저자 감사 NHLBI/NIH (K08 HL124068 및 LRP HMOT1243), NCATS/NIH UCSF 임상 및 변환 과학 연구소 촉매 프로그램 (UL1 TR000004), UCSF 학술 상원 헬 맨 재단에서 관대 한 자금 지원을 한 길 르 앗 과학 연구 학술 상, (모두 존 S. Chorba) 화는 심장 혈관 상 고 (Adri M. Galvan Kevan M. Shokat)를 하 워드 휴즈 의학 연구소.

1. 사이트 감독 Mutagenesis Protease 벡터의
<ol><li>디자인과 표준 사이트 감독 mutagenesis 프로토콜12의 수정을 사용 하 여 관심사의 돌연변이 설치 하려면 사용자 정의 합성 oligonucleotides 주문. 표준 desalted 뇌관 (추가 정화) 없이 완벽 하 게 사용할 수 있습니다. 참고: 뇌관 디자인에 대 한 일반적인 접근 표 1의 중 합 효소에 녹는 온도 (Tm) 계산기를 사용 하 여 표시 된 대로 부분적으로 겹치는 뇌관을 만드는 작업이 포함 됩니다.</li>
	<li>설정 중 합 효소 연쇄 반응 (PCRs) 사이트 감독 mutagenesis 얼음, 표 2에 표시 된 대로.</li>
	<li>표 3에 표시 된 대로 PCRs를 주기.</li>
	<li>1 %agarose 젤에 각 PCR의 2-5 µ L을 실행 하 고 성공적인 증폭을 확인 하는 제품을 시각화. 참고: 성공적인 PCR (~7.8 kB) 서식 파일의 대략적인 크기 표시에서 단일, 저명한 DNA 밴드를 표시 합니다.</li>
	<li>DpnI의 (25 µ L 반응) 당 0.5 µ L을 추가 하 고 1 시간 동안 37 ° C에서 샘플을 품 어.</li>
	<li>화학적으로 유능한 병원 성 대장균으로 반응의 2 µ L를 변환. 참고: 급성장 E. 콜라이 긴장 부 화 시간을 줄일 것입니다 하지만 어떤 복제 긴장 든 지 받아들일 수 있을 것입니다.</li>
	<li>포함 하는 50-100 µ g/mL carbenicillin Luria Bertani (파운드) agar에 변형 판 37 ° c.에 하룻밤 번호판을 품 어</li>
	<li>2-4 식민지는 소규모 문화 (50-100 µ g/mL carbenicillin와 파운드 매체의 2-5 mL)에서 성장 하는 것을 선택 합니다. 혼 탁 한 때까지 220 rpm에서 37 ° C에서 문화를 품 어.</li>
	<li>제조업체의 지침에 따라 플라스 미드 DNA (i.e, "miniprep") 정화 키트를 사용 하 여 셀에서 DNA 플라스 미드를 분리. Microvolume 분 광 광도 계를 사용 하 여 eluted DNA의 농도 계량.</li>
	<li>플라스 미드는 생어 시퀀싱 서비스 (코어 또는 상업 시설)를 사용 하 여 광범위 하 게 DNA 순서. 서비스의 사양에 따라 DNA 샘플을 준비 합니다. 사전 연속 반응에서 성공적으로 사용 하는 뇌관은 표 4에 설명 되어 있습니다. 참고: 전체 플라스 미드 PCR 증폭으로 인해 전체 PCSK9 코딩 영역의 시퀀싱이 좋습니다 각 돌연변이 대 한.</li>
</ol>2. 높은 처리량 Luciferase 기반 베이스 분석 결과
<ol><li>
셀 도금 (0 일)
	<ol>
<li>실험에 대 한 낮은 통로 HEK293T 셀을 사용 하 고 Dulbecco의에 문화 10% 태아 둔감 한 혈 청 (FBS)와 독수리 매체 (DMEM) 수정. 수행 모든 luciferase 활동 시험 준비까지 조직 문화 후드에서 무 균 조건 하에서 작업 셀. 우물과 transfections를 테스트 하는 각 조건에 대 한 3 중에 수행 하 게 될 예상 실험에 필요한 접시의 수를 견적 한다.</li>
		<li>0.05% trypsin ethylenediaminetetraacetic 산 (EDTA) 셀 커버의 최소 볼륨으로 그들을 치료 하 여 부모 플라스 크에서 HEK293T 세포를 분리. 트립 신-EDTA 10 %FBS 전송 보충 DMEM의 2 볼륨 비활성화 무 균 튜브에 세포. 셀 계산 자동된 셀 카운터를 사용 하 여 (와 함께 trypan 블루 얼룩). 500 x g 세포를 복구 하려면 5 분 동안에 튜브 원심</li>
		<li>트립 신 포함 된 매체를 발음 하 고 문화 매체 2 x 105 셀/mL의 농도에 있는 셀을 다시 구성 하기. 멀티 채널 피 펫을 사용 하 여, 셀의 100 µ L의 2 × 104 셀/최종 시드 농도 주는 흰색 (불투명 하단) 96 잘 접시의 각 잘 전송. 참고: 초기 실험에 대 한 그것은 유용할 수 있습니다 또한 자매, 클리어 아래 96 잘 접시, 세포 성장 및 프로토콜 및 가이드 미래 문제 해결 동안 준수 모니터링 되므로 씨앗.</li>
		<li>24 h에 대 한 37 ° C, 5% CO2 에서 셀을 품 어.</li>
		<li>96-잘 형식에 플라스 미드의 마스터 플레이트를 준비 합니다. 차입 버퍼 (Tris HCl, pH 8.5) 96 잘 접시의 개별 잘에서 50 ng / µ L를 각 플라스 미드를 희석.<ol>
<li>긍정적인 통제 (WT) 플라스 미드8, 부정적인 컨트롤 (S386A) 플라스 미드8, 및 플라스 미드 무료 버퍼 (mock transfections) 4 우물을 준비 합니다. 약물 이나 다른 셀룰러 기반 치료 계획 되 고, 다음에 각 잘 각 부정적인 4 우물 함께 긍정적인 제어 (WT) 플라스 미드와 마스터 플레이트를 준비 하는 경우 (S386A) 플라스 미드, 플라스 미드 무료 버퍼를 제어 합니다.</li>
		</ol>
</li>
	</ol>
</li>
	<li>
Transfection (주 1)
	<ol>
<li>깊은 잘 96 잘 접시를 사용 하 여 96 잘 접시 형태로 transfection 혼합물을 준비 합니다. Pipetting 및 전송 손실에 대 한 계정에 충분 한 시 약을 준비 해야 되 고 3 중에는 transfections를 수행 합니다. 참고: 다음 계산 (420 웰 스에 대 한 보수적 추정) 3 중에 한 96 잘 접시를 실행할 충분 한 시 약을 준비 합니다.<ol>
<li>마스터는 희석된 지질 transfection 시 약, 시 약의 50.4 µ L 감소-혈 청 매체의 2050 µ L을 추가 혼합을 확인 합니다. DNA precomplexation 시 약, 시 약의 33.6 µ L 감소-혈 청 매체의 1730 µ L에 추가의 마스터 믹스를 확인 합니다.</li>
			<li>멀티 채널 피 펫, 깊은 잘 격판덮개의 각 음에 희석된 DNA precomplexation 시 약 혼합물의 aliquot 16.8 µ L를 사용 하 여.</li>
			<li>멀티 채널 피 펫, aliquot 3.2 µ L를 사용 하 여 (160 ng) 깊은 잘 격판덮개의 각 음에 마스터 플레이트에서 각 플라스 미드의.</li>
			<li>멀티 채널 피 펫을 사용 하 여, 각 희석된 지질 transfection 시 혼합물의 aliquot 20 µ L 접시의 잘 하 고 잘 사용 하 여 각 멀티 채널 피 펫의 내용을 혼합. 플레이트 커버 그리고 그들이 실내 온도 (RT)에 앉아 폼 지질: DNA 단지 10-15 분. 참고: transfection, 시 잘 당 최종 구성 될 것입니다 다음과 같습니다: 40 DNA, transfection 시 약의 0.12 µ L 및 DNA 중 complexation 시 약의 0.08 µ L의 ng와 각각의 내용을 잘 될 것입니다 10 µ L 총 볼륨 (감소-혈 청 매체).</li>
		</ol>
</li>
		<li>부드럽게 셀을 방해 하지 않도록 주의 복용 멀티 채널 피 펫을 사용 하 여 96 잘 접시에서 293T 세포에 매체를 교환 합니다. DMEM 10% 보충의 95 µ L 발음된 매체 바꿉니다 FBS. 참고:이 셀의 모든 약물을 치료 하는 적절 한 시간 것입니다.</li>
		<li>각 적절 한 잘 통해 멀티 채널 피 펫을 transfection 혼합물의 10 µ L를 추가 합니다. 부드럽게 우물에 내용을 섞어 접시를 소용돌이 친다. 24 시간 5% CO2 와 37 ° C에서 접시를 품 어. 참고: 우물의 최종 볼륨 증발 이상 24 h에 대 한 계정에 105 µ L에 온다.</li>
	</ol>
</li>
	<li>
분석 결과 (주 2)
	<ol>
<li>재고 솔루션 coelenterazine 시 약 준비: [인산 염 버퍼 식 염 수 (PBS), 신선한 준비에 녹아] 3m 나트륨 하는데, 5 M NaCl, 10 mg/mL 소 혈 청 알 부 민 (BSA;에 녹아 PBS, 신선한 준비), 그리고 2 m m coelenterazine (에 녹아 산성화 메탄올 10 mL 당 3 N HCl의 200 µ L를 포함). 참고: 2 mM coelenterazine 때 그것은 유지-80 ° C에서 빛의 부재에 2 주 동안 저장할 수 있습니다.</li>
		<li>표 5에 따르면 luciferase 판독 한 별도 시 약 각 세포와 매체와 2 x coelenterazine 시 약 준비. 먼저는 coelenterazine 저장 모든 시 약을 혼합 하 고 혼합 0.22 μ m 주사기 필터를 통해 필터링은 coelenterazine를 추가 합니다. 그들은 접시에 추가 될 준비가 될 때까지 약 빛에서 보호 합니다. 참고: 여과에서 솔루션의 손실로 인해 전송 뿐만 아니라 여과에서 모두 손실에 대 한 계정에 충분 한 시 약 확인. 표 5 는 2 x 시 약 (뿐만 아니라 한 시 약으로 한 96 잘 접시를 읽을 추가 하려면 재고 솔루션의 금액)의 최종 농도 보여 줍니다.</li>
		<li>Transfection는 후 24 h 인큐베이터에서 셀을 제거 합니다. 멀티 채널 피 펫을 사용 하 여, 신선한, 화이트 바닥 (불투명) 96 잘 접시에 각 우물에서 50 µ L 조절된 하는 매체의 전송.<ol>
<li>그들은 매체 또는 셀을 포함 하는 여부로 접시를 레이블을 지정 합니다. 하나 이상의 96 잘 접시 페 했다 매체 포함 된 플레이트 각 셀의 그것의 부모 플레이트와 결합 하 여 수 있도록 접시를 레이블을 지정 합니다.</li>
		</ol>
</li>
		<li>멀티 채널 피 펫을 사용 하 여, 바른된 매체를 포함 하는 접시에 비 용균성 coelenterazine 시 약 x 2의 50 µ L를 추가 합니다. 부드럽게 바위 또는 실시간에 5-10 분에 대 한 빛의 부재에 접시를 흔들어</li>
		<li>멀티 채널 피 펫을 사용 하 여 셀을 포함 하는 접시에 2 x 용균성 coelenterazine 시 약의 50 µ L를 추가 합니다. 부드럽게 바위 또는 실시간에 5-10 분에 대 한 빛의 부재에 접시를 흔들어</li>
		<li>부 화 후 플레이트 리더에서 매체 전용 플레이트의 발광 밖으로 읽기. 그런 다음, 동일한 플레이트 리더에 포함 하는 셀 판의 발광 밖으로 읽기.</li>
		<li>판 삭제 하 고 데이터 분석에 대 한 파일을 저장 합니다.</li>
	</ol>
</li>
</ol>3. 데이터 분석
<ol><li>스프레드시트 소프트웨어를 사용 하 여 초기 데이터 분석을 수행 합니다. 셀 및 중간 플레이트에서 결과 포함 하는 스프레드시트를 만듭니다.</li>
	<li>수동으로 제대로 transfected 우물을 식별 하기 위해 셀 격판덮개에서 데이터를 검사 합니다. 우물 < 5%-10% 부정적인 컨트롤 (S386A) 플라스 미드의 판독의 고려 되어야 한다으로 저조한 페, 그 데이터 용의자의 해석 만들기.</li>
	<li>Mock 페 우물에서 각 판의 평균 배경 발광을 계산 합니다. 그 접시의 값에서 각 판의 배경 빼기. 참고:이 값을 사용 하는 플레이트 리더에 따라 무시할 수 수 있습니다.</li>
	<li>각 잘 전반적인 luciferase 활동에 비해 매체에서 luciferase 활동의 비율을 계산 하 여 데이터 처리 합니다. 셀 접시 포함 셀, 뿐만 아니라 모두 바른된 매체 때문에 세포 격판덮개로 조절된 하는 매체의 동일한 금액을 포함 하는 매체 전용 접시, 그것은 다음과 같은 방정식을 사용 하 여 적절 한: <img alt="Equation 1" src="/files/ftp_upload/58265/58265eq1.jpg"> 여기서, RLU = 상대 발광 단위, 플레이트 리더에서 배경 빼고 판독.</li>
	<li>긍정적인 통제 (WT)와 부정적인 컨트롤 (S386A) 우물의 평균 secreted luciferase를 계산 합니다.</li>
	<li>Z-팩터13를 계산 하 여 실험의 전반적인 품질을 평가. <img alt="Equation 2" src="/files/ftp_upload/58265/58265eq2.jpg"> 참고: 활성 값에서 긍정적인 제어 (WT)와 서 부정적인 컨트롤 (S386A) 우물에서 비활성 값 온. 1에 가까운 값 높은 실험 품질을 나타냅니다. 실험을 반복 값이 0 미만의 경우 워크플로 최적화 하십시오.</li>
	<li>과학적인 데이터 분석 소프트웨어 스프레드시트 프로그램에서 데이터를 전송.</li>
	<li>긍정적인 통제 (WT) 및 부정적인 제어 (S386A)의 평균 값을 0으로 긍정적인 통제 1와 부정적인 컨트롤 설정 luciferase 분 비 활동을 정상화.</li>
	<li>Outliers 회귀 및 국외 자 제거 (패 주) 메서드를 사용 하 여 최대 틀린 발견 비율을 1%로 설정에 대 한 데이터를 청소.</li>
	<li>(1의 값으로 정규화) WT 활동의 의미를 각 돌연변이 상태 (또는 돌연변이)에 대 한 데이터를 비교 하 여 통계적으로 유의 한 차이 평가 합니다. 수행 하는 여러 홀된 t-테스트, Holm Sidak 방법과 α를 사용 하 여 여러 비교에 대 한 수정 = 0.05.</li>
</ol>

<ol>
	<li>Park, S. W., Moon, Y. A., Horton, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+regulation+of+low+density+lipoprotein+receptor+protein+by+proprotein+convertase+subtilisin/kexin+type+9a+in+mouse+liver.">Post-transcriptional regulation of low density lipoprotein receptor protein by proprotein convertase subtilisin/kexin type 9a in mouse liver.</a> Journal of Biological Chemistry. 279 (48), 50630-50638 (2004).</li><li>Cohen, J. C., Boerwinkle, E., Mosley, T. H., Hobbs, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+variations+in+PCSK9,+low+LDL,+and+protection+against+coronary+heart+disease.">Sequence variations in PCSK9, low LDL, and protection against coronary heart disease.</a> New England Journal of Medicine. 354 (12), 1264-1272 (2006).</li><li>Ridker, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiovascular+Efficacy+and+Safety+of+Bococizumab+in+High-Risk+Patients.">Cardiovascular Efficacy and Safety of Bococizumab in High-Risk Patients.</a> New England Journal of Medicine. 376 (16), 1527-1539 (2017).</li><li>Sabatine, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolocumab+and+Clinical+Outcomes+in+Patients+with+Cardiovascular+Disease.">Evolocumab and Clinical Outcomes in Patients with Cardiovascular Disease.</a> New England Journal of Medicine. 376 (18), 1713-1722 (2017).</li><li>Kazi, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cost-effectiveness+of+PCSK9+Inhibitor+Therapy+in+Patients+With+Heterozygous+Familial+Hypercholesterolemia+or+Atherosclerotic+Cardiovascular+Disease.">Cost-effectiveness of PCSK9 Inhibitor Therapy in Patients With Heterozygous Familial Hypercholesterolemia or Atherosclerotic Cardiovascular Disease.</a> Journal of the American Medical Association. 316 (7), 743-753 (2016).</li><li>Kazi, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Updated+Cost-effectiveness+Analysis+of+PCSK9+Inhibitors+Based+on+the+Results+of+the+FOURIER+Trial.">Updated Cost-effectiveness Analysis of PCSK9 Inhibitors Based on the Results of the FOURIER Trial.</a> Journal of the American Medical Association. 318 (8), (2017).</li><li>Pettersen, D., Fjellstr&#246;m, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecule+modulators+of+PCSK9+-+A+literature+and+patent+overview.">Small molecule modulators of PCSK9 - A literature and patent overview.</a> Bioorganic &amp; Medicinal Chemistry Letters. 28 (7), 1155-1160 (2018).</li><li>Chorba, J. S., Galvan, A. M., Shokat, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+processing+analyses+of+the+single-turnover+PCSK9+protease+reveal+its+substrate+sequence+specificity+and+link+clinical+genotype+to+lipid+phenotype.">Stepwise processing analyses of the single-turnover PCSK9 protease reveal its substrate sequence specificity and link clinical genotype to lipid phenotype.</a> Journal of Biological Chemistry. 293 (6), 1875-1886 (2018).</li><li>Maxwell, K. N., Breslow, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenoviral-mediated+expression+of+Pcsk9+in+mice+results+in+a+low-density+lipoprotein+receptor+knockout+phenotype.">Adenoviral-mediated expression of Pcsk9 in mice results in a low-density lipoprotein receptor knockout phenotype.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (18), 7100-7105 (2004).</li><li>Benjannet, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NARC-1/PCSK9+and+its+natural+mutants:+zymogen+cleavage+and+effects+on+the+low+density+lipoprotein+(LDL)+receptor+and+LDL+cholesterol.">NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol.</a> Journal of Biological Chemistry. 279 (47), 48865-48875 (2004).</li><li>Cunningham, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biophysical+studies+of+PCSK9+and+its+mutants+linked+to+familial+hypercholesterolemia.">Structural and biophysical studies of PCSK9 and its mutants linked to familial hypercholesterolemia.</a> Nature Structural &amp; Molecular Biology. 14 (5), 413-419 (2007).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8, 91 (2008).</li><li>Zhang, J., Chung, T., Oldenburg, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Statistical+Parameter+for+Use+in+Evaluation+and+Validation+of+High+Throughput+Screening+Assays.">A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays.</a> Journal of Biomolecular Screening. 4 (2), 67-73 (1999).</li><li>Hall, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+luciferase+reporter+from+a+deep+sea+shrimp+utilizing+a+novel+imidazopyrazinone+substrate.">Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate.</a> ACS Chemical Biology. 7 (11), 1848-1857 (2012).</li><li>McNutt, M. C., Lagace, T. A., Horton, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+activity+is+not+required+for+secreted+PCSK9+to+reduce+low+density+lipoprotein+receptors+in+HepG2+cells.">Catalytic activity is not required for secreted PCSK9 to reduce low density lipoprotein receptors in HepG2 cells.</a> Journal of Biological Chemistry. 282 (29), 20799-20803 (2007).</li><li>Chorba, J. S., Shokat, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+proprotein+convertase+subtilisin/kexin+type+9+(PCSK9)+active+site+and+cleavage+sequence+differentially+regulate+protein+secretion+from+proteolysis.">The proprotein convertase subtilisin/kexin type 9 (PCSK9) active site and cleavage sequence differentially regulate protein secretion from proteolysis.</a> Journal of Biological Chemistry. 289 (42), 29030-29043 (2014).</li><li>Benjannet, S., Rhainds, D., Hamelin, J., Nassoury, N., Seidah, N. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+proprotein+convertase+(PC)+PCSK9+is+inactivated+by+furin+and/or+PC5/6A:+functional+consequences+of+natural+mutations+and+post-translational+modifications.">The proprotein convertase (PC) PCSK9 is inactivated by furin and/or PC5/6A: functional consequences of natural mutations and post-translational modifications.</a> Journal of Biological Chemistry. 281 (41), 30561-30572 (2006).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+loss-of-function+mutations+in+PCSK9+and+identification+of+a+compound+heterozygote.">Molecular characterization of loss-of-function mutations in PCSK9 and identification of a compound heterozygote.</a> American Journal of Human Genetics. 79 (3), 514-523 (2006).</li></ol>

저자는 공개 없다.

위에서 설명한 실험 절차 단일 매출 protease PCSK9의 본질적으로 저조를 극복 하 고 강력한 방식으로 분해 기능을 평가 하는 방법을 제시. 분석 결과의 주요 개념 효소 증폭된 판독 단일 매출 이벤트 변환에 의존 합니다. 분석 결과의 강점 등는 상대적으로 짧은 시간 프레임 luciferase 기자는 확장성 높은 처리량 접근의 사용의 용이성. 또한, 분석 결과 네이티브, 셀룰러 맥락에서 베이스를 평가합니다. 또한,이 분석 결과와 임상적으로 확인 된 Snp 평가할 수 있다 어떤 인간이 나 환자 조직;에 대 한 필요 없이 PCSK9 베이스에 그들의 효과 대 한 관심사의 유전자 형의 기술만 필요 하다.
분석 결과의 몇 가지 기술적인 제한이 존재 한다. 분석 결과 평가 셀 내에 베이스, 비록 벡터의 overexpression을 또한 필요 합니다. 분석 결과 HEK293T 셀 라인의 과도 transfection를 해야 하므로 transfection 효율 내장 잘-투-잘 다양성을 추가 합니다. 효소-죽은 S386A PCSK9 베이스에 대 한 부정적인 제어 역할을, 하는 동안 그것은 또한 역할 transfection 자체에 대 한 긍정적인 통제 이후 이러한 셀 생산 기능, 침 갇혀, luciferase 이기는 하지만. Transfection 효율에 심한 변형을 그 셀을 식별 하는 데 도움이 휴대 전화 번호판의 원시 데이터를 평가 및 이러한 데이터가 삭제 될 수 있습니다 (그리고 경우 반복 실험 원하는). 또한, 총 luciferase에서 luciferase 분 비의 비율에 대 한 데이터 처리 플라스 미드 배달에 transcriptional 출력 작은 변화에 대 한 조정 하는 데 도움이 생산. 같은 유사 마찬가지로 세포와 조절된 매체의 luciferase 출력에 영향을 미칠 예상 또한,이 분석 결과 대 한 사용 하는 벡터는 성공에 대 한 요구를 무시 하는 수단으로 고용 되어 상용 Flp-In T-렉스 293 라인으로 유도할 수 있는, isogenic 안정 세포 선의 형성에 의무가 지질 중재 transfection입니다. 이 PCSK9 베이스 억제제에 대 한 작은 분자 검열에 분석 결과 적용할 때 매력적인 기능을 있을 것입니다. 날짜 하려면, 같은 저 해제 확인 되었습니다,이 분석 결과의 중요성을 더욱 강조.
PCSK9 효소 공학 또한 여러 생물 학적 한계를 만듭니다. 첫째, 분석 결과 WT PCSK9 발생 intramolecular 베이스 보다는 오히려 intermolecular PCSK9 베이스를 측정 합니다. 이러한 두 활동은 일반적으로 연결 하는 동안 그것은 모든 생물 학적 상황에 존재 하는 이러한 상관 관계 되 고, 따라서, 일부 상황에서 cis에서 PCSK9 분열에 이러한 효과의 검증 분석 결과, 가능성이 대안 방법 immunoblot, 같은 필요할 수 있습니다. 또한, 분석 결과 수만 평가 missense Snp (비 코딩 유사의 효과 아닙니다). 마지막으로, 비록 PCSK9 베이스 PCSK9 분 비의 속도-제한 단계 이며 PCSK9 베이스의 감소 (에 관하여 임상 콜레스테롤 phenotype) 기능 손실 PCSK9 variant를 일으킬 것으로 예상 된다, 이것은 사실이 아니다 나타내는 모든 Snp에 대 한 적어도 일부 돌연변이 대 한 추가 생물학은 플레이8에.
이 분석 결과의 유틸리티는 본질적으로 저 출력 효소의 분해 기능을 평가 하는 능력에 있다. 이러한 디자인 개념에서 유사한도 전에 고통 받는 PCSK9 이외의 프로 테아 제 번역 한다. 이 수정을 수행 하려면 그것이 절단, luciferase 분 비 사이의 연결을 유지 하기 위해 필요 합니다. 기판 한 전략 내가 막 앵커는 유형으로 대체 통해 luciferase에 연결 된 분열 시퀀스의 효소에이 요구 사항을 만족 해야 합니다.
요약 하자면,이 프로토콜 높은 처리량 패션에서 PCSK9 베이스를 평가 하는 방법을 설명 합니다. 이 방법은 작은 분자 PCSK9 억제제의 심사에 대 한 뿐만 아니라 PCSK9 베이스에 임상 Snp의 효과 평가 하기 위한 모두 유용할 것 이다.

LDL 콜레스테롤 (LDL-콜레스테롤)을 제기 하 고 동맥 경 화성 심장 질환1,2운전 PCSK9 성능 저하, LDL 수용 체 (LDL-R)를 대상. 치료 대상 PCSK9 튼튼하게 LDL-콜레스테롤을 낮출 하 고 적극적인 지질을 낮추는 치료 스타 틴3,4에 추가 하는 경우에 환자에 대 한 심장 혈관 결과 개선. 그러나 현재 승인 된 치료 항 체 기반 접근에 제한 된다, 그리고 비용 효율성5,6의 부족에서 고통. 이 문제를 해결 하려면 비용이 많이 드는 치료 대안, 환자 더 큰 혜택을 얻을 것을 식별 하는 수단 또는 둘 다 필요 합니다.
작은 분자 접근은 세포내 PCSK9 대상, 관리의 향상 된 경로 제공 고 비용, 그들에 게이 지역7에 있는 "성배"를 줄일 수 있습니다. 그러나, PCSK9 작은 분자 약물 어려운 입증 했다. 한 효소로 PCSK9의 분해 기능을 대상으로 자체 베이스 PCSK9 성숙8 의 속도 제한 단계가 고 LDL-R9에 그것의 최대 효과 위해 필요한 매력적인 전략 이다. 그러나 현재까지,,이 전략 하지 않은 성공 가능성이 PCSK9의 고유한 생화학 때문: PCSK9 앞만 자체10, 수행 하는 단일-매출 반응, 그리고 자기 분열 후 PCSK9 prodomain와 활성 사이트에 바인딩된는 자동-억제제11, 어떤 더 프로 테아 제 활동의 판독을 방지.
이 문서는 높은 처리량 패션8PCSK9 분해 기능을 평가 하는 메서드를 제공 합니다. 사이트 지시 된 mutagenesis, 통해 조사자는 베이스, PCSK9 성숙의 속도 제한 단계에 효과 대 한 그들을 평가 하기 위해 병원에서 발견 하는 Snp 코딩의 효과 조사 하이 분석 결과 사용할 수 있습니다. 또한,이 방법은 궁극적으로 LDL-r PCSK9의 프레 젠 테이 션을 방해 (및 변조 PCSK9의 콜레스테롤 효과) 것으로 예상 되는 PCSK9 베이스의 변조기를 식별 하기 위해 높은 처리량 스크린의 설계에 도움이 될 것입니다. . 마지막으로,이 프로토콜은 i) 특정 기질-효소 쌍을 찾을 수 있습니다, 고 기판에 대 한 ii)는 적당 한 세포내 앵커를 설정할 수 있습니다 본질적으로 낮은 활동, 다른 프로 테아 제를 적용할 수 있습니다.

<table>
	<tbody>
		<tr>
			<td>PCR Tubes</td>
			<td>USA Scientific</td>
			<td>1402-2900</td>
			<td>For PCR</td>
		</tr>
		<tr>
			<td>Q5 Hot Start</td>
			<td>New England Biolabs</td>
			<td>M0493L</td>
			<td>High-fidelity DNA Polymerase</td>
		</tr>
		<tr>
			<td>Deoxynucleotide Solution Mix</td>
			<td>New England Biolabs</td>
			<td>N0447L</td>
			<td>dNTPs (for PCR)</td>
		</tr>
		<tr>
			<td>pPCSK9-NLucProteaseAssay-WT</td>
			<td>Authors</td>
			<td>n/a</td>
			<td>Available from authors</td>
		</tr>
		<tr>
			<td>pPCSK9-NLucProteaseAssay-S386A</td>
			<td>Authors</td>
			<td>n/a</td>
			<td>Available from authors</td>
		</tr>
		<tr>
			<td>Agarose LE</td>
			<td>Gold Biotechnology</td>
			<td>A-201-100</td>
			<td>For DNA gels</td>
		</tr>
		<tr>
			<td>E-Gel Imager System with Blue Light Base</td>
			<td>ThermoFisher Scientific</td>
			<td>4466612</td>
			<td>For imaging DNA gels</td>
		</tr>
		<tr>
			<td>SYBR Safe DNA Gel Stain</td>
			<td>ThermoFisher Scientific</td>
			<td>S33102</td>
			<td>For DNA gels</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>ThermoFisher Scientific</td>
			<td>BP152-1</td>
			<td>For DNA gel running buffer</td>
		</tr>
		<tr>
			<td>Glacial acetic acid</td>
			<td>ThermoFisher Scientific</td>
			<td>A38-500</td>
			<td>For DNA gel running buffer</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid solution</td>
			<td>Millipore Sigma</td>
			<td>3690</td>
			<td>EDTA, for DNA gel running buffer</td>
		</tr>
		<tr>
			<td>1 kb DNA ladder</td>
			<td>Gold Biotechnology</td>
			<td>D010</td>
			<td>DNA ladder</td>
		</tr>
		<tr>
			<td>DpnI</td>
			<td>New England Biolabs</td>
			<td>R0176S</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr>
			<td>LB Agar plates with 100 &#181;g/mL carbenicillin</td>
			<td>Teknova</td>
			<td>L1010</td>
			<td>LB-Carb plates</td>
		</tr>
		<tr>
			<td>One Shot Mach1 T Phage-Resistent Chemically Competent E. coli</td>
			<td>ThermoFisher Scientific</td>
			<td>C862003</td>
			<td>Chemically competent cells</td>
		</tr>
		<tr>
			<td>LB Broth, Miller</td>
			<td>ThermoFisher Scientific</td>
			<td>BP1426-2</td>
			<td>LB</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>Gold Biotechnology</td>
			<td>C-103-5</td>
			<td>Selective antibiotic</td>
		</tr>
		<tr>
			<td>E.Z.N.A. Plasmid Mini Kit I</td>
			<td>Omega BioTek</td>
			<td>D6942-02</td>
			<td>DNA Purification Miniprep kit</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 Spectrophotomer</td>
			<td>ThermoFisher Scientific</td>
			<td>ND-2000C</td>
			<td>Spectrophotometer</td>
		</tr>
		<tr>
			<td>293T Cells</td>
			<td>American Tissue Culture Collection (ATCC)</td>
			<td>CRL-3216</td>
			<td>HEK 293T cells</td>
		</tr>
		<tr>
			<td>DMEM, high glucose, pyruvate</td>
			<td>ThermoFisher Scientific</td>
			<td>11995065</td>
			<td>DMEM, mammalian cell media</td>
		</tr>
		<tr>
			<td>Fetal Bovine Sera</td>
			<td>Axenia Biologix</td>
			<td>F001</td>
			<td>FBS</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05%), phenol red</td>
			<td>ThermoFisher Scientific</td>
			<td>25300062</td>
			<td>Trypsin, for cell dissociation</td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>ThermoFisher Scientific</td>
			<td>10010023</td>
			<td>PBS</td>
		</tr>
		<tr>
			<td>Countess automated cell counter</td>
			<td>ThermoFisher Scientific</td>
			<td>C10227</td>
			<td>Automated cell counting</td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>ThermoFisher Scientific</td>
			<td>C10228</td>
			<td>Slides for cell counting</td>
		</tr>
		<tr>
			<td>CELLSTAR Tissue Culture Plates, White, White-Bottom, with Lid</td>
			<td>Grenier Bio-One</td>
			<td>655083</td>
			<td>White, white-bottom 96 well plate</td>
		</tr>
		<tr>
			<td>TempPlate non-skirted 96-well PCR plate, natural</td>
			<td>USA Scientific</td>
			<td>1402-9596</td>
			<td>96 well plate for master plasmid plate</td>
		</tr>
		<tr>
			<td>Nunc 2.0mL DeepWell Plates</td>
			<td>ThermoFisher Scientific</td>
			<td>278743</td>
			<td>96 well deep well plate</td>
		</tr>
		<tr>
			<td>Lipofectamine 3000</td>
			<td>ThermoFisher Scientific</td>
			<td>L3000008</td>
			<td>Lipid transfection reagent, Lf3K</td>
		</tr>
		<tr>
			<td>P3000 Reagent</td>
			<td>ThermoFisher Scientific</td>
			<td>L3000008</td>
			<td>DNA pre-complexation reagent, provided with Lf3K</td>
		</tr>
		<tr>
			<td>OptiMEM I Reduced Serum Medium</td>
			<td>ThermoFisher Scientific</td>
			<td>31985062</td>
			<td>Reduced serum medium for transfection</td>
		</tr>
		<tr>
			<td>(+)-Sodium L-ascorbate</td>
			<td>Millipore Sigma</td>
			<td>A4034</td>
			<td>Sodium ascorbate</td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Millipore Sigma</td>
			<td>S9888</td>
			<td>NaCl</td>
		</tr>
		<tr>
			<td>Albumin, Bovine Serum, Fraction V, Low Heavy Metals</td>
			<td>Millipore Sigma</td>
			<td>12659</td>
			<td>BSA</td>
		</tr>
		<tr>
			<td>Methanol (HPLC)</td>
			<td>ThermoFisher Scientific</td>
			<td>A4524</td>
			<td>MeOH</td>
		</tr>
		<tr>
			<td>Hydrochloric acid</td>
			<td>VWR</td>
			<td>JT9535-2</td>
			<td>Concentrated HCl</td>
		</tr>
		<tr>
			<td>Coelenterazine</td>
			<td>Gold Biotechnology</td>
			<td>CZ2.5</td>
			<td>Luciferase substrate</td>
		</tr>
		<tr>
			<td>Syringe Filter, Sterile</td>
			<td>ThermoFisher Scientific</td>
			<td>09-720-3</td>
			<td>Sterile filter, PVDF, 0.22 &#181;m pore</td>
		</tr>
		<tr>
			<td>Pipet-Lite Multi Pipette L12-200XLS+</td>
			<td>Rainin</td>
			<td>17013810</td>
			<td>Multichannel pipette</td>
		</tr>
		<tr>
			<td>Pipet-Lite Multi Pipette L12-20XLS+</td>
			<td>Rainin</td>
			<td>17013808</td>
			<td>Multichannel pipette</td>
		</tr>
		<tr>
			<td>Pipet-Lite Multi Pipette L12-10XLS+</td>
			<td>Rainin</td>
			<td>17013807</td>
			<td>Multichannel pipette</td>
		</tr>
		<tr>
			<td>Reagent reservoir</td>
			<td>Corning</td>
			<td>4870</td>
			<td>Trough for reagents</td>
		</tr>
		<tr>
			<td>Centrifuge tubes, 15 mL</td>
			<td>ThermoFisher Scientific</td>
			<td>05-539-12</td>
			<td>15 mL tubes</td>
		</tr>
		<tr>
			<td>Centrifuge tubes, 50 mL</td>
			<td>Corning</td>
			<td>430829</td>
			<td>50 mL tubes</td>
		</tr>
		<tr>
			<td>Spark Microplate Reader</td>
			<td>Tecan</td>
			<td>N/a</td>
			<td>Plate Reader</td>
		</tr>
		<tr>
			<td>Excel</td>
			<td>Microsoft</td>
			<td>2016 for Mac</td>
			<td>Spreadsheet software</td>
		</tr>
		<tr>
			<td>Prism</td>
			<td>GraphPad Software</td>
			<td>v7</td>
			<td>Scientific data analysis software</td>
		</tr>
	</tbody>
</table>

a high-throughput luciferase assay to evaluate proteolysis of the single-turnover protease pcsk9

Proprotein convertase subtilisin/kexin 9 (PCSK9) 형식이 단일 매출 protease 혈 청 저밀도 지 단백질 (LDL) 수치를 조절 하 고, 따라서, 심장 혈관 질병. PCSK9 베이스에 필요 하지만 전체 콜레스테롤 효과, 분해 기능 평가 도전 이다: PCSK9 자체 쪼개만 알려져, 겪 습만 단일 회전율, 및 베이스, 후에 그것의 기질을 유지 자동-억제제로 그것의 활성 사이트입니다. 여기에 제시 된 방법을 이러한 문제를 극복 하는 분석 결과 설명 합니다. 분석 결과 셀 컨텍스트 및 링크 쉽게 읽을 수 있습니다 밖으로 바른된 매체에 은닉 luciferase 활동에 성공적인 분열 intermolecular 베이스에 집중 한다. 통해 순차적 단계 mutagenesis, 과도 transfection 그리고 luciferase 판독, 분석 결과 높은 처리량 방법에서 유전적 또는 분자 섭 동의 조건 하에서 PCSK9 베이스를 프로브 수 있습니다. 이 시스템은 임상 발견된 missense 단일 뉴클레오티드 동 질 다 상 (Snp), 또한 PCSK9 베이스의 작은 분자 억제제의 심사에 관해서는 모두 생 화 학적 평가 대 한 적합 합니다.

높은 처리량 베이스 분석 결과 세 가지 주요 과제를 극복에 의존 합니다. 첫째, 단일-매출 PCSK9 효소는 억제 부족 PCSK9 효소의 본질적으로 낮은 출력을 극복 하기 위해 prodomain 사용 됩니다, 분열 순서는 prodomain의 꼬리에서 분 비14수 luciferase에 연결. 둘째, 접으면 protease에 대 한 필요를 만족 시키기 위해 복잡 한 그것의 억제와 함께 prodomain, 2 개의 polypeptides는 coexpressed 트랜스에서 셀룰러 컨텍스트15,16를 통해 bicistronic 벡터에. 셋째,에서 차별화 하는 쪼개진 uncleaved 기판, PCSK9 효소가 잘립니다 C678 바인딩과 그물 (응급실)에서 복잡 한 PCSK9 출구를 방지 하지만 분해 기능17,18에 아무런 영향도 주지에서 . 함께 찍은, 존재와 PCSK9 베이스 (그림 1A)의 정도 대 한 프록시 secreted luciferase의 평가 대 한 수 있습니다. 분석 결과의 일반적인 기간 짧은, 분석 결과 벡터의 사이트 감독 mutagenesis의 단계는 (일 1-2) 과도 transfection (3 일) 뒤와 luciferase 판독 (주 4) 모든에 신속 하 게 최소한의 "실제" 시간 (4 일 완성 그림 1B)입니다.
전반적으로,이 분석 결과 판독 luciferase 분석 결과 의해 수행과 다양 한 조건에서 PCSK9 베이스의 동시 평가 대 한 수 있습니다. 수집 및 처리 후 데이터 열 지도 또는 테이블 형식으로 구상 될 수 있다. 특히, Snp 코딩의 mutational 분석은이 접근 방식에 적합. 그림 2 는 P6 통해 기판 사이트 P6에서 PCSK9 효소의 분열 순서 특이성 평가 포화 mutagenesis 라이브러리의 열 지도 '. 결과 최적의 절단 순서는 기본적으로 WT 시퀀스와 동일 (SSVFAQ | SIPWNL)입니다. 특히, P6 또는 P1 통해 P4의 돌연변이 ', 성숙의 결정 구조에서 이러한 위치는 PCSK9 죽 습에 대 한 잔류물 효소, 얕은, 소수 바인딩 그루브와 일치 하 여 저조한 용납. 억제제 개발의 관점에서이 좁은 순서 특이성 프로필은 유용한 찾기, 모방 없는 이상적인된 기판 내 생 분열 시퀀스 노르만족 수 있듯이. 그림 3 PCSK9 기본 구조에 밖으로 매핑된 missense Snp는 클리닉에 설명 된 라이브러리의 (무게에 비해) 상대적 분열 활동을 보여준다. 평가 84 Snp의 이상 절반 보였다 중요 한 변화 활동 WT 효소에 비해. 이 결과 변경 PCSK9 분해 활동에는 실제로 꽤 임상 인구에 있는 일반적인 이러한 변경 LDL 콜레스테롤 수치는 병원에서 본에 있는 변화를 설명 하기 위해 도움이 될 수 있습니다 것이 좋습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58265/58265fig1.jpg"> 그림 1: 높은 처리량에 트랜스에서 PCSK9 분열 분석 결과의 전체 회로도 (A)이이 패널은 여기에 제시 된 분석 결과의 생 화 확 적인 회로도 보여준다. 기판 구성 PCSK9 신호 순서 (어두운 회색) 및 prodomain (레드)에 연결 될 수 있는 luciferase PCSK9 분열 시퀀스 (노란색) (NLuc, 그린) 분 비. 신호 순서 (어두운 회색), 촉매 도메인 (밝은 회색), 및 시스테인-히스티딘 풍부한 (CHR) 도메인 C679X 잘림을 포함 하는 프로 테아 제에 의하여 이루어져 있다. 기질-효소 쌍 2A 기반 bicistronic 벡터, 유전자 조작 의무가 있는 화학 량 론 총계에서 coexpressed입니다. Coexpression, 효소와 기질 공동 배 고 바인딩과 그물 (응급실)에서 분리 된 유지. 분열 활동은 luciferase 복잡 한에서 해방 이며 분 비, 조절된 하는 매체의 luciferase 분석 결과 의해 감지 수 있습니다. 잠재적인 섭 분열 활동을 포함, 하지만, 유전자 조작 (섭 동 A) 이나 작은 분자 (섭 동 B)의 존재에 국한 되지 않습니다. (B)이이 패널 전체 분석 결과 대 한 일정을 보여 줍니다. 사이트 감독 mutagenesis WT 플라스 미드에는-1과 0, 뒤에 1 일 transfection luciferase 분석 결과 하루에 2, 4 일의 전체 타임 라인에 대 한 일에 수행 됩니다. 이 그림에서 Chorba 외 적응 되었습니다. 8. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58265/58265fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58265/58265fig2.jpg"> 그림 2: PCSK9 효소의 특이성을 시퀀싱. (A)이 열 지도 표시 분해 활동 표준화 배경과 WT, P6 통해 P6의 포화 mutagenesis 라이브러리의 각 단일 아미노산 돌연변이 대 한 ' 분열 시퀀스. WT 시퀀스 id WT 시퀀스 상단에 모두 표시 하 고 흰색 사각형으로 강조 표시에 대 한 값으로 하단에 표시 됩니다. 값이 0 (검정) WT 값을 표시 하는 배경 활동, 및 + (녹색) 1의 값을 나타냅니다. (B)이이 열 지도 빨간색에서 검은색과 높은 값에서 낮은 값을 가진 동일한 포화 mutagenesis 라이브러리에서 베이스 값의 표준 편차를 보여 줍니다. 흰색 점선된 사각형에 명시 된 값 나타냅니다 Holm Sidak 수정, 짝이 없는 t에 의해 결정으로 WT protease의 크게 다른 베이스 값을 보여준 돌연변이-α < 0.05와 함께 테스트. 표시 된 데이터 3 독립적인 실험에서 각각 3 복제를 포함 하는. 이 그림에서 Chorba 외 적응 되었습니다. 8. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58265/58265fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58265/58265fig3.jpg"> 그림 3: 분해 기능에 PCSK9 Snp의 효과. (A)이이 패널 표시 PCSK9의 기본 구조 신호 순서 (SS, 검은 윤곽선), prodomain (빨강 윤곽선), 촉매 도메인 (회색 개요), 그리고 시스테인-히스티딘 풍부한 도메인 (CHR; 블루 개요). (B)이이 패널 기본 구조에 매핑된 베이스 분석 결과 84 임상 Snp (노란색 사각형 검은 윤곽선으로)의 위치를 보여줍니다. (C)이이 패널 Holm Sidak 수정 홀된 t에 의해 결정으로 WT 효소에 비해 상당히 변경 된 분해 활동 47 Snp의 값을 표시-α < 0.05와 함께 테스트. 값은 PCSK9 기본 구조, 아니 분해 활동을 나타내는-1 (빨간색)의 가치와 WT protease에 2-fold 향상을 나타내는 + (청록색) 1의 값에 매핑됩니다. 이 그림에서 Chorba 외 적응 되었습니다. 8. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58265/58265fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
표 1: 돌연변이 PCR 뇌관 디자인 사이트 감독. PCR 뇌관 디자인 표시에 따라 부분적으로 중복 시퀀스, 있다. 성공적인 뇌관 쌍의 예 표는 아래와 같습니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58265/Table_1.xlsx">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>구성 요소</td>
			<td>주식</td>
			<td>볼륨 (µ L)</td>
			<td>최종</td>
		</tr>
<tr>
<td>초순 H2O</td>
			<td></td>
			<td>17.5</td>
			<td>25 µ L 총 볼륨</td>
		</tr>
<tr>
<td>중 합 효소 반응 버퍼</td>
			<td>5 X</td>
			<td>5</td>
			<td>1 X</td>
		</tr>
<tr>
<td>Deoxynucleotides (dNTPs)</td>
			<td>200 Μ M</td>
			<td>0.5</td>
			<td>4 Μ M</td>
		</tr>
<tr>
<td>템플릿 (야생-타입 (WT))</td>
			<td>2 ng / µ l</td>
			<td>0.5</td>
			<td>1 기 (총)</td>
		</tr>
<tr>
<td>뇌관 (Fwd)</td>
			<td>20 Μ M</td>
			<td>0.625</td>
			<td>500 nM</td>
		</tr>
<tr>
<td>뇌관 (계)</td>
			<td>20 Μ M</td>
			<td>0.625</td>
			<td>500 nM</td>
		</tr>
<tr>
<td>고 충실도 DNA 중 합 효소</td>
			<td>2 U/Μ L</td>
			<td>0.25</td>
			<td>0.5 U (총)</td>
		</tr>
</tbody></table>표 2: 사이트 지시 된 mutagenesis에 대 한 PCR의 구성 요소. 구성 요소에 있는 나열 된 순서 대로, 반응 시작 될 때까지 얼음에 보관 하는 혼합물에 추가 되어야 합니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td></td>
			<td>단계</td>
			<td>온도 (° C)</td>
			<td>시간</td>
		</tr>
<tr>
<td>초기 변성</td>
			<td>1</td>
			<td>98</td>
			<td>30 s</td>
		</tr>
<tr>
<td>변성</td>
			<td>2</td>
			<td>98</td>
			<td>10 s</td>
		</tr>
<tr>
<td>어 닐 링</td>
			<td>3</td>
			<td>(Tm 템플릿) * + 1</td>
			<td>20 s</td>
		</tr>
<tr>
<td>확장</td>
			<td>4</td>
			<td>72</td>
			<td>30 s/kilobase (kb) (4 분)</td>
		</tr>
<tr>
<td>사이클링</td>
			<td colspan="3">5 (35 주기 총 2 단계로 이동)</td>
		</tr>
<tr>
<td>마지막 확장</td>
			<td>6</td>
			<td>72</td>
			<td>5 분</td>
		</tr>
<tr>
<td>보류</td>
			<td>7</td>
			<td>12</td>
			<td>보류</td>
		</tr>
<tr>
<td colspan="4">*-뇌관 쌍의 낮은 Tm 템플릿 선택</td>
		</tr>
</tbody></table>표 3: PCR에 대 한 제안된 자전거 매개 변수. 제안 된 매개 변수는 좋은 출발점 나타내지만 최적화 필요할 수 있습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관</td>
			<td>어 닐 링 위치</td>
			<td>시퀀스 (5' 3')</td>
		</tr>
<tr>
<td>1</td>
			<td>CMV 발기인</td>
			<td>CGCAAATGGGCGGTAGGCGTG</td>
		</tr>
<tr>
<td>2</td>
			<td>PCSK9 A95</td>
			<td>TCTCGCAGTCAGAGCGCAC</td>
		</tr>
<tr>
<td>3</td>
			<td>NLuc의 C-터미널</td>
			<td>TGTGCGAACGCATTCTGGCG</td>
		</tr>
<tr>
<td>4</td>
			<td>PCSK9 C301</td>
			<td>GCCAGCGCCTGGCTAGG</td>
		</tr>
<tr>
<td>5</td>
			<td>PCSK9 E501</td>
			<td>GAGGCCCAAGGGGGCAAG</td>
		</tr>
</tbody></table>표 4: 뇌관 시퀀싱에 대 한 검증. 각 뇌관은이 방법에서 참조 하는 플라스 미드의 코딩 영역을 시퀀싱에 성공적으로 사용 되었습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>구성 요소 (재고)</td>
			<td>비-용균성 (매체)</td>
			<td>용균성 (셀)</td>
			<td>96 웰 (1 접시)에 대 한 금액</td>
		</tr>
<tr>
<td>나트륨 하는데 (3 M)</td>
			<td>300 mM</td>
			<td>300 mM</td>
			<td>700 Μ L</td>
		</tr>
<tr>
<td>NaCl (5m)</td>
			<td>5 mM</td>
			<td>5 mM</td>
			<td>7 Μ L</td>
		</tr>
<tr>
<td>BSA (10mg/mL, 1%)</td>
			<td>0.10%</td>
			<td>-</td>
			<td>700 Μ L</td>
		</tr>
<tr>
<td>트라이 톤 X-100</td>
			<td>-</td>
			<td>0.10%</td>
			<td>7 Μ L</td>
		</tr>
<tr>
<td>PBS</td>
			<td>50 µ L/잘 하</td>
			<td>50 µ L/잘 하</td>
			<td>7000 µ L를</td>
		</tr>
<tr>
<td colspan="4">0.22 μ m 멤브레인을 통해 필터링 하 고 신선한 관으로 여과 액의 5880 µ L를 전송</td>
		</tr>
<tr>
<td>Coelenterazine (2 mM)</td>
			<td>40 Μ M</td>
			<td>40 Μ M</td>
			<td>120 Μ L</td>
		</tr>
<tr>
<td></td>
			<td></td>
			<td></td>
			<td>전체 용량: 6000 µ L</td>
		</tr>
</tbody></table>표 5: luciferase 판독에 대 한 2 x coelenterazine 시 약의 구성 요소. 용균성 비 및 용균성 시 약이 되므로 별도로 평가 하 조절된 매체 transfected 세포 분석은 각 잘 필요 합니다. 시 약은 혼합 하 고는 coelenterazine의 추가 사전 필터링. Coelenterazine 추가 후 사용을 위한 준비까지 시 빛 으로부터 보호 합니다.

Watch this Scientific Journal Video about A High-Throughput Luciferase Assay to Evaluate Proteolysis of the Single-Turnover Protease PCSK9 at JoVE.com

A High-Throughput Luciferase Assay to Evaluate Proteolysis of the Single-Turnover Protease PCSK9

단일-매출 Protease PCSK9의 베이스를 평가 하는 높은 처리량 Luciferase 분석 결과

이 프로토콜 셀룰러 맥락에서 본질적으로 낮은 활동, 단일 매출 효소의 분해 활동을 평가 하는 메서드를 제공 합니다. 특히,이 메서드는 PCSK9, 그 분해 활동은 그것의 궁극적인 노인 기능에 필요한 지질 대사의 핵심 드라이버의 분해 활동을 평가에 적용 됩니다.

Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a single-turnover protease which regulates serum low-density lipoprotein (LDL) levels and, ...

a-high-throughput-luciferase-assay-to-evaluate-proteolysis-single

Nanyang Technological University

Research

JoVE Journal

Biochemistry

8.0K 조회수.  Zuckerberg San Francisco General and University of California San Francisco. 이 프로토콜 셀룰러 맥락에서 본질적으로 낮은 활동, 단일 매출 효소의 분해 활동을 평가 하는 메서드를 제공 합니다. 특히,이 메서드는 PCSK9, 그 분해 활동은 그것의 궁극적인 노인 기능에 필요한 지질 대사의 핵심 드라이버의 분해 활동을 평가에 적용 됩니다.

비디오: A High-Throughput Luciferase Assay to Evaluate Proteolysis of the Single-Turnover Protease PCSK9

High-throughput Screening of Carbohydrate-degrading Enzymes Using Novel Insoluble Chromogenic Substrate Assay Kits

Carbohydrates active enzymes (CAZymes) have multiple roles in vivo and are widely used for industrial processing in the biofuel, textile, detergent, paper and food industries. A deeper understanding of CAZymes is important from both fundamental biology and industrial standpoints. Vast numbers of CAZymes exist in nature (especially in microorganisms) and hundreds of thousands have been cataloged and described in the carbohydrate active enzyme database (CAZy). However, the rate of discovery of putative enzymes has outstripped our ability to biochemically characterize their activities. One reason for this is that advances in genome and transcriptome sequencing, together with associated bioinformatics tools allow for rapid identification of candidate CAZymes, but technology for determining an enzyme's biochemical characteristics has advanced more slowly. To address this technology gap, a novel high-throughput assay kit based on insoluble chromogenic substrates is described here. Two distinct substrate types were produced: Chromogenic Polymer Hydrogel (CPH) substrates (made from purified polysaccharides and proteins) and Insoluble Chromogenic Biomass (ICB) substrates (made from complex biomass materials). Both CPH and ICB substrates are provided in a 96-well high-throughput assay system. The CPH substrates can be made in four different colors, enabling them to be mixed together and thus increasing assay throughput. The protocol describes a 96-well plate assay and illustrates how this assay can be used for screening the activities of enzymes, enzyme cocktails, and broths.

A high-throughput assay for enzyme screening is described. This multiplexed ready-to-use assay kit comprises of pre-chosen Chromogenic Polymer Hydrogel (CPH) substrates and complex Insoluble Chromogenic Biomass (ICB) substrates. Target enzymes are polysaccharide degrading endo-enzymes and proteases.

소설 불용성 발색 기질 분석 키트를 사용하여 탄수화물 분해 효소의 높은 처리량 검열

Carbohydrates active enzymes (CAZymes) have multiple roles in vivo and are widely used for industrial processing in the biofuel, textile, detergent, paper ...

연구

생화학

Method for Identifying Small Molecule Inhibitors of the Protein-protein Interaction Between HCN1 and TRIP8b

Hyperpolarization-activated cyclic nucleotide-gated (HCN) channels are expressed ubiquitously throughout the brain, where they function to regulate the excitability of neurons. The subcellular distribution of these channels in pyramidal neurons of hippocampal area CA1 is regulated by tetratricopeptide repeat-containing Rab8b interacting protein (TRIP8b), an auxiliary subunit. Genetic knockout of HCN pore forming subunits or TRIP8b, both lead to an increase in antidepressant-like behavior, suggesting that limiting the function of HCN channels may be useful as a treatment for Major Depressive Disorder (MDD). Despite significant therapeutic interest, HCN channels are also expressed in the heart, where they regulate rhythmicity. To circumvent off-target issues associated with blocking cardiac HCN channels, our lab has recently proposed targeting the protein-protein interaction between HCN and TRIP8b in order to specifically disrupt HCN channel function in the brain. TRIP8b binds to HCN pore forming subunits at two distinct interaction sites, although here the focus is on the interaction between the tetratricopeptide repeat (TPR) domains of TRIP8b and the C terminal tail of HCN1. In this protocol, an expanded description of a method for purifying TRIP8b and executing a high throughput screen to identify small molecule inhibitors of the interaction between HCN and TRIP8b, is described. The method for high throughput screening utilizes a Fluorescence Polarization (FP) -based assay to monitor the binding of a large TRIP8b fragment to a fluorophore-tagged eleven amino acid peptide corresponding to the HCN1 C terminal tail. This method allows &#39;hit&#39; compounds to be identified based on the change in the polarization of emitted light. Validation assays are then performed to ensure that &#39;hit&#39; compounds are not artifactual.

The interaction between HCN channels and their auxiliary subunit has been identified as a therapeutic target in Major Depressive Disorder. Here, a fluorescence polarization-based method for identifying small molecule inhibitors of this protein-protein interaction, is presented.

방법 및 HCN1 TRIP8b 간의 단백질 - 단백질 상호 작용의 작은 분자 억제제 식별

Hyperpolarization-activated cyclic nucleotide-gated (HCN) channels are expressed ubiquitously throughout the brain, where they function to regulate the ...

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages for identifying biologically active chemical structures that can modify complex phenotypes such as lifespan. Described here is a simple protocol for producing hundreds of 96-well culture plates with fairly consistent numbers of C. elegans in each well. Next, we specified how to use these cultures to screen thousands of chemicals for effects on the lifespan of the nematode C. elegans. This protocol makes use of temperature sensitive sterile strains, agar plate conditions, and simple animal handling to facilitate the rapid and high throughput production of synchronized animal cultures for screening.

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Here we describe a simple protocol for rapidly producing hundreds of nematode growth media agar, 96-well culture plates with consistent numbers of Caenorhhabditis elegans per well. These cultures are useful for the phenotypic screening of whole organisms. We focus here on using these cultures to screen chemicals for pro-longevity effects.

꼬마 선 충 에서 높은 처리량 화학 심사 하는 간단한 방법

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages ...

Use of Recombinant Fusion Proteins in a Fluorescent Protease Assay Platform and Their In-gel Renaturation

Proteases are intensively studied enzymes due to their essential roles in several biological pathways of living organisms and in pathogenesis; therefore, they are important drug targets. We have developed a magnetic-agarose-bead-based assay platform for the investigation of proteolytic activity, which is based on the use of recombinant fusion protein substrates. In order to demonstrate the use of this assay system, a protocol is presented on the example of human immunodeficiency virus type 1 (HIV-1) protease. The introduced assay platform can be utilized efficiently in the biochemical characterization of proteases, including enzyme activity measurements in mutagenesis, kinetic, inhibition, or specificity studies, and it may be suitable for high-throughput substrate screening or may be adapted to other proteolytic enzymes.
In this assay system, the applied substrates contain N-terminal hexahistidine (His6) and maltose-binding protein (MBP) tags, cleavage sites for tobacco etch virus (TEV) and HIV-1 proteases, and a C-terminal fluorescent protein. The substrates can be efficiently produced in Escherichia coli cells and easily purified using nickel (Ni)-chelate-coated beads. During the assay, the proteolytic cleavage of bead-attached substrates leads to the release of fluorescent cleavage fragments, which can be measured by fluorimetry. Additionally, cleavage reactions can be analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). A protocol for the in-gel renaturation of assay components is also described, as partial renaturation of fluorescent proteins enables their detection based on molecular weight and fluorescence.

Here, we present the detailed procedure of a recently developed protease assay platform utilizing N-terminal hexahistidine/maltose-binding protein and fluorescent protein-fused recombinant substrates attached to the surface of nickel-nitrilotriacetic acid magnetic agarose beads. A subsequent in-gel analysis of the assay samples separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is also presented.

형광 효소 분석 결과 플랫폼에 그들의에서 젤 Renaturation 재조합 융합 단백질의 사용

Proteases are intensively studied enzymes due to their essential roles in several biological pathways of living organisms and in pathogenesis; therefore, ...

A Semi-High-Throughput Adaptation of the NADH-Coupled ATPase Assay for Screening Small Molecule Inhibitors

ATPase enzymes utilize the free energy stored in adenosine triphosphate to catalyze a wide variety of endergonic biochemical processes in vivo that would not occur spontaneously. These proteins are crucial for essentially all aspects of cellular life, including metabolism, cell division, responses to environmental changes and movement. The protocol presented here describes a nicotinamide adenine dinucleotide (NADH)-coupled ATPase assay that has been adapted to semi-high throughput screening of small molecule ATPase inhibitors. The assay has been applied to cardiac and skeletal muscle myosin II's, two actin-based molecular motor ATPases, as a proof of principle. The hydrolysis of ATP is coupled to the oxidation of NADH by enzymatic reactions in the assay. First, the ADP generated by the ATPase is regenerated to ATP by pyruvate kinase (PK). PK catalyzes the transition of phosphoenolpyruvate (PEP) to pyruvate in parallel. Subsequently, pyruvate is reduced to lactate by lactate dehydrogenase (LDH), which catalyzes the oxidation of NADH in parallel. Thus, the decrease in ATP concentration is directly correlated to the decrease in NADH concentration, which is followed by change to the intrinsic fluorescence of NADH. As long as PEP is available in the reaction system, the ADP concentration remains very low, avoiding inhibition of the ATPase enzyme by its own product. Moreover, the ATP concentration remains nearly constant, yielding linear time courses. The fluorescence is monitored continuously, which allows for easy estimation of the quality of data and helps to filter out potential artifacts (e.g., arising from compound precipitation or thermal changes).

A nicotinamide adenine dinucleotide (NADH)-coupled ATPase assay has been adapted to semihigh throughput screening of small molecule myosin inhibitors. This kinetic assay is run in a 384-well microplate format with total reaction volumes of only 20 &#181;L per well. The platform should be applicable to virtually any ADP producing enzyme.

소분자 억제제 스크리닝을 위한 NADH 결합 ATPase 분석의 반 높은 처리량 적응

ATPase enzymes utilize the free energy stored in adenosine triphosphate to catalyze a wide variety of endergonic biochemical processes in vivo that would ...

High-Throughput Total Internal Reflection Fluorescence and Direct Stochastic Optical Reconstruction Microscopy Using a Photonic Chip

Total internal reflection fluorescence (TIRF) is commonly used in single molecule localization based super-resolution microscopy as it gives enhanced contrast due to optical sectioning. The conventional approach is to use high numerical aperture microscope TIRF objectives for both excitation and collection, severely limiting the field of view and throughput. We present a novel approach to generating TIRF excitation for imaging with optical waveguides, called chip-based nanoscopy. The aim of this protocol is to demonstrate how chip-based imaging is performed in an already built setup. The main advantage of chip-based nanoscopy is that the excitation and collection pathways are decoupled. Imaging can then be done with a low magnification lens, resulting in large field of view TIRF images, at the price of a small reduction in resolution. Liver sinusoidal endothelial cells (LSECs) were imaged using direct stochastic optical reconstruction microscopy (dSTORM), showing a resolution comparable to traditional super-resolution microscopes. In addition, we demonstrate the high-throughput capabilities by imaging a 500 &#181;m x 500 &#181;m region with a low magnification lens, providing a resolution of 76 nm. Through its compact character, chip-based imaging can be retrofitted into most common microscopes and can be combined with other on-chip optical techniques, such as on-chip sensing, spectroscopy, optical trapping, etc. The technique is thus ideally suited for high throughput 2D super-resolution imaging, but also offers great opportunities for multi-modal analysis.

Chip-based super-resolution optical microscopy is a novel approach to fluorescence microscopy and offers advantages in cost effectiveness and throughput. Here, the protocols for chip preparation and imaging are shown for TIRF microscopy and localization-based super-resolution microscopy.

포토닉 칩을 사용한 고처리량 총 내부 반사 형광 및 직접 적층 광학 재건 현미경

Total internal reflection fluorescence (TIRF) is commonly used in single molecule localization based super-resolution microscopy as it gives enhanced ...

Click-Chemistry Based Fluorometric Assay for Apolipoprotein N-acyltransferase from Enzyme Characterization to High-Throughput Screening

Lipoproteins from proteobacteria are posttranslationally modified by fatty acids derived from membrane phospholipids by the action of three integral membrane enzymes, resulting in triacylated proteins. The first step in the lipoprotein modification pathway involves the transfer of a diacylglyceryl group from phosphatidylglycerol onto the prolipoprotein, resulting in diacylglyceryl prolipoprotein. In the second step, the signal peptide of prolipoprotein is cleaved, forming an apolipoprotein, which in turn is modified by a third fatty acid derived from a phospholipid. This last step is catalyzed by apolipoprotein N-acyltransferase (Lnt). The lipoprotein modification pathway is essential in most &#947;-proteobacteria, making it a potential target for the development of novel antibacterial agents. Described here is a sensitive assay for Lnt that is compatible with high-throughput screening of small inhibitory molecules. The enzyme and substrates are membrane-embedded molecules; therefore, the development of an in vitro test is not straightforward. This includes the purification of the active enzyme in the presence of detergent, the availability of alkyne-phospholipids and diacylglyceryl peptide substrates, and the reaction conditions in mixed micelles. Furthermore, in order to use the activity test in a high-throughput screening (HTS) setup, direct readout of the reaction product is preferred over coupled enzymatic reactions. In this fluorometric enzyme assay, the alkyne-triacylated peptide product is rendered fluorescent through a click-chemistry reaction and detected in a multiwell plate format. This method is applicable to other acyltransferases that use fatty acid-containing substrates, including phospholipids and acyl-CoA.

Presented here is a sensitive fluorescence assay to monitor apolipoprotein N-acyltransferase activity using diacylglyceryl peptide and alkyne-phospholipids as substrates with click-chemistry.

효소 특성화에서 고처리량 스크리닝까지 아포지단백질 N-아실트랜스퍼라제에 대한 클릭 화학 기반 형광 분석

Lipoproteins from proteobacteria are posttranslationally modified by fatty acids derived from membrane phospholipids by the action of three integral ...

A High-Throughput Enzyme-Coupled Activity Assay to Probe Small Molecule Interaction with the dNTPase SAMHD1

Sterile alpha motif and HD domain-containing protein 1 (SAMHD1) is a pivotal regulator of intracellular deoxynucleoside triphosphate (dNTP) pools, as this enzyme can hydrolyze dNTPs into their corresponding nucleosides and inorganic triphosphates. Due to its critical role in nucleotide metabolism, its association to several pathologies, and its role in therapy resistance, intense research is currently being carried out for a better understanding of both the regulation and cellular function of this enzyme. For this reason, development of simple and inexpensive high-throughput amenable methods to probe small molecule interaction with SAMHD1, such as allosteric regulators, substrates, or inhibitors, is vital. To this purpose, the enzyme-coupled malachite green assay is a simple and robust colorimetric assay that can be deployed in a 384-microwell plate format allowing the indirect measurement of SAMHD1 activity. As SAMHD1 releases the triphosphate group from nucleotide substrates, we can couple a pyrophosphatase activity to this reaction, thereby producing inorganic phosphate, which can be quantified by the malachite green reagent through the formation of a phosphomolybdate malachite green complex. Here, we show the application of this methodology to characterize known inhibitors of SAMHD1 and to decipher the mechanisms involved in SAMHD1 catalysis of non-canonical substrates and regulation by allosteric activators, exemplified by nucleoside-based anticancer drugs. Thus, the enzyme-coupled malachite green assay is a powerful tool to study SAMHD1, and furthermore, could also be utilized in the study of several enzymes which release phosphate species.

SAMHD1 is a deoxynucleoside triphosphate triphosphohydrolase with critical roles in human health and disease. Here we present a versatile enzyme-coupled SAMHD1 activity assay, deployed in a 384-well microplate format, that allows for the evaluation of small molecules and nucleotide analogues as SAMHD1 substrates, activators, and inhibitors.

dNTPase SAMHD1과의 저분자 상호작용을 프로브하기 위한 고처리량 효소 결합 활성 분석

Sterile alpha motif and HD domain-containing protein 1 (SAMHD1) is a pivotal regulator of intracellular deoxynucleoside triphosphate (dNTP) pools, as this ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening (HTS) of random small molecule libraries against GPCRs is used by the pharmaceutical industry for target-specific drug discovery. In this study, an HTS was employed to identify novel small-molecule ligands of invertebrate-specific neuropeptide GPCRs as probes for physiological studies of vectors of deadly human and veterinary pathogens.
The invertebrate-specific kinin receptor was chosen as a target because it regulates many important physiological processes in invertebrates, including diuresis, feeding, and digestion. Furthermore, the pharmacology of many invertebrate GPCRs is poorly characterized or not characterized at all; therefore, the differential pharmacology of these groups of receptors with respect to the related GPCRs in other metazoans, especially humans, adds knowledge to the structure-activity relationships of GPCRs as a superfamily. An HTS assay was developed for cells in 384-well plates for the discovery of ligands of the kinin receptor from the cattle fever tick, or southern cattle tick, Rhipicephalus microplus. The tick kinin receptor was stably expressed in CHO-K1 cells.
The kinin receptor, when activated by endogenous kinin neuropeptides or other small molecule agonists, triggers Ca2+ release from calcium stores into the cytoplasm. This calcium fluorescence assay combined with a &#34;dual-addition&#34; approach can detect functional agonist and antagonist &#34;hit&#34; molecules in the same assay plate. Each assay was conducted using drug plates carrying an array of 320 random small molecules. A reliable Z&#39; factor of 0.7 was obtained, and three agonist and two antagonist hit molecules were identified when the HTS was at a 2 &#181;M final concentration. The calcium fluorescence assay reported here can be adapted to screen other GPCRs that activate the Ca2+ signaling cascade.

In this work, a high-throughput, intracellular calcium fluorescence assay for 384-well plates to screen small molecule libraries on recombinant G protein-coupled receptors (GPCRs) is described. The target, the kinin receptor from the cattle fever tick, Rhipicephalus microplus, is expressed in CHO-K1 cells. This assay identifies agonists and antagonists using the same cells in one "dual-addition" assay.

재조합 G 단백질 결합 수용체의 고처리량 스크리닝을 위한 "이중 첨가" 칼슘 형광 분석

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

단백질 결정화를 위한 고처리량 스크리닝

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into an ordered lattice amenable to diffraction remains challenging. The crystallization of biomolecules is largely experimentally defined, and this process can be labor-intensive and prohibitive to researchers at resource-limited institutions. At the National High-Throughput Crystallization (HTX) Center, highly reproducible methods have been implemented to facilitate crystal growth, including an automated high-throughput 1,536-well microbatch-under-oil plate setup designed to sample a wide breadth of crystallization parameters. Plates are monitored using state-of-the-art imaging modalities over the course of 6 weeks to provide insight into crystal growth, as well as to accurately distinguish valuable crystal hits. Furthermore, the implementation of a trained artificial intelligence scoring algorithm for identifying crystal hits, coupled with an open-source, user-friendly interface for viewing experimental images, streamlines the process of analyzing crystal growth images. Here, the key procedures and instrumentation are described for the preparation of the cocktails and crystallization plates, imaging the plates, and identifying hits in a way that ensures reproducibility and increases the likelihood of successful crystallization.

저자 스포트라이트: 단백질 결정학을 위한 결정 적중을 얻기 위한 고처리량 스크리닝  

This protocol details high-throughput crystallization screening, ranging from the 1,536 microassay plate preparation to the end of a 6 week experimental time window. Details are included about the sample setup, the imaging obtained, and how users can perform analyses using an artificial intelligence-enabled graphical user interface to quickly and efficiently identify macromolecular crystallization conditions.

단백질 결정학을 위한 결정 적중을 얻기 위한 고처리량 스크리닝

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...