno (ama-1 o snb-1), o comparar veces de inducción después de la herida (AMP inducción en gusanos heridos / gusanos no heridos) por normaalizing al control interno. NOTA: cnc-1 y cnc-5 se caenacin familiares péptidos antimicrobianos cuya transcripción se activa por hiriendo a 10. Típicamente, la herida de la aguja induce la expresión (~ 500 veces para CNC-1) durante un transcurso de tiempo de 4 h 10. Los cebadores utilizados en los trabajos publicados se enumeran en la Tabla 2. </li></ol> 6. Ensayo de supervivencia después de la herida <ol><li> NOTA: Heridas activa al menos dos vías de señalización independientes de la epidermis: la herida dependen de la vía Ca 2+ reparación y la ruta de respuesta inmune innata. Se requieren ambas vías para la supervivencia lleno de heridas estéril. Para probar si un mutante o tratamiento RNAi afecta a la curación de heridas, la supervivencia a medir después de la curación de 24-48 hr. Opcionalmente, utilice ensayos de vida útil convencionales para determinar el efecto de herir en la longevidad 4,9. </li><li> Realizar aguja hiriendo al joven adulto (L4 + 24 hr) gusanos (50 gusanos, repita seveveces ral) siguiendo el protocolo 1 anterior. Mantener un número equivalente de gusanos ilesos como controles. </li><li> Compruebe la supervivencia cada 24 horas (de transferencia gusanos heridos a una nueva placa de agar cada 24 horas). Observe ~ 50% de supervivencia a las 24 horas después de la herida en los mutantes que son defectuosos en la reparación de heridas, como GTL-2 o tir-1, cuando se normalizaron a los animales de control no heridos. La muerte se define como la falta de respuesta locomotora a tocar por selección gusano. </li></ol>

<ol>
	<li>Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair+and+regeneration.">Wound repair and regeneration.</a> Nature. 453, 314-321 (2008).</li><li>Sonnemann, K. J., Bement, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair:+toward+understanding+and+integration+of+single-cell+and+multicellular+wound+responses.">Wound repair: toward understanding and integration of single-cell and multicellular wound responses.</a> Annu Rev Cell Dev Biol. 27, 237-263 (2011).</li><li>Xu, S., Chisholm, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+G&#945;q-Ca2++signaling+pathway+promotes+actin-mediated+epidermal+wound+closure+in+C.+elegans.">A G&#945;q-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.</a> Curr Biol. 21, 1960-1967 (2011).</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+innate+immune+responses+to+infection+and+wounding+in+the+C.+elegans+epidermis.">Distinct innate immune responses to infection and wounding in the C. elegans epidermis.</a> Curr Biol. 18, 481-489 (2008).</li><li>Chisholm, A. D., Xu, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Caenorhabditis+elegans+epidermis+as+a+model+skin.+II:+differentiation+and+physiological+roles.">The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles.</a> Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook : the online review of C. elegans biology. , 1-11 .</li><li>Bargmann, C. I., Avery, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+killing+of+cells+in+Caenorhabditis+elegans.+Methods+in+cell+biology.">Laser killing of cells in Caenorhabditis elegans. Methods in cell biology.</a> 48, 225-250 .</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-fungal+innate+immunity+in+C.+elegans+is+enhanced+by+evolutionary+diversification+of+antimicrobial+peptides.">Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides.</a> PLoS Pathog. 4, (2008).</li><li>Tong, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+regulation+of+Caenorhabditis+elegans+epidermal+damage+responses+by+death-associated+protein+kinase.">Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase.</a> Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).</li><li>Zugasti, O., Ewbank, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroimmune+regulation+of+antimicrobial+peptide+expression+by+a+noncanonical+TGF-beta+signaling+pathway+in+Caenorhabditis+elegans+epidermis.">Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis.</a> Nat Immunol. 10, 249-256 (2009).</li><li>Zhao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip-based+C.+elegans+microinjection+system+for+investigating+cell-cell+communication+in+vivo.">Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo.</a> Biosensor., &amp; Bioelectronics. 50, 28-34 (2013).</li><li>Jansson, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adhesion+of+Conidia+of+Drechmeria+coniospora+to+Caenorhabditis+elegans+Wild+Type+and+Mutants.">Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants.</a> J Nematol. 26, 430-435 (1994).</li><li>Hodgkin, J., Kuwabara, P. E., Corneliussen, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+bacterial+pathogen,+Microbacterium+nematophilum,+induces+morphological+change+in+the+nematode+C.+elegans.">A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans.</a> Curr Biol. 10, 1615-1618 (2000).</li><li>Hochbaum, D., Ferguson, A. A., Fisher, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+C.+elegans+by+biolistic+transformation.">Generation of transgenic C. elegans by biolistic transformation.</a> J Vis Exp. (42), (2010).</li><li>Hashmi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+nematodes+using+arrays+of+micromechanical+piercing+structures.">Genetic transformation of nematodes using arrays of micromechanical piercing structures.</a> BioTechniques. 19, 766-770 (1995).</li></ol>

The authors are not aware of any competing interests.

Los métodos presentados aquí por aguja y lesiones láser ofrecen enfoques complementarios para evaluar la capacidad del epitelio epidérmico para reparar los daños. Herida láser es relativamente localizado y (dependiendo de la configuración del láser) puede limitarse a la epidermis, mientras que la herida de la aguja interrumpe la epidermis, la cutícula, y membranas basales internos probables. Heridas de aguja puede parecerse más precisión las heridas infligidas por agentes patógenos o daños mecánicos en el medio natural. Como regla general, la herida de la aguja requiere más práctica para lograr heridas precisas que son compatibles con la supervivencia animal. Las respuestas celulares a agujas y visualización heridas láser muchas similitudes. Sin embargo hay que señalar que la formación de anillos de actina no se observa de forma reproducible después de la herida láser de femtosegundo. Una limitación de punción de la aguja es que no es una herida precisa: la aguja también daña los tejidos internos cuyas contribuciones al gusanosupervivencia no han sido investigados. Una posible modificación de este protocolo sería combinar el sistema de microinyección basado en microfluidos 11 y los reporteros fluorescentes para realizar herida física más precisa. Los métodos hirientes agujas y láser se detallan aquí son sencillas pero bastante mano de obra, y en el mejor de mediano rendimiento, por lo que es difícil de usar enfoques genómicos o bioquímicas para la caracterización de la respuesta de la herida. Cutícula penetrante patógenos como hongos o protozoos 12,13 pueden ser entregados a las poblaciones más grandes de animales, y pueden desencadenar respuestas que se superponen con la respuesta a heridas, sin embargo, introducir complejidades adicionales de respuestas específicas de patógenos. Se requiere trabajo adicional para explorar si otros métodos abióticos como el bombardeo balístico 14 o arrays de estructuras de perforación micromecánicas 15 pueden adaptarse para herir a gran escala.

Mecanismos de curación de heridas en la piel son de interés biológico básico y relevante para la salud humana. La cicatrización de heridas en los vertebrados y mamíferos comprende una compleja serie de respuestas coordinadas de múltiples tejidos y de señalización 1. Muchos simples organismos modelo genético también son capaces de curar las heridas de la piel 2. Por tanto, es de interés analizar modelos genéticamente tratables de la reparación de heridas de la piel. Nosotros y otros han comenzado a utilizar Caenorhabditis elegans como nuevo modelo para la curación de heridas de la piel 3,4. El objetivo de este protocolo es permitir a un conjunto más amplio de investigadores de utilizar C. elegans como una herramienta para investigar los mecanismos moleculares y celulares de la epidermis cicatrización de la herida. El C. piel elegans comprende la epidermis (también conocidos como hipodermis) y la cutícula extracelular 5. La epidermis adulto se forman a partir de un pequeño número de sincitios multinucleados, de los cuales el más grande es el sincitio known como hyp7. La epidermis es un epitelio simple que segrega la cutícula en su superficie apical. La piel puede defenderse activamente contra los patógenos que penetran en la piel y reparar pequeñas heridas 4. La reparación de heridas de la C. piel elegans es robusta, ya que casi todos los animales de tipo salvaje sobreviven pueden sobrevivir pequeñas heridas punzantes causadas por agujas o daño local de la piel causada por la irradiación láser. C. heridas de la piel elegans desencadena una serie de respuestas, incluyendo una respuesta inmune innata epidérmico, cierre de la herida, y la formación de cicatrices 4. La epidermis adultos es post-mitótico, y cicatrización de heridas implica respuestas celulares locales en oposición a la proliferación epidérmica o la migración celular. Hemos demostrado que las heridas de la piel provoca un aumento grande y sostenido en epidérmica Ca 2+, requiriendo el canal de TRPM membrana GTL-2 e internos Ca 2 + tiendas 3. Se requiere señal El epidérmica Ca 2+ para la formación y el cierre de los anillos F-actina en el wositio und. Heridas también induce la respuesta inmune innata que activan la transcripción de AMPs como PNL-29. La transcripción inducida por heridas de AMP depende de una TIR-1 / PMK-1 p38 MAP quinasa cascada que actúa de forma autónoma en la epidermis 4. Los defectos en cualquiera de la vía de señalización de Ca2 + o en la respuesta inmune innata dará lugar a una menor supervivencia después de la herida. La estructura relativamente simple de la C. elegans epidermis, su maleabilidad genética y ventajas en vivo de imágenes hacen que sea un excelente sistema para estudiar varios aspectos de la reparación de la herida. Aquí presentamos los protocolos para los dos métodos comunes de heridas: las heridas de aguja y lesiones láser. Herida de la aguja no requiere equipo especializado (que no sea el extractor de aguja), y con la experiencia se puede realizar en cientos de gusanos por día. Heridas de aguja se realiza en animales en crecimiento en placas de agar. Por el contrario, las heridas de láser se realiza en Anesanimales anestesiados montados en agar almohadillas bajo un cubreobjetos, y es adecuado para imágenes en vivo de las respuestas celulares a los daños.

<table border="0" cellpadding="0" cellspacing="0" width="908">
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Name</td>
			<td style="width:227px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:227px;">Comments</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Agarose</td>
			<td style="width:227px;">Denville Scientific</td>
			<td style="width:227px;">CA3510-8</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Plastic Petri plate</td>
			<td style="width:227px;">Tritech Research</td>
			<td style="width:227px;">T3308</td>
			<td style="width:227px;">60 mm</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Levamisole</td>
			<td style="width:227px;">Sigma</td>
			<td style="width:227px;">L9756</td>
			<td style="width:227px;">12 mM</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;"><a name="RANGE!A5">Borosilicate Glass Capillary&#160;</a></td>
			<td style="width:227px;">World Precision Instruments</td>
			<td style="width:227px;">1B100F-4</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Needle puller</td>
			<td style="width:227px;">Sutter Instrument&#160;</td>
			<td style="width:227px;">P-2000</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Worm pick (Platinum wire)</td>
			<td style="width:227px;">Tritech Research</td>
			<td style="width:227px;">PT-9010</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="86">
			<td height="86" style="height:87px;width:227px;">M9 solution</td>
			<td style="width:227px;">Home-made</td>
			<td colspan="2" style="width:453px;">3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 litre. Sterilize by autoclaving</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Trizol</td>
			<td style="width:227px;">Invitrogen</td>
			<td align="right" style="width:227px;">15596026</td>
			<td style="width:227px;">Use 500 ml for 50 worms</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">iQ SYBR Green</td>
			<td style="width:227px;">Bio-Rad</td>
			<td align="right" style="width:227px;">1708882</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">SuperScript III</td>
			<td style="width:227px;">Invitrogen</td>
			<td style="width:227px;">18080-051</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">PCR machine</td>
			<td style="width:227px;">Bio-Rad</td>
			<td style="width:227px;">C1000/CFX96</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">96-well PCR tubes</td>
			<td style="width:227px;">Bio-Rad</td>
			<td style="width:227px;">MLL9601</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:227px;">Image analysis software</td>
			<td style="width:227px;">Molecular Devices</td>
			<td style="width:227px;">Metamorph</td>
			<td style="width:227px;"></td>
		</tr>
	</tbody>
</table>

methods for skin wounding and assays for wound responses in c. elegans

El C. elegans epidermis y cutícula forman una sencilla capa de piel y sofisticado que puede reparar daños localizados resultante de la herida. Los estudios de las respuestas de la herida y la reparación en este modelo han iluminado nuestro entendimiento del citoesqueleto y respuestas genómicas a daños en los tejidos. Los dos métodos más comúnmente utilizados para lesionar al C. elegans piel del adulto son pinchazos con agujas de microinyección y la irradiación láser local. Aguja hiriendo localmente altera la cutícula, la epidermis, y la matriz extracelular asociada, y también puede dañar los tejidos internos. Resultados de irradiación láser en daños más localizado. Heridas desencadena una sucesión de respuestas ensayadas fácilmente incluyendo elevada epidérmica Ca 2+ (segundo minutos), la formación y el cierre de un anillo que contiene actina en el sitio de la herida (1-2 horas), elevado transcripción de genes de péptidos antimicrobianos (2-24 hr), y la formación de cicatrices. Esencialmente, todos los animales adultos silvestres sobreviven herida, dondecomo mutantes defectuosos en la reparación de heridas u otras respuestas muestran una menor supervivencia. Se presentan los protocolos detallados de aguja y las heridas de láser, y ensayos para la cuantificación y visualización de las respuestas de la herida y los procesos de reparación (dinámica de Ca, la dinámica de actina, la inducción péptido antimicrobiano y supervivencia).

Láser o heridas aguja activarán elevación rápida y sostenida de los niveles de Ca epidérmicas, como se visualiza con sensores de Ca como GCaMPs (Figura 1). La elevación Ca se produce en cuestión de segundos, y sigue siendo elevado durante decenas de minutos. Aguja hiriendo reproducible resulta en la formación de anillos de F-actina en los sitios de la herida (Figura 2); éstos aparecen en cuestión de minutos, y poco a poco cerca sobre 1-2 horas después de la herida. Anillos de actina se forman con menos frecuencia después de herir láser más preciso. Tanto la aguja y el láser de heridas epidérmicas inducir la expresión de péptidos antimicrobianos (AMP), tales como PNL-29, detectados con los reporteros transcripcionales (Figura 3). AMP inducción es evidente dentro de 2-4 horas después de la herida y tiene una duración de aproximadamente 24 horas. Herida de la aguja de la de tipo salvaje no debería afectar significativamente la viabilidad (medido a las 24 h después de la herida) o tiempo de vida. <img alt="Figura 1" src="/files/ftp_upload/51959/51959fig1highres.jpg" /> Figura 1. heridas Laser desencadena una respuesta de Ca2 + en el C. epidermis elegans. (A) epidérmico GCaMP3 fluorescencia (P col-19 -GCaMP3 (juIs319)) niveles después de herir láser de femtosegundo. Vista lateral de la epidermis en antero-cuerpo; x, herida láser; N, núcleo epidérmica. Spinning confocal de imágenes de disco, código intensidad. UW: no herido, W:. Heridos (B) Cuantificación de GCaMP3? F / F 0 a 20, 40 y 60 micras en el sitio de la herida; rastro representante. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51959/51959fig1large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/51959/51959fig2highres.jpg" /> Figura 2. Aguja heridas desencadena la polimerización de actina alrededor del sitio de la herida. (A) </strong&gt; heridas de agujas epidérmicos desencadenan la formación de anillos de actina en el borde de la herida, visualizadas con P col-19- GFP-moesina (juIs352). Escala: 10 micras. UW: no herido, W:.. Heridos (B) Cuantificación de diámetro del anillo de actina de las exploraciones de línea, 4 exploraciones de línea por animal (líneas de puntos rojos en el panel (A), WT) <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51959/51959fig2large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/51959/51959fig3highres.jpg" /> Figura 3. epidérmico heridas activa la respuesta inmune innata. Imágenes representativas (WT ileso, WT herido + 3 h) de P PNL-29-GFP (frIs7) inducción después de herir aguja. Escala:. 200 m <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51959/51959fig3large.jpg" target="_blank">Haga clic aquí para ver una</a>versión más grande de esta cifra. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Reportero </td><td> Transgén </td><td> Fluorescencia </td><td> Alelo </td></tr><tr><td> Calcio </td><td> PCOL-19-GCaMP3; PCOL-19-tdTomato </td><td> GFP / tdTomato </td><td> juIs319 X </td></tr><tr><td> La actina </td><td> -19 PCOL-GFP :: moesina </td><td> GFP </td><td> juIs352 I </td></tr><tr><td> PNL-29 </td><td> PNLP-29-GFP / PCOL-12-DsRed </td><td> GFP / DsRed </td><td> frIs7 IV </td></tr></tbody></table> Tabla 1. Los transgenes usados ​​en ensayos de respuesta de la herida. Esta tabla muestra los transgenes disponibles en el Centro de Genética Caenorhabditis (http://www.cbs.umn.edu/research/resources/cgc) cromosómicamente integrado. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gen </td><td> Secuencia </td></tr><tr><td> PNL-29 </td><td> F: cttctcgcctgcttcatggc </td></tr><tr><td> R: gtccgtatccaccatatcctcc </td></tr><tr><td> PNL-30 </td><td> F: TTCTTCTCGCCTGCTTCATGG </td></tr><tr><td> R: CATAACCTCTACCATATCCACCG </td></tr><tr><td> cnc-1 </td><td> F: gccattgtcgccatttcctc </td></tr><tr><td> R: cctccatacattggatatcctc </td></tr><tr><td> cnc-5 </td><td> F: CTTCTTCTAGCAATGCTCGCTC </td></tr><tr><td> R: GTATCCTCCACCATACCCTCC </td></tr><tr><td> ama-1 </td><td> F: ACTCAGATGACACTCAACAC </td></tr><tr><td> R: GAATACAGTCAACGACGGAG </td></tr><tr><td> SNB-1 </td><td> F: tccagcagacacaagctcagg </td></tr><tr><td> R: gagacaacttctgatcacgctc </td></tr></tbody></table> Tabla 2. Los cebadores utilizados para la RT-PCR de los transcritos de amplificador. La concentración de trabajo es de 0,2 M. Snb-1 sirve como control interno.

Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity.

Los métodos para la piel Heridas y ensayos para Respuestas de heridas en<em&gt; C. elegans</em

The C. elegans epidermis and cuticle form a simple yet sophisticated skin layer that can repair localized damage resulting from wounding. Studies of wound ...

methods-for-skin-wounding-and-assays-for-wound-responses-in-c-elegans

Nanyang Technological University

Research

JoVE Journal

Biology

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

10.3K vistas.  University of California, San Diego. The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity. 

Video: Methods for Skin Wounding and Assays for Wound Responses in C. elegans

Paradigms for Pharmacological Characterization of C. elegans Synaptic Transmission Mutants

The nematode, Caenorhabditis elegans, has become an expedient model for studying neurotransmission. C. elegans is unique among animal models, as the anatomy and connectivity of its nervous system has been determined from electron micrographs and refined by pharmacological assays. In this video, we describe how two complementary neural stimulants, an acetylcholinesterase inhibitor, called aldicarb, and a gamma-aminobutyric acid (GABA) receptor antagonist, called pentylenetetrazole (PTZ), may be employed to specifically characterize signaling at C. elegans neuromuscular junctions (NMJs) and facilitate our understanding of antagonistic neural circuits.
Of 302 C. elegans neurons, nineteen GABAergic D-type motor neurons innervate body wall muscles (BWMs), while four GABAergic neurons, called RMEs, innervate head muscles. Conversely, thirty-nine motor neurons express the excitatory neurotransmitter, acetylcholine (ACh), and antagonize GABA transmission at BWMs to coordinate locomotion. The antagonistic nature of GABAergic and cholinergic motor neurons at body wall NMJs was initially determined by laser ablation and later buttressed by aldicarb exposure. Acute aldicarb exposure results in a time-course or dose-responsive paralysis in wild-type worms. Yet, loss of excitatory ACh transmission confers resistance to aldicarb, as less ACh accumulates at worm NMJs, leading to less stimulation of BWMs. Resistance to aldicarb may be observed with ACh-specific or general synaptic function mutants. Consistent with antagonistic GABA and ACh transmission, loss of GABA transmission, or a failure to negatively regulate ACh release, confers hypersensitivity to aldicarb. Although aldicarb exposure has led to the isolation of numerous worm homologs of neurotransmission genes, aldicarb exposure alone cannot efficiently determine prevailing roles for genes and pathways in specific C. elegans motor neurons. For this purpose, we have introduced a complementary experimental approach, which uses PTZ.
Neurotransmission mutants display clear phenotypes, distinct from aldicarb-induced paralysis, in response to PTZ. Wild-type worms, as well as mutants with specific inabilities to release or receive ACh, do not show apparent sensitivity to PTZ. However, GABA mutants, as well as general synaptic function mutants, display anterior convulsions in a time-course or dose-responsive manner. Mutants that cannot negatively regulate general neurotransmitter release and, thus, secrete excessive amounts of ACh onto BWMs, become paralyzed on PTZ. The PTZ-induced phenotypes of discrete mutant classes indicate that a complementary approach with aldicarb and PTZ exposure paradigms in C. elegans may accelerate our understanding of neurotransmission. Moreover, videos demonstrating how we perform pharmacological assays should establish consistent methods for C. elegans research.

This video demonstrates how to employ two neural stimulants, aldicarb and pentylenetetrazole (PTZ), in complementary ways to study synaptic function in the nematode, C. elegans. This complementary approach may also be used to shed light on evolutionarily conserved mechanisms for modulating neuronal synchrony and has implications for epilepsy and seizures.

Paradigmas para la caracterización farmacológica de C. elegans mutantes transmisión sináptica

The nematode, Caenorhabditis elegans, has become an expedient model for studying neurotransmission. C. elegans is unique among animal models, as the ...

Investigación

Biología

Neurocircuit Assays for Seizures in Epilepsy Mutants of Drosophila

Drosophila melanogaster is a useful tool for studying seizure like activity. A variety of mutants in which seizures can be induced through either physical shock or electrical stimulation is available for study of various aspects of seizure activity and behavior. All flies, including wild-type, will undergo seizure-like activity if stimulated at a high enough voltage. Seizure like activity is an all-or-nothing response and each genotype has a specific seizure threshold. The seizure threshold of a specific genotype of fly can be altered either by treatment with a drug or by genetic suppression or enhancement. The threshold is easily measured by electrophysiology. Seizure-like activity can be induced via high frequency electrical stimulation delivered directly to the brain and recorded through the dorsal longitudinal muscles (DLMs) in the thorax. The DLMs are innervated by part of the giant fiber system. Starting with low voltage, high frequency stimulation, and subsequently raising the voltage in small increments, the seizure threshold for a single fly can be measured.

Neurocircuit Assays for Seizures in Epilepsy Mutants of Drosophila

Using high frequency electrical stimulation, seizure-like activity can be induced in Drosophila. This activity is easily recorded from the giant fiber system.

Neurocircuit ensayos para las convulsiones en la epilepsia de los mutantes Drosophila</em

Drosophila melanogaster is a useful tool for studying seizure like activity. A variety of mutants in which seizures can be induced through either physical ...

Analysis of Schwann-astrocyte Interactions Using In Vitro Assays

Schwann cells are one of the commonly used cells in repair strategies following spinal cord injuries. Schwann cells are capable of supporting axonal regeneration and sprouting by secreting growth factors 1,2 and providing growth promoting adhesion molecules 3 and extracellular matrix molecules 4. In addition they myelinate the demyelinated axons at the site of injury 5.
However following transplantation, Schwann cells do not migrate from the site of implant and do not intermingle with the host astrocytes 6,7. This results in formation of a sharp boundary between the Schwann cells and astrocytes, creating an obstacle for growing axons trying to exit the graft back into the host tissue proximally and distally. Astrocytes in contact with Schwann cells also undergo hypertrophy and up-regulate the inhibitory molecules 8-13.
In vitro assays have been used to model Schwann cell-astrocyte interactions and have been important in understanding the mechanism underlying the cellular behaviour.
These in vitro assays include boundary assay, where a co-culture is made using two different cells with each cell type occupying different territories with only a small gap separating the two cell fronts. As the cells divide and migrate, the two cellular fronts get closer to each other and finally collide. This allows the behaviour of the two cellular populations to be analyzed at the boundary. Another variation of the same technique is to mix the two cellular populations in culture and over time the two cell types segregate with Schwann cells clumped together as islands in between astrocytes together creating multiple Schwann-astrocyte boundaries.
The second assay used in studying the interaction of two cell types is the migration assay where cellular movement can be tracked on the surface of the other cell type monolayer 14,15. This assay is commonly known as inverted coverslip assay. Schwann cells are cultured on small glass fragments and they are inverted face down onto the surface of astrocyte monolayers and migration is assessed from the edge of coverslip.
Both assays have been instrumental in studying the underlying mechanisms involved in the cellular exclusion and boundary formation. Some of the molecules identified using these techniques include N-Cadherins 15, Chondroitin Sulphate proteoglycans(CSPGs) 16,17, FGF/Heparin 18, Eph/Ephrins19.
This article intends to describe boundary assay and migration assay in stepwise fashion and elucidate the possible technical problems that might occur.

Analysis of Schwann-astrocyte Interactions Using In Vitro Assays

This article intends to describe in stepwise fashion the commonly used in vitro assays used in studying Schwann cell-asrtocyte interactions.

El análisis de Schwann-astrocito interacciones utilizando In Vitro Ensayos

Schwann cells are one of the commonly used cells in repair strategies following spinal cord injuries. Schwann cells are capable of supporting axonal ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has since been used extensively as a model organism 1. C. elegans possesses key attributes such as simplicity, transparency and short life cycle that have made it a suitable experimental system for fundamental biological studies for many years 2. Discoveries in this nematode have broad implications because many cellular and molecular processes that control animal development are evolutionary conserved 3.
C. elegans life cycle goes through an embryonic stage and four larval stages before animals reach adulthood. Development can take 2 to 4 days depending on the temperature. In each of the stages several characteristic traits can be observed. The knowledge of its complete cell lineage 4,5 together with the deep annotation of its genome turn this nematode into a great model in fields as diverse as the neurobiology 6, aging 7,8, stem cell biology 9 and germ line biology 10. 
An additional feature that makes C. elegans an attractive model to work with is the possibility of obtaining populations of worms synchronized at a specific stage through a relatively easy protocol. The ease of maintaining and propagating this nematode added to the possibility of synchronization provide a powerful tool to obtain large amounts of worms, which can be used for a wide variety of small or high-throughput experiments such as RNAi screens, microarrays, massive sequencing, immunoblot or in situ hybridization, among others. 
Because of its transparency, C. elegans structures can be distinguished under the microscope using Differential Interference Contrast microscopy, also known as Nomarski microscopy. The use of a fluorescent DNA binder, DAPI (4',6-diamidino-2-phenylindole), for instance, can lead to the specific identification and localization of individual cells, as well as subcellular structures/defects associated to them.

Basic Caenorhabditis elegans Methods: Synchronization and Observation

The easiness of maintaining and propagating the nematode C. elegans make it a nice model organism to work with. The possibility of synchronizing worms allows the work with a significant amount of subjects at the same developmental stage, what facilitates the study of one particular process in many animals.

Básico<em&gt; Caenorhabditis elegans</em&gt; Métodos de sincronización y de observación

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Method for Culturing Embryonic C. elegans Cells

C. elegans is a powerful model system, in which genetic and molecular techniques are easily applicable. Until recently though, techniques that require direct access to cells and isolation of specific cell types, could not be applied in C. elegans. This limitation was due to the fact that tissues are confined within a pressurized cuticle which is not easily digested by treatment with enzymes and/or detergents. Based on early pioneer work by Laird Bloom, Christensen and colleagues 1 developed a robust method for culturing C. elegans embryonic cells in large scale. Eggs are isolated from gravid adults by treatment with bleach/NaOH and subsequently treated with chitinase to remove the eggshells. Embryonic cells are then dissociated by manual pipetting and plated onto substrate-covered glass in serum-enriched media. Within 24 hr of isolation cells begin to differentiate by changing morphology and by expressing cell specific markers. C. elegans cells cultured using this method survive for up 2 weeks in vitro and have been used for electrophysiological, immunochemical, and imaging analyses as well as they have been sorted and used for microarray profiling.

A Method for Culturing Embryonic C. elegans Cells

We describe here a revised protocol for large-scale culture of embryonic C. elegans cells. Embryonic C. elegans cells cultured in vitro using this method, appear to differentiate and recapitulate the expression of genes in a cell specific manner. Techniques that require direct access to the cells or isolation of specific cell types from the other tissues can be applied on C. elegans cultured cells.

Un método para cultivar embrionarias<em&gt; C. elegans</em&gt; Células

C. elegans is a powerful model system, in which genetic and molecular techniques are easily applicable. Until recently though, techniques that require ...

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed under anoxia for 20 hr&#160;(simulated ischemia), and subsequently moved to a normal atmosphere with food (simulated reperfusion). This experimental paradigm results in increased death and neuronal damage, and techniques are presented to assess organism viability, alterations to the morphology of touch neuron processes, as well as touch sensitivity, which represents the behavioral output of neuronal function. Finally, a method for constructing hypoxic incubators using common kitchen storage containers is described. The addition of a mass flow control unit allows for alterations to be made to the gas mixture in the custom incubators, and a circulating water bath allows for both temperature control and makes it easy to identify leaks. This method provides a low cost alternative to commercially available units.

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

A protocol is described that uses anoxia/starvation in C. elegans to model ischemia/reperfusion. Functional outcomes include increased mortality, visible abnormalities in GFP-labeled neuronal processes, and impaired behavioral responses that require neuronal function.

Un Modelo Anoxia inanición por isquemia / reperfusión en el<em&gt; C. elegans</em

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed ...

Methods to Assess Subcellular Compartments of Muscle in C. elegans

Muscle is a dynamic tissue that responds to changes in nutrition, exercise, and disease state. The loss of muscle mass and function with disease and age are significant public health burdens. We currently understand little about the genetic regulation of muscle health with disease or age. The nematode C. elegans is an established model for understanding the genomic regulation of biological processes of interest. This worm&#8217;s body wall muscles display a large degree of homology with the muscles of higher metazoan species. Since C. elegans is a transparent organism, the localization of GFP to mitochondria and sarcomeres allows visualization of these structures in vivo. Similarly, feeding animals cationic dyes, which accumulate based on the existence of a mitochondrial membrane potential, allows the assessment of mitochondrial function in vivo. These methods, as well as assessment of muscle protein homeostasis, are combined with assessment of whole animal muscle function, in the form of movement assays, to allow correlation of sub-cellular defects with functional measures of muscle performance. Thus, C. elegans provides a powerful platform with which to assess the impact of mutations, gene knockdown, and/or chemical compounds upon muscle structure and function. Lastly, as GFP, cationic dyes, and movement assays are assessed non-invasively, prospective studies of muscle structure and function can be conducted across the whole life course and this at present cannot be easily investigated in vivo in any other organism.

Methods to Assess Subcellular Compartments of Muscle in C. elegans

Skeletal muscle is essential for locomotion and is the bodies&#8217; main protein store. Muscle health measurements within C. elegans are described. Prospective changes to muscle structure and function are assessed using localized GFP and cationic dyes.

Métodos para evaluar subcelulares compartimentos de músculo en<em&gt; C. elegans</em

Muscle is a dynamic tissue that responds to changes in nutrition, exercise, and disease state. The loss of muscle mass and function with disease and age ...

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here protocols are presented for preparing embryos and adult C. elegans animals for short- and long-term time-lapse microscopy and methods for tracking and quantification of developmental processes. The methods presented are all based on C. elegans strains available from the Caenorhabditis Genetics Center and on open-source software that can be easily implemented in any laboratory independently of the microscopy system used. A reconstruction of a 3D cell-shape model using the modelling software IMOD, manual tracking of fluorescently-labeled subcellular structures using the multi-purpose image analysis program Endrov, and an analysis of cortical contractile flow using PIVlab (Time-Resolved Digital Particle Image Velocimetry Tool for MATLAB) are shown. It is discussed how these methods can also be deployed to quantitatively capture other developmental processes in different models, e.g., cell tracking and lineage tracing, tracking of vesicle flow.

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Here it is shown how to track and quantify developmental processes in C. elegans. The methods presented are based on open-source tools that can be easily implemented. It is demonstrated how to reconstruct 3D cell-shape models, how to manually track subcellular structures, and how to analyze cortical contractile flow.

El seguimiento y cuantificación de los procesos de desarrollo en<em&gt; C. elegans</em&gt; Uso de las herramientas de código abierto

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here ...

Methods to Study Changes in Inherent Protein Aggregation with Age in Caenorhabditis elegans

In the last decades, the prevalence of neurodegenerative disorders, such as Alzheimer's disease (AD) and Parkinson's disease (PD), has grown. These age-associated disorders are characterized by the appearance of protein aggregates with fibrillary structure in the brains of these patients. Exactly why normally soluble proteins undergo an aggregation process remains poorly understood. The discovery that protein aggregation is not limited to disease processes and instead part of the normal aging process enables the study of the molecular and cellular mechanisms that regulate protein aggregation, without using ectopically expressed human disease-associated proteins. Here we describe methodologies to examine inherent protein aggregation in Caenorhabditis elegans through complementary approaches. First, we examine how to grow large numbers of age-synchronized C. elegans to obtain aged animals and we present the biochemical procedures to isolate highly-insoluble-large aggregates. In combination with a targeted genetic knockdown, it is possible to dissect the role of a gene of interest in promoting or preventing age-dependent protein aggregation by using either a comprehensive analysis with quantitative mass spectrometry or a candidate-based analysis with antibodies. These findings are then confirmed by in vivo analysis with transgenic animals expressing fluorescent-tagged aggregation-prone proteins. These methods should help clarify why certain proteins are prone to aggregate with age and ultimately how to keep these proteins fully functional.

Methods to Study Changes in Inherent Protein Aggregation with Age in Caenorhabditis elegans

The goal of the method presented here is to explore protein aggregation during normal aging in the model organism C. elegans. The protocol represents a powerful tool to study the highly insoluble large aggregates that form with age and to determine how changes in proteostasis impact protein aggregation.

Métodos de estudio cambios de agregación inherente de proteína con la edad en Caenorhabditis elegans

In the last decades, the prevalence of neurodegenerative disorders, such as Alzheimer's disease (AD) and Parkinson's disease (PD), has grown. These ...

Measurements of Physiological Stress Responses in C. Elegans

Organisms are often exposed to fluctuating environments and changes in intracellular homeostasis, which can have detrimental effects on their proteome and physiology. Thus, organisms have evolved targeted and specific stress responses dedicated to repair damage and maintain homeostasis. These mechanisms include the unfolded protein response of the endoplasmic reticulum (UPRER), the unfolded protein response of the mitochondria (UPRMT), the heat shock response (HSR), and the oxidative stress response (OxSR). The protocols presented here describe methods to detect and characterize the activation of these pathways and their physiological consequences in the nematode, C. elegans. First, the use of pathway-specific fluorescent transcriptional reporters is described for rapid cellular characterization, drug screening, or large-scale genetic screening (e.g., RNAi or mutant libraries). In addition, complementary, robust physiological assays are described, which can be used to directly assess sensitivity of animals to specific stressors, serving as functional validation of the transcriptional reporters. Together, these methods allow for rapid characterization of the cellular and physiological effects of internal and external proteotoxic perturbations.

Measurements of Physiological Stress Responses in C. Elegans

Here, we characterize cellular proteotoxic stress responses in the nematode C. elegans by measuring the activation of fluorescent transcriptional reporters and assaying sensitivity to physiological stress.

Mediciones de las respuestas fisiológicas de estrés en C. Elegans

Organisms are often exposed to fluctuating environments and changes in intracellular homeostasis, which can have detrimental effects on their proteome and ...