저자는 인간을 제공 하기 위한 스탠포드 대학에서 윌리엄 탤벗에 감사를 표현 하 고 싶습니다 Nrg1 cDNA를 제공 하기 위한 UCSD에서 데보라 Yelon는 wea 돌연변이입니다. 저자 또한 이미지 수집 도와주 신 시아 첸을 감사 하 고 싶습니다. 이 연구 보조금 NIH HL118650 (T.K. Hsiai)에 의해 지원 되었다 (T.K. Hsiai)에 HL083015, HD069305 (하려면 노스캐롤라이나 치 T.K. Hsiai.), HL111437 (T.K. Hsiai 노스캐롤라이나 치)를, (T.K. Hsiai)에 HL129727, T32HL007895 (R.R. Sevag Packard)에, HL 134613 (V. Messerschmidt) 하 고 텍사스 시스템 별 자금 (현)의 대학.

<ol>
	<li>Lee, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moving+domain+computational+fluid+dynamics+to+interface+with+an+embryonic+model+of+cardiac+morphogenesis.">Moving domain computational fluid dynamics to interface with an embryonic model of cardiac morphogenesis.</a> PLoS One. 8 (8), e72924 (2013).</li><li>Peshkovsky, C., Totong, R., Yelon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dependence+of+cardiac+trabeculation+on+neuregulin+signaling+and+blood+flow+in+zebrafish.">Dependence of cardiac trabeculation on neuregulin signaling and blood flow in zebrafish.</a> Dev Dyn. 240 (2), 446-456 (2011).</li><li>High, F. A., Epstein, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multifaceted+role+of+Notch+in+cardiac+development+and+disease.">The multifaceted role of Notch in cardiac development and disease.</a> Nat Rev Genet. 9 (1), 49-61 (2008).</li><li>Galloway, J. L., Wingert, R. A., Thisse, C., Thisse, B., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+Gata1+but+Not+Gata2+Converts+Erythropoiesis+to+Myelopoiesis+in+Zebrafish+Embryos.">Loss of Gata1 but Not Gata2 Converts Erythropoiesis to Myelopoiesis in Zebrafish Embryos.</a> Developmental Cell. 8 (1), 109-116 (2005).</li><li>Chi, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+conduction+is+required+to+preserve+cardiac+chamber+morphology.">Cardiac conduction is required to preserve cardiac chamber morphology.</a> Proceedings of the National Academy of Sciences. 107 (33), 14662 (2010).</li><li>Paffett-Lugassy, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+conservation+of+erythropoietin+signaling+in+zebrafish.">Functional conservation of erythropoietin signaling in zebrafish.</a> Blood. 110 (7), 2718 (2007).</li><li>De Luca, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZebraBeat:+a+flexible+platform+for+the+analysis+of+the+cardiac+rate+in+zebrafish+embryos.">ZebraBeat: a flexible platform for the analysis of the cardiac rate in zebrafish embryos.</a> Scientific Reports. 4, 4898 (2014).</li><li>Liu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+dual+role+for+ErbB2+signaling+in+cardiac+trabeculation.">A dual role for ErbB2 signaling in cardiac trabeculation.</a> Development. 137 (22), 3867-3875 (2010).</li><li>Samsa, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+contraction+activates+endocardial+Notch+signaling+to+modulate+chamber+maturation+in+zebrafish.">Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish.</a> Development. 142 (23), 4080-4091 (2015).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+genetic+analysis+in+mice+unveils+central+role+for+cilia+in+congenital+heart+disease.">Global genetic analysis in mice unveils central role for cilia in congenital heart disease.</a> Nature. 521, 520 (2015).</li><li>Sifrim, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+genetic+architectures+for+syndromic+and+nonsyndromic+congenital+heart+defects+identified+by+exome+sequencing.">Distinct genetic architectures for syndromic and nonsyndromic congenital heart defects identified by exome sequencing.</a> Nature Genetics. 48, 1060 (2016).</li><li>Hu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genome-wide+association+study+identifies+two+risk+loci+for+congenital+heart+malformations+in+Han+Chinese+populations.">A genome-wide association study identifies two risk loci for congenital heart malformations in Han Chinese populations.</a> Nature Genetics. 45, 818 (2013).</li><li>Huisken, J., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plane+illumination+microscopy+techniques+in+developmental+biology.">Selective plane illumination microscopy techniques in developmental biology.</a> Development (Cambridge, England). 136 (12), 1963-1975 (2009).</li><li>Panier, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+functional+imaging+of+multiple+brain+regions+in+intact+zebrafish+larvae+using+Selective+Plane+Illumination+Microscopy.">Fast functional imaging of multiple brain regions in intact zebrafish larvae using Selective Plane Illumination Microscopy.</a> Frontiers in Neural Circuits. 7, 65 (2013).</li><li>Lee, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ACT-PRESTO:+Rapid+and+consistent+tissue+clearing+and+labeling+method+for+3-dimensional+(3D)+imaging.">ACT-PRESTO: Rapid and consistent tissue clearing and labeling method for 3-dimensional (3D) imaging.</a> Scientific Reports. 6, 18631 (2016).</li><li>Kelley, L. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live-cell+confocal+microscopy+and+quantitative+4D+image+analysis+of+anchor-cell+invasion+through+the+basement+membrane+in+Caenorhabditis+elegans.">Live-cell confocal microscopy and quantitative 4D image analysis of anchor-cell invasion through the basement membrane in Caenorhabditis elegans.</a> Nature Protocols. 12, 2081 (2016).</li><li>Lee, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=4-Dimensional+light-sheet+microscopy+to+elucidate+shear+stress+modulation+of+cardiac+trabeculation.">4-Dimensional light-sheet microscopy to elucidate shear stress modulation of cardiac trabeculation.</a> The Journal of Clinical Investigation. 126 (5), 1679-1690 (2016).</li><li>Lavagnino, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=4D+(x-y-z-t)+imaging+of+thick+biological+samples+by+means+of+Two-Photon+inverted+Selective+Plane+Illumination+Microscopy+(2PE-iSPIM).">4D (x-y-z-t) imaging of thick biological samples by means of Two-Photon inverted Selective Plane Illumination Microscopy (2PE-iSPIM).</a> Scientific Reports. 6, 23923 (2016).</li><li>Huisken, J., Swoger, J., Del Bene, F., Wittbrodt, J., Stelzer, E. H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+Sectioning+Deep+Inside+Live+Embryos+by+Selective+Plane+Illumination+Microscopy.">Optical Sectioning Deep Inside Live Embryos by Selective Plane Illumination Microscopy.</a> Science. 305 (5686), 1007 (2004).</li><li>Hove, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracardiac+fluid+forces+are+an+essential+epigenetic+factor+for+embryonic+cardiogenesis.">Intracardiac fluid forces are an essential epigenetic factor for embryonic cardiogenesis.</a> Nature. 421 (6919), 172-177 (2003).</li><li>Bakkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+as+a+model+to+study+cardiac+development+and+human+cardiac+disease.">Zebrafish as a model to study cardiac development and human cardiac disease.</a> Cardiovascular Research. 91 (2), 279-288 (2011).</li><li>BioRad. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> General Protocol for Western Blotting. 6376, (2018).</li><li>GeneTools. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene Tools Oligo Design Website. , (2018).</li><li>Mullins, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zebrafish Course. , (2013).</li><li>Grenander, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Probability and Statistics: The Harald Cram&#233;r Volume. , (1959).</li><li>Fei, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+Light-Sheet+Fluorescent+Microscopy+for+Multi-Scale+and+Rapid+Imaging+of+Architecture+and+Function.">Cardiac Light-Sheet Fluorescent Microscopy for Multi-Scale and Rapid Imaging of Architecture and Function.</a> Scientific Reports. 6, 22489 (2016).</li><li>Liebling, M., Forouhar , A. S., Gharib, M., Fraser, S. E., Dickinson, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Four-dimensional+cardiac+imaging+in+living+embryos+via+postacquisition+synchronization+of+nongated+slice+sequences.">Four-dimensional cardiac imaging in living embryos via postacquisition synchronization of nongated slice sequences.</a> Journal of Biomedical Optics. 10 (5), (2005).</li><li>Adeoye, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+effects+of+exogenous+enzymes+and+probiotic+on+Nile+tilapia+(Oreochromis+niloticus)+growth,+intestinal+morphology+and+microbiome.">Combined effects of exogenous enzymes and probiotic on Nile tilapia (Oreochromis niloticus) growth, intestinal morphology and microbiome.</a> Aquaculture. 463, 61-70 (2016).</li><li>Matthews, M., Varga, Z. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anesthesia+and+Euthanasia+in+Zebrafish.">Anesthesia and Euthanasia in Zebrafish.</a> ILAR Journal. 53 (2), 192-204 (2012).</li><li>Singleman, C., Holtzman, N. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart+Dissection+in+Larval,+Juvenile+and+Adult+Zebrafish,+Danio+rerio.">Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio.</a> Journal of Visualized Experiments : JoVE. (55), e3165 (2011).</li><li>Li, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disturbed+Flow+Induces+Autophagy,+but+Impairs+Autophagic+Flux+to+Perturb+Mitochondrial+Homeostasis.">Disturbed Flow Induces Autophagy, but Impairs Autophagic Flux to Perturb Mitochondrial Homeostasis.</a> Antioxidants &amp; Redox Signaling. 23 (15), 1207-1219 (2015).</li><li>Li, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear+Stress-Activated+Wnt-Angiopoietin-2+Signaling+Recapitulated+Vascular+Repair+in+Zebrafish+Embryos.">Shear Stress-Activated Wnt-Angiopoietin-2 Signaling Recapitulated Vascular Repair in Zebrafish Embryos.</a> Arteriosclerosis, thrombosis, and vascular biology. 34 (10), 2268-2275 (2014).</li><li>Baek, K. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow-Responsive+Vascular+Endothelial+Growth+Factor+Receptor-Protein+Kinase+C+Isoform+Epsilon+Signaling+Mediates+Glycolytic+Metabolites+for+Vascular+Repair.">Flow-Responsive Vascular Endothelial Growth Factor Receptor-Protein Kinase C Isoform Epsilon Signaling Mediates Glycolytic Metabolites for Vascular Repair.</a> Antioxidants &amp; Redox Signaling. 28 (1), 31-43 (2018).</li><li>Huang, C. J., Tu, C. T., Hsiao, C. D., Hsieh, F. J., Tsai, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ-line+transmission+of+a+myocardium-specific+GFP+transgene+reveals+critical+regulatory+elements+in+the+cardiac+myosin+light+chain+2+promoter+of+zebrafish.">Germ-line transmission of a myocardium-specific GFP transgene reveals critical regulatory elements in the cardiac myosin light chain 2 promoter of zebrafish.</a> Developmental Dynamics. 228 (1), 30-40 (2003).</li><li>Vermot, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reversing+blood+flows+act+through+klf2a+to+ensure+normal+valvulogenesis+in+the+developing+heart.">Reversing blood flows act through klf2a to ensure normal valvulogenesis in the developing heart.</a> PLoS Biol. 7 (11), (2009).</li><li>Grego-Bessa, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+is+essential+for+ventricular+chamber+development.">Notch signaling is essential for ventricular chamber development.</a> Dev Cell. 12 (3), 415-429 (2007).</li><li>Berdougo, E., Coleman, H., Lee, D. H., Stainier, D. Y. R., Yelon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutation+of+weak+atrium/atrial+myosin+heavy+chain+disrupts+atrial+function+and+influences+ventricular+morphogenesis+in+zebrafish.">Mutation of weak atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular morphogenesis in zebrafish.</a> Development. 130 (24), 6121 (2003).</li><li>Arnaout, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+model+for+human+long+QT+syndrome.">Zebrafish model for human long QT syndrome.</a> Proc Natl Acad Sci U S A. 104 (27), 11316-11321 (2007).</li><li>Chi, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+and+physiologic+dissection+of+the+vertebrate+cardiac+conduction+system.">Genetic and physiologic dissection of the vertebrate cardiac conduction system.</a> PLoS Biol. 6 (5), e109 (2008).</li><li>Liao, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+gene+cloche+acts+upstream+of+a+flk-1+homologue+to+regulate+endothelial+cell+differentiation.">The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation.</a> Development. 124 (2), 381-389 (1997).</li><li>Stainier, D. Y., Weinstein, B. M., Detrich, H. W., Zon, L. I., Fishman, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloche,+an+early+acting+zebrafish+gene,+is+required+by+both+the+endothelial+and+hematopoietic+lineages.">Cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages.</a> Development. 121 (10), 3141-3150 (1995).</li><li>Santi, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light+Sheet+Fluorescence+Microscopy:+A+Review.">Light Sheet Fluorescence Microscopy: A Review.</a> Journal of Histochemistry and Cytochemistry. 59 (2), 129-138 (2011).</li><li>Engelbrecht, C. J., Stelzer, E. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resolution+enhancement+in+a+light-sheet-based+microscope+(SPIM).">Resolution enhancement in a light-sheet-based microscope (SPIM).</a> Optics Letters. 31 (10), 1477-1479 (2006).</li></ol>

저자는 공개 없다.

이 프로토콜에서 우리 4 차원 이미징 biomechanical 세력의 변화에 대 한 응답에서 배수 네트워크의 개발을 추적 하기 위해 사용 될 수 있다는 것으로 나타났습니다. 특히, 내 피 세포에 의해 경험된 전단 응력 노치 신호 폭포, 차례 차례로 trabeculation를 승진 시키는 시작 합니다. 우리는 (1) gata1a 모 사출 조 감소 하 고 따라서 벽 전단 응력 감소, (2) tnnt2a 모 사출 벽 전단 응력, 그리고 (3) wea를 줄이기 위해 심 실 수축 기능을 저해 표시는이 원고 돌연변이 부족 다음 감소는 hemodynamic 힘은 심 실 심 방 수축. 심장 벽에 전단 응력을 줄임으로써, 우리는 노치 신호 qRT-PCR을 통해 계량 하 고 감소 wss 했음을 발견 노치 신호 감소. 더 증명 하기 위해 우리의 가설, clo 돌연변이 부족 endocardium trabeculae, 형성 하지 않았다 그리고 그 전단 응력은 노치 신호 활성화 하는 것을 보여주었다 ADAM10 존재와 타악기 전단 응력을 내 피 세포를 쓰는.
Confocal 현미경 검사 법 등 다른 이미징 기술을 3 차원14이미지 샘플을 사용할 수 있습니다. 그러나,이 기술은 등 많은 단점이 있다. 예를 들어 confocal 영상 샘플에 깊이 침투 수 없습니다, 그리고 낮은 축 해상도 느린 검색 속도19,42. Confocal 영상에 침투 깊이 제한으로 인해 전체에서 zebrafish 태아 같은 작은 샘플 몇 군데 수만 수 있습니다. 두 광자 공초점 현미경 침투 깊이 향상 하지만 해상도, 느린 검색 속도, 및 높은 비용이 기법은 바람직하지 않은13. 그러나 두 광자 현미경 및 LSFM를 성공적으로 결합 하는 연구 되었습니다18,, 결점은 여전히 눈에 띄는42.
LSFM, 다른 한편으로, 최소 사진 표백 및 손상13,,1842, 빠른 수집 속도, 및 유사한 침투 깊이13있다. 또한, 듀얼 렌즈 단일 면 (그림 1)의 흥분 때문에, 배경 잡음은 크게 감소43이다. 그러나, 샘플 vivo에서 zebrafish14,,1719이외의 모델에 적용 하기 어려운 샘플을 무력화 하는 젤에 포함 될 필요가 있다. 또한, 형광 빛의 이용 제한 몇 밀리미터에 깊이 침투 합니다. LSFM는 시각화에 대 한 좋은 방법입니다, 비록 그것은 양적 데이터로 보완 중요입니다. LSFM 질적만 있기 때문에 다양 한 해석에 따라 수 있습니다. QRT-PCR를 사용 하 여, 우리 LFSM 4 차원 이미지 라이브 샘플에서 발생 하는 이벤트에 대 한 올바른 표현을 했다 확인할 수 있습니다. 때때로 더 큰 견본에 줄무늬와 그림자 이미지를 형성할 수 있다. 그러나, 이러한 유물42를 줄이기 위해 양면 조명 또는 mSPIM을 이용하실 수 있습니다. LSFM은 너무 다양 하기 때문에 높은 해상도 전반적으로 더 나은 품질의 이미지를 캡처의 능력은 LSFM 약속의 미래. 앞에서 설명한 LSFM 성공적인 이미징18,42에 대 한 다른 이미징 시스템과 결합할 수 있습니다.
우리는 이전 23 x 10-5 N 1 Hz에서 24 h에 대 한의 타악기 전단 응력을 실질적으로 적용 하는 upregulates 노치 신호 vitro에(그림 4)17시연 했다. 우리 다시 한번 입증 전단 세력 노치 신호 조 (gata1a 모)4, 심장 수축 (tnnt1a 모)5, 심 방 수축 (wea 돌연변이), endocardial의 유전자 조작에 의해 활성화 삭제 (clo 돌연변이), 그리고 노치 신호 (안내 [flk:mCherry; tp1:gfp])의 지 방화. 우리가 설명 여기에 노치 관련 유전자 아래로 (그림 2 K, L, M)은심 실 벽 전단 응력을 낮추는 방법으로 합니다. 또한, 우리는 Nrg1 mRNA trabeculation 구조, 노치 신호, 복원 수 있었다 고 심 실 분수 단축 및 방출 분 율 향상을 수 있었다 (그림 2E, F, H, K M, 그림 5) . 심장 기능의 복원 수축 기능 중재 hemodynamic 세력 활성화 노치 신호 (그림 2 KM)에 증가 의해 표시 했다.
우리는 또한 전단 응력 활성화 노치 신호 하는 것이 endocardial 종속은 결정 합니다. Gata1a 모, tnnt2a 모, wea 돌연변이 또는 AG1478 치료를 사용 하 여 trabeculation을 저해 하 고 아래로 (그림 2 KM)는노치 신호. 그러나 Nrg1 trabeculation와 wea 돌연변이에 노치 신호를 구출 하는 때 공동 gata1a 주사 모 (그림 2D, H, K, L). 벽 전단 응력 (EPO 주사) 또는 노치 신호 (10 세/nL Nrg1 주입) 증가 했다, 형태학, 측면에서 EPO 그룹에 변화 했다 하지만 비정상적인 심 실 morphogenesis Nrg1에 증가 복용량 (그림 3).
결론적으로, 우리는 전단 응력의 mechanotransduction 노치 신호 전달 경로 활성화 나타났습니다. 적용 하 여 4 차원 LSFM와 유전자 조작된 zebrafish, 우리는 새로운 개발 어떻게 중요 한 혈액의 흐름을 보여 주는 모델 시스템 그것의 형태학, 수축, 및 전반적인 기능에 심장 개발 중 이다.

An erratum was issued for:&#160;<a href="https://www-jove-com.remotexs.ntu.edu.sg/video/57763/light-sheet-fluorescence-microscopy-to-capture-4-dimensional-images">Light-sheet Fluorescence Microscopy to Capture 4-Dimensional Images of the Effects of Modulating Shear Stress on the Developing Zebrafish Heart</a>.&#160;Additional author names were added, and an author affiliation was updated.
The author list was updated from:
Victoria Messerschmidt*1, Zachary Bailey*1, Kyung In Baek2, Richard Bryant1, Rongsong Li2, Tzung K. Hsiai2, Juhyun Lee1
to:
Victoria Messerschmidt*1, Zachary Bailey*1, Kyung In Baek2, Yichen Ding2, Jeffrey J. Hsu2, Richard Bryant1, Rongsong Li2, Tzung K. Hsiai2, Juhyun Lee1
The author affiliation for Rongsong Li was updated from:
Department of Medicine (Cardiology) and Bioengineering, UCLA
to:
College of Health Science and Environmental Engineering, Shenzhen Technology University

An erratum was issued for: <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/57763/light-sheet-fluorescence-microscopy-to-capture-4-dimensional-images">Light-sheet Fluorescence Microscopy to Capture 4-Dimensional Images of the Effects of Modulating Shear Stress on the Developing Zebrafish Heart</a>. Additional&#160;author names were&#160;added, and an author affiliation was updated.

Erratum: Light-sheet Fluorescence Microscopy to Capture 4-Dimensional Images of the Effects of Modulating Shear Stress on the Developing Zebrafish Heart

Biomechanical 세력, hemodynamic 전단 응력, 같은 심장 morphogenesis에서 친밀 하 게 포함 된다. Hemodynamic 전단 세력에 대 한 응답, 심근 능선과 홈 개발 전단 응력의 방향으로 정렬에 파도 같은 배수 네트워크에 걸쳐 것 (AV) 밸브1. Trabeculation 심장 수축 기능 및 심근 질량2증가 필요가 있다. 노치 신호 통로에서 돌연변이 인간과 다른 척추 동물3에서 선 천 성 심장 결함 발생. 예를 들어, gata1a4 , tnnt2a5 morpholino oligonucleotides (MO) erythropoietin (EPO) mRNA6 및 Isoproterenol (ISO)7 증가 빨간 혈액 적혈구를 줄이기 위해 표시 되었습니다 있다 세포와 심장 박동 각각, 그리고 그러므로 전단 응력 (WSS) 벽. 또한, ErbB2 신호, 하류, 노치의 cardiomyocyte 확산 및 차례 차례로 활성화 노치 신호8,9수축 성 힘을 생성 하는 차별화를 촉진. 노치 신호 심 실 개발에 대 한 제어 trabeculation를 지배 하는 그 전단 응력이 좋습니다. 현재, 추가 선 천 성 심장 결함 (CHD)10,,1112, 선도 유전자 프로그래밍 이벤트를 이해 하려고 많은 연구 하지만 거의 조사 하는 방법 기계적인 힘 영향 형성 심장.
기계적인 힘 조사 연기 endocardium, 발달 기간 동안 가까운 관측에 구현 해야 합니다. 그러나, vivo에서 박동 때문에 전통적인 현미경 검사 법13의 판매세 샘플의 좋은 품질의 이미지를 얻기 위해 도전 이다. 샘플 내에서 시간이 지남에 개발을 관찰 하기 위해 실제 단면 및 얼룩, 따라서 필요가 발생 하는13,,1415. Confocal 현미경 검사 법은 널리 샘플14,16의 3 차원 구조를 이미지 하는 데 사용 됩니다, 비록 이러한 이미징 시스템이 인수는 여전히 느린 검색 속도 의해 제한 됩니다.
빛-시트 형광 현미경 검사 법 (LSFM)은 긴 작동 거리13동적 이벤트 vivo에서 의 시각화 수 있도록 독특한 이미징 기술입니다. 이 기술은 빛 시트 형광 현미경을 사용 하 여 광학 샘플17섹션. 샘플에 빛의 단지 얇은 시트의 조명으로 인해 사진 표백 및 사진 독성13,18에 감소가입니다. 보기 및 긴 작동 거리의 큰 분야 대형 샘플 이미지13,,1417은 그대로 남아 있습니다. 낮은 확대 긴 동안 이미지를 더 큰 영역에 대 한 허용 작업 거리 신호 대 잡음 비율을 타협 하지 않고 이미지를 두꺼운 샘플에 대 한 수 있습니다. 많은 그룹 이미지 전체 배아17LSFM 사용,14,18, 근육 및 심 혼19 다른 조직 중 몇 군데 수 샘플의 다양 한 종류를 보여주는 두뇌.
이전 연구 zebrafish 심장의 유입 또는 유출 트랙 경색으로 감소 hemodynamic 전단 힘 설명, 정보는 전적으로 질적. 그것은 결과 비정상적인 3 챔버, 저하 심장 루핑, 장애인된 밸브 대형20. 4 차원 LSFM 이미지 hemodynamic 전단 세력에 영향을 미칠 방법으로 심장 조직 개발 새로운 관점 제공 합니다. 이러한 기계적인 힘 힘 민감한 신호 분자를 활성화 하 고 배수 능선의 형성을 유발 수 있습니다. 4 차원 영상의 추가 시간 측면 때문에 하나는 개발 이전 주목 했다 새로운 폭로 이어질 수 있는 실시간으로 변경 내용을 추적할 수 있다. Zebrafish는 과학자만 세포 세포 상호 작용에 대 한 전체 척추 동물을 관찰할 수 있기 때문에 이미지에 대 한 이상적인 모델입니다. 산소 또한 포유류 개발에서와 달리 혈관 시스템에 따라 하지 않고 발생 하는 개발을 수 있는 전체 태아 통해 무마 수 있습니다. Zebrafish 심장 필요 4 연 발 심장, 폐 장기 부족 하더라도 심장 유전자가 zebrafish와 인간21사이 보존의 큰 숫자가입니다.
이 원고에 우리는 다양 한 상황에서 zebrafish 마음에 개발 trabeculae 이미지를 빛 시트 형광 현미경 검사 법을 사용 하는 방법을 설명 합니다. 첫째, 주입 gata1a4 또는 tnnt2a5 의 모스 낮은 혈액 점성을 따라서 WSS 사용 되었다. 심장의 형태학 다음 기록 했다. 물고기의 별도 그룹에서 우리 EPO mRNA6 또는 isoproterenol7 을 투여 하 여 WSS를 증가 하 고 결과 관찰 했다. 우리는 또한 다른 타악기 또는 진동 흐름 율을 가진 셀 연구를 실시. 후 각 그룹 이미징, 우리 발견 WSS 노치 통해 endocardium에 의해 감지 신호 시작 trabeculation.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Clontech Hifi PCR pre-mix&#160;</td>
			<td>Takara&#160;</td>
			<td>639298</td>
			<td>PCR mastermix 
			1.1.1.1, 1.1.1.2, 1.1.1.5, 1.1.2.1, 3.1.4</td>
		</tr>
		<tr>
			<td>Human Nrg1 cDNA</td>
			<td>Gift from William Talbot, Stanford University, Stanford, California, USA</td>
			<td>N/A</td>
			<td>Used for trabeculation rescue 
			1.1.1.3, 1.1.1.4, 1.1.2.1</td>
		</tr>
		<tr>
			<td>CFX Connect&#8482; Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>1855201</td>
			<td>PCR Machine 
			1.1.1.5, 1.1.1.6, 1.1.2.2, 1.1.3.2</td>
		</tr>
		<tr>
			<td>pCS2+</td>
			<td>GE Health</td>
			<td></td>
			<td>Plasmid used to synthesize mRNA 
			1.1.2.1, 1.1.2.4, 1.1.2.5</td>
		</tr>
		<tr>
			<td>Nucleospin purification kit&#160;&#160;</td>
			<td>Clontech</td>
			<td>740609.25</td>
			<td>DNA Purification 
			1.1.2.3, 1.1.2.4, 1.1.6.2</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>Clontech</td>
			<td>2011A</td>
			<td>PCR Ligation solution 
			1.1.2.5</td>
		</tr>
		<tr>
			<td>Stellar competent cells</td>
			<td>Clontech</td>
			<td>636763</td>
			<td>E. coli cells used for transformation 
			1.1.2.6, 1.1.3.1, 1.1.3.2</td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 transfection reagent</td>
			<td>Life Technologies</td>
			<td>11668027</td>
			<td>Transfection reagent 
			1.1.4</td>
		</tr>
		<tr>
			<td>mMessage SP6 kit</td>
			<td>Invitrogen</td>
			<td>AM1340</td>
			<td>Kit used to synthesize mRNA 
			1.1.6.3</td>
		</tr>
		<tr>
			<td>Aurum Total RNA Mini Kit</td>
			<td>Bio-Rad</td>
			<td>7326820</td>
			<td>Purifies RNA&#160; 
			1.1.6.4, 3.1.2</td>
		</tr>
		<tr>
			<td>GeneTools 4.3.8</td>
			<td>GeneTools</td>
			<td>N/A</td>
			<td>Software for primer design 
			1.2.1, 3.1.3</td>
		</tr>
		<tr>
			<td>EPO cDNA</td>
			<td>Creative Biogene</td>
			<td>CDFH006026</td>
			<td>Increases WSS 
			1.2.2, 1.2.3, 1.1.7</td>
		</tr>
		<tr>
			<td>AG1478</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>T4182</td>
			<td>ErbB inhibitor 
			1.3.1</td>
		</tr>
		<tr>
			<td>E3 medium</td>
			<td></td>
			<td></td>
			<td>To grow embryos 
			1.3.1, 1.3.2, 5.1.5</td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>D5942</td>
			<td>&#947;-secretase inhibitor 
			1.3.2</td>
		</tr>
		<tr>
			<td>Agarose&#160;</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>A9539</td>
			<td>Used for mounting embryos 
			2.1.1.1</td>
		</tr>
		<tr>
			<td>ORCA-Flash4.0 LT&#160;Digital CMOS camera</td>
			<td>Hamamatsu Photonics</td>
			<td>C11440-42U</td>
			<td>Used to capture Images 
			2.1.1.2, 2.1.1.3</td>
		</tr>
		<tr>
			<td>Amira Software</td>
			<td>FEI Software</td>
			<td>N/A</td>
			<td>Visualized and Analysed images into 3D, and 4D 
			2.1.5.1.1-2.1.5.2.8</td>
		</tr>
		<tr>
			<td>Tricaone mesylate&#160;</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>886-86-2</td>
			<td>Used to humanely sedated or sacrifice embryos 
			3.1.1</td>
		</tr>
		<tr>
			<td>iScript cDNA Synthesis Kit</td>
			<td>Bio-Rad</td>
			<td>1708890</td>
			<td>Synthesizes cDNA 
			3.1.2</td>
		</tr>
		<tr>
			<td>Eppendorf 5424 microcentrifuge</td>
			<td>Eppendorf</td>
			<td>05-400-005</td>
			<td>Microcentrifuge 
			4.1.1.3</td>
		</tr>
		<tr>
			<td>GI254023X</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>260264-93-5</td>
			<td>ADAM10 inhibitor 
			4.1.2, 4.1.3&#160;</td>
		</tr>
		<tr>
			<td>Isoprenaline hydrochloride</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>I5627</td>
			<td>Isoproterenol increases WSS 
			5.1.5</td>
		</tr>
		<tr>
			<td>MATLAB</td>
			<td>Mathworks</td>
			<td>N/A</td>
			<td>Cardiac mechanics analysis</td>
		</tr>
	</tbody>
</table>

light-sheet fluorescence microscopy to capture 4-dimensional images of the effects of modulating shear stress on the developing zebrafish heart

심장 영향 심장 개발, 특히 trabeculation, 심근에서 분기 outgrowths의 네트워크를 형성 하 여 경험 hemodynamic 세력. 캐스케이드 왼쪽 심 실 비 압축 심근 또는 Hypoplastic 좌 심 혼 증후군 같은 심 실 결함에 관련 된 신호 단계에서 결함을 유전 프로그램. 이 프로토콜을 사용 하 여, 그것은 확인할 수 있습니다 전단 응력 중심 trabeculation 및 노치 신호 서로 관련. 빛-시트 형광 현미경 검사 법을 사용 하 여, 개발 zebrafish 심장의 시각화 가능 했다. 이 원고에서 그것은 평가 되었다 hemodynamic 세력 노치 신호를 통해 trabeculation의 개시를 변조 하 고 따라서, 수축 성 기능에 영향을 미칠 여부를 발생 합니다. 정성 및 정량에 대 한 전단 응력 해석, 4 차원 (3-D + 시간) 이미지 zebrafish 심장 morphogenesis 동안 인수 했다 그리고 4 차원 동기화 통합된 빛 시트 형광 현미경 검사 법 심 실 모션 캡처. 혈액 점도 gata1a-morpholino oligonucleotides (MO) 마이크로-주입 함으로써, 전단 응력을 감소를 통해 다운 조절 노치 신호 및 trabeculation 약하게 감소 되었다. Gata1a 모와 Nrg1 mRNA의 공동 주입 노치 관련 유전자 trabeculation를 복구를 구출. 노치 신호를 구동 하는 전단 응력 영향 trabeculation 것인지 cardiomyocyte 수축 더 tnnt2a을 통해 체포 됐다-모, hemodynamic 세력을 줄이기 위해 비-trabeculated 개발 하 노치 대상 유전자 다운 규제 심근입니다. 마지막으로, 전단 응력 응답 노치 유전자의 표현 패턴의 확증 타악기 흐름에 내 피 세포를 쓰는 하 여 실시 했다. 따라서, 4 차원 빛 시트 현미경 기본 노치 신호 및 trabeculation 비 압축 심근에 임상 관련성 hemodynamic 세력 적발.

LSFM은 고해상도 2 차원 및 3 차원 사진을 얻기 위해서는이 원고에 사용 되었다. 그림 1A 및 1B에서 보듯이 조명 렌즈 빛 시트 샘플에 지시 합니다. 빛 시트의 두께, 때문에 단일 평면 조명 이다. 감지 렌즈 조명 렌즈에 수직으로 위치 이며 조명된 평면 (그림 1B)에 초점을 맞추고. 조명 렌즈에서 빛 시트 다음 왼쪽에서 오른쪽 (그림 1C) 샘플을 검색합니다. 스캔 덜 사진-표백, 사진-독성, 허용 하 고 더 낮은 신호 대 잡음 비율.
LSFM 빠른 스캐닝 (> 30 s) 복 셀 해상도 0.65 x 0.65 x 1 µ m입니다. 단일 평면 조명 때문에 의해34 전체 심장 구조 시각화 하기 위해 Tg(cmlc2a:gfp) 배아에 적용 된, 배경 잡음은 크게 감소 (그림 1). 75에서 심 실 루멘으로 배수 능선 protruded hpf, 그리고 배수 네트워크 명확 하 게 표시 했다 100 hpf (그림 2A, B). Gata1a 모 마이크로 주입 904,35조 고 점도 감소. 이 줄어든된 점도 감쇠는 지연된 개시 및 75에 배수 네트워크의 밀도 결과 hemodynamic 전단 응력, hpf와 100 hpf 제어 그룹 (그림 2 C, D)에 비해. 또한, 단계에서 (Dll4, Jag1및 Jag2), 수용 체 ligands (Notch1b), 그리고 하류 신호 구성 요소 (Nrg1 및 ErbB2) gata1a 모에 대 한 응답에서 아래로 통제 했다 주입 (p < 0.05, n = 5) (그림 2 K)2,,836. Gata1a 모 Nrg1 mRNA 위로 노치 신호 관련 유전자 발현 및 배수 구조 형성의 5 μ M와 75에서의 공동 주입 hpf와 100 hpf (그림 2E, F, K). 따라서, gata1a 모 Nrg1 mRNA 위로 노치 관련 유전자를 구출 하는 반면 노치 신호, 다운-레 귤 레이 션을 이끌어 hemodynamic 세력을 감소 하 고 trabeculation를 다시 시작.
추가 우리의 가설을 강제로 hemodynamic 변경 및 따라서 노치 신호, wea 돌연변이 소개를 통해 trabeculation를 증명 하기 위하여는 비 수축 성 심37을 개발 한다. 심 실 유입 및 심 방 systole 동안 hemodynamic 세력의 부재, wea 돌연변이 익스프레스 노치 신호 구성 요소 유전자의 낮은 심장 mRNA 수준 및 대상 유전자 컨트롤에 비해 비 trabeculated, 작고 약하게 항구 심 (그림 2G, L) 계약. 그러나, Nrg1 mRNA 마이크로 주입 wea 돌연변이에 최대-규제 비 수축 성 아 트리 움 (에도 불구 하 고 더 발음된 수축 성 심 선도 노치 신호 전달 경로, 배수 능선의 부분 구조와 함께 그림 2 H, L)2. 이러한 맥락에서 wea 돌연변이 노치 신호를 통해 trabeculation의 hemodynamic 변조 강조 비 수축 성 아 트리 움과 비 trabeculated 심 실 사이의 관계를 뒷받침.
Tnnt2a 모는 심장 수축 심장 분 T38,39억제 들러 전달 했다. Tnnt2a 모 주입 물고기 순환 및 중요 한 아래로 노치 신호, 부드러운 심 실 표면 및 얇은 벽에 제어 그룹 (그림 2I, M) 에 비해 선도 인 심 실 WSS 없는 완전히 했다 . WSS는 endocardium에 trabeculation에 대 한 요구 였는 지 여부를 조사 하는 endocardium 및 심장 내 피 막 개발 하지 않습니다40,41 접속이 (clo) 돌연변이 있습니다. Clo 돌연변이 심장 trabeculae 개발 하는 데 실패 하 고 작은 크기의 심 실 및 (그림 2J)를반복 하는 불완전 한 심장 보였다. 따라서, endocardial 안 대기는 감각 hemodynamic 전단 응력을 노치 신호 (그림 2 M)를활성화 하는 데 필요한. 그러나, hemodynamic 전단 응력 조 또는 isoproterenol 수축 증가 증가 의해 증가 했다 때 노치 관련 유전자의 표현 레벨을 증가 하지 않았다 하 고 배수 네트워크 형태를 변경 하지 않은 (그림 3)입니다.
더 설명 하기 위해 전단 응력 및 노치 신호 사이의 관계, HAECs 생체 외에서 테스트를 위해 사용 되었다. 타악기 흐름 시뮬레이션 내 피 세포에 의해 관찰 hemodynamic 전단 응력 confluent 셀에 발휘 했다. 그것은 정적에 비해 문화, 타악기 문화 노치 관련 유전자 (그림 4)의 표현을 증가 표시 됩니다. 또한, ADAM10 억제제 치료는 크게 노치 신호 (그림 4)감소.
다음, 심 실 분수 단축 및 심 실 구멍 변화 볼륨에는 야생-타입, gata1a 모, AG1478에 대 한 시간이 지남에 계산 하 고 그 Nrg1 주입 그룹 50에 의해 구출 hpf, 75 hpf, 및 100 hpf (그림 5A-C) . ErbB 신호 억제 물, AG1478, 치료 크게 지연 및 감소 100 심 실 심장 중 소수 단축 hpf (그림 5A). Gata1a 모 및 AG1478 치료 4 차원 LSFM (그림 5E, F)에 있는 변화에 의해 평가 동안 수축, 심 실 챔버 크기 감소. 두 그룹 모두를 증가 끝 심장 수축-이완 볼륨 야생-타입에 비해 개발. Gata1a 모와 Nrg1 mRNA의 공동 주입 야생 타입의 사람들 방출 분수와 소수 단축, 복원.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57763/57763fig1.jpg"> 그림 1 : 형광 빛 시트 개요. (A) 대표 LSFM 시스템 샘플 조명 렌즈 (IL)에서 빛 시트의 교차와 감지 렌즈 (DL)의 검색 경로에 배치 됩니다. (B) IL 뒤에 원통형 렌즈 미크론 크기의 빛 시트 (퍼플) 샘플, 내 흥분 샘플의 얇은 시트를 만듭니다. 감지 렌즈 방출된 형광 신호를 기록합니다. (C)는 회로도 광학 zebrafish 태아를 왼쪽 오른쪽 이동 단면 얇은 레이저 시트 (퍼플) 이 그림은 리 외17에서 수정 되었습니다. <a href="/files/ftp_upload/57763/57763fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57763/57763fig2.jpg"> 그림 2 : 심 실 형태학의 유전자 조작 Tg(cmlc:gfp) zebrafish 노치 Ligand와 수용 체, 대상 유전자 발현. (A) 배수 네트워크 75에 표시 됩니다 제어 zebrafish의 hpf. (B) 100에 배수 네트워크 제어 zebrafish의 hpf. (C) 1-4 세포 단계에서 gata1a 미주리의 주입 거의 아무 trabeculation에서 보였다 75 hpf. (D) gata1a 모 zebrafish에의 주입 배수 네트워크 형성을 지연 했다. (E) gata1a 모와 인간 Nrg1 mRNA의 공동 주입 부분적으로 복원 75에서 trabeculation hpf. (F) gata1a 모와 인간 Nrg1 mRNA의 공동 주입 거의 완전히 복원 100 배수 네트워크 hpf. 100 (G) wea 돌연변이 hpf 아무 trabeculation와 부드러운 심 실 벽을 보여줍니다. (H) wea 돌연변이 제 브라에 인간 Nrg1 의 주입 부분적으로 복원 100 trabeculation hpf. (I) tnnt2a 75에서 아무 trabeculation 했다 미주리의 주입 (표시 되지 않음) 하는 hpf와 100 hpf. (J) 100에서 아무 trabeculation를 보였다 clo 돌연변이 hpf. (K) gata1a 미주리의 주입 크게 감소 Notch1, Nrg1, 및 Jag2 의 mRNA 표현 (t-검정, * P < 0.05, n = 5 대 제어). Gata1a 모와 인간 Nrg1 mRNA의 공동 주입 크게 Notch1b, Nrg1, ErbB, 및 Jag1 제어에 비해 표현의 증가. (L) wea 돌연변이 했다 노치 관련 유전자의 상당히 낮은 식 (t-검정, * P < 0.05, n = 5 대 제어). 인간 Nrg1 의 주입 증가 노치 관련 유전자;의 표현 Jag1 및 Jag2 컨트롤 보다 훨씬 더 높은 했다. (M) tnnt2a 모 주입 및 clo 돌연변이 보여 상당히 낮은 표현의 노치 관련 유전자 (t-검정, * P < 0.05, n = 5 대 제어). 스케일 바: 50 μ m. 데이터는 평균 표준 편차로 표시 됩니다. 이 그림은 리 외17에서 수정 되었습니다. <a href="/files/ftp_upload/57763/57763fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57763/57763fig3.jpg"> 그림 3 : 조작에 WSS 증가 Tg(cmlc:gfp) 노치 ligand, 수용 체 및 대상 유전자 발현과 제 브라 vivo에서 . EPO(A) 의 주입 또는 심장 박동 증가 통해 ISO (B) 의 추가-표현의 조 통해 WSS 증가 trabeculation를 증가 하지 않았다 하 고 배수 네트워크 컨트롤의 저것과 유사 했다. (C) EPO mRNA 또는 Isoproterenol 주입 노치 ligand, 수용 체 또는 대상 유전자의 표정 변화 하지 않았다 (t-검정, * P < 0.05, n = 5 대 제어). 이 그림은 리 외17에서 수정 되었습니다. <a href="/files/ftp_upload/57763/57763fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57763/57763fig4.jpg"> 그림 4 : 진동 또는 타악기 전단 응력에 따라 내 피 세포 생체 외에서 . 평균 τ의 타악기 전단 응력에 따라 HAECs 30 x 10-5 1에서 n = upregulated 노치 관련 유전자 표현과 노치 관련 유전자 표현의 downregulated ADAM10 억제제 적용 했다 (t-검정, * P < 0.05, n = 5 대 제어). 이 그림은 리 외17에서 수정 되었습니다. <a href="/files/ftp_upload/57763/57763fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57763/57763fig5.jpg"> 그림 5 : 소수 단축 및 방출 분 율의 trabeculation의 효과. (A-C) AG1478 및 gata1a 모 추가 크게 감소 100 소수 단축 hpf, 하지만 인간의 Nrg1 및 gata1a 모 공동 주입 그것을 개선. (D) gata1a 주입 및 AG1478 크게 감소 100 소수 단축 hpf (t-검정, * P < 0.05, n = 5 대 제어). Gata1a 및 Nrg1 mRNA의 공동 주입 부분 단축 개선. (E-F) AG1478 및 gata1a 모 75에서 끝 심장 수축과 심장 확장 볼륨을 증가 했다 하는 것을 보여주었다 LSFM와 4 차원 동기화 알고리즘을 통합 hpf (E) 및 100 hpf (F). 데이터는 평균 표준 편차로 표시 됩니다. 이 그림은 리 외17에서 수정 되었습니다. <a href="/files/ftp_upload/57763/57763fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td rowspan="2">제 브라 Jag1</td>
			<td>앞으로</td>
			<td>CCGCGTATGTTTGAAGGAGTATCAGTCG</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>CAGCACGATCCGGGTTTTGTCG</td>
		</tr>
<tr>
<td rowspan="2">제 브라 Jag2</td>
			<td>앞으로</td>
			<td>AGCCCTAGCAAAACGAGCGACG</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>GCGTGAATGTGCCGTTCGATCAA</td>
		</tr>
<tr>
<td rowspan="2">제 브라 Dll4</td>
			<td>앞으로</td>
			<td>CAAAGTGGGAAGCAGACAGAGCTAAGG</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>CGGTCATCCCTGGGTGTGCATT</td>
		</tr>
<tr>
<td rowspan="2">제 브라 BMP10</td>
			<td>앞으로</td>
			<td>GCATCAAGGGGCCACTCGTGTAGA</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>TCGTCTCACTCCACTAGGTCCCATACTG</td>
		</tr>
<tr>
<td rowspan="2">Zebrafish ErBb2</td>
			<td>앞으로</td>
			<td>GATCAGGACTGCCAAACATTGACGTCT</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>AGCAGCACACTGAACATGGCAGCA</td>
		</tr>
<tr>
<td rowspan="2">Zebrafish Nrg-1</td>
			<td>앞으로</td>
			<td>GTGTGTTTGTCCCTGTGGACGCGT</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>CCTCCTGGAGCTTCCCCTCAAACA</td>
		</tr>
<tr>
<td rowspan="2">제 브라 Notch1b</td>
			<td>앞으로</td>
			<td>CAGAGAGTGGAGGCACAGTGCAATCC</td>
		</tr>
<tr>
<td>뒤로</td>
			<td>GCCGTCCCATTCACACTCTGCATT</td>
		</tr>
</tbody></table>Zebrafish 심사에 사용 한 표 3: 뇌관

Watch this Scientific Journal Video about Light-sheet Fluorescence Microscopy to Capture 4-Dimensional Images of the Effects of Modulating Shear Stress on the Developing Zebrafish Heart at JoVE.com

Light-sheet Fluorescence Microscopy to Capture 4-Dimensional Images of the Effects of Modulating Shear Stress on the Developing Zebrafish Heart

여기, 선물이 시각화 4 차원 (4d)에서 zebrafish에 마음을 개발 하는 프로토콜. 빛-시트 형광 현미경 검사 법 (LSFM)를 통해 4 차원 영상, 3 차원 (3 차원) 이미지 개발 마음을 재구성 하는 시간 걸립니다. 우리 그 전단 응력 활성화 endocardial 노치 신호 챔버 개발, 심장 trabeculation를 승진 시키는 동안 질적 및 양적 보여줍니다.

개발 Zebrafish 마음에 전단 응력을 조절의 효과의 4 차원 이미지를 캡처 빛 시트 형광 현미경 검사 법

The hemodynamic forces experienced by the heart influence cardiac development, especially trabeculation, which forms a network of branching outgrowths ...

light-sheet-fluorescence-microscopy-to-capture-4-dimensional-images

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.2K 조회수.  The University of Texas at Arlington. 여기, 선물이 시각화 4 차원 (4d)에서 zebrafish에 마음을 개발 하는 프로토콜. 빛-시트 형광 현미경 검사 법 (LSFM)를 통해 4 차원 영상, 3 차원 (3 차원) 이미지 개발 마음을 재구성 하는 시간 걸립니다. 우리 그 전단 응력 활성화 endocardial 노치 신호 챔버 개발, 심장 trabeculation를 승진 시키는 동안 질적 및 양적 보여줍니다.

비디오: Light-sheet Fluorescence Microscopy to Capture 4-Dimensional Images of the Effects of Modulating Shear Stress on the Developing Zebrafish Heart

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

의 순환 압력 생물 반응기 설계 예 VIVO</em대동맥 심장 밸브> 학습

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

연구

생체공학

Low Molecular Weight Protein Enrichment on Mesoporous Silica Thin Films for Biomarker Discovery

The identification of circulating biomarkers holds great potential for non invasive approaches in early diagnosis and prognosis, as well as for the monitoring of therapeutic efficiency.1-3 The circulating low molecular weight proteome (LMWP) composed of small proteins shed from tissues and cells or peptide fragments derived from the proteolytic degradation of larger proteins, has been associated with the pathological condition in patients and likely reflects the state of disease.4,5 Despite these potential clinical applications, the use of Mass Spectrometry (MS) to profile the LMWP from biological fluids has proven to be very challenging due to the large dynamic range of protein and peptide concentrations in serum.6 Without sample pre-treatment, some of the more highly abundant proteins obscure the detection of low-abundance species in serum/plasma. Current proteomic-based approaches, such as two-dimensional polyacrylamide gel-electrophoresis (2D-PAGE) and shotgun proteomics methods are labor-intensive, low throughput and offer limited suitability for clinical applications.7-9 Therefore, a more effective strategy is needed to isolate LMWP from blood and allow the high throughput screening of clinical samples. 
Here, we present a fast, efficient and reliable multi-fractionation system based on mesoporous silica chips to specifically target and enrich LMWP.10,11 Mesoporous silica (MPS) thin films with tunable features at the nanoscale were fabricated using the triblock copolymer template pathway. Using different polymer templates and polymer concentrations in the precursor solution, various pore size distributions, pore structures, connectivity and surface properties were determined and applied for selective recovery of low mass proteins. The selective parsing of the enriched peptides into different subclasses according to their physicochemical properties will enhance the efficiency of recovery and detection of low abundance species. In combination with mass spectrometry and statistic analysis, we demonstrated the correlation between the nanophase characteristics of the mesoporous silica thin films and the specificity and efficacy of low mass proteome harvesting. The results presented herein reveal the potential of the nanotechnology-based technology to provide a powerful alternative to conventional methods for LMWP harvesting from complex biological fluids. Because of the ability to tune the material properties, the capability for low-cost production, the simplicity and rapidity of sample collection, and the greatly reduced sample requirements for analysis, this novel nanotechnology will substantially impact the field of proteomic biomarker research and clinical proteomic assessment.

We developed a technology based on mesoporous silica thin film for the selective recovery of low molecular weight proteins and peptides from human serum. The physico-chemical properties of our mesoporous chips were finely tuned to provide substantial control in peptide enrichment and consequently profile the serum proteome for diagnostic purposes.

Biomarker 디스커버리를위한 Mesoporous 실리카 박막의 낮은 분자량의 단백질 농축

The identification of circulating biomarkers holds great potential for non invasive approaches in early diagnosis and prognosis, as well as for the ...

Patient-specific Modeling of the Heart: Estimation of Ventricular Fiber Orientations

Patient-specific simulations of heart (dys)function aimed at personalizing cardiac therapy are hampered by the absence of in vivo imaging technology for clinically acquiring myocardial fiber orientations. The objective of this project was to develop a methodology to estimate cardiac fiber orientations from in vivo images of patient heart geometries. An accurate representation of ventricular geometry and fiber orientations was reconstructed, respectively, from high-resolution ex vivo structural magnetic resonance (MR) and diffusion tensor (DT) MR images of a normal human heart, referred to as the atlas. Ventricular geometry of a patient heart was extracted, via semiautomatic segmentation, from an in vivo computed tomography (CT) image. Using image transformation algorithms, the atlas ventricular geometry was deformed to match that of the patient. Finally, the deformation field was applied to the atlas fiber orientations to obtain an estimate of patient fiber orientations. The accuracy of the fiber estimates was assessed using six normal and three failing canine hearts. The mean absolute difference between inclination angles of acquired and estimated fiber orientations was 15.4 &deg;. Computational simulations of ventricular activation maps and pseudo-ECGs in sinus rhythm and ventricular tachycardia indicated that there are no significant differences between estimated and acquired fiber orientations at a clinically observable level.The new insights obtained from the project will pave the way for the development of patient-specific models of the heart that can aid physicians in personalized diagnosis and decisions regarding electrophysiological interventions.

A methodology to estimate ventricular fiber orientations from in vivo images of patient heart geometries for personalized modeling is described. Validation of the methodology performed using normal and failing canine hearts demonstrate that that there are no significant differences between estimated and acquired fiber orientations at a clinically observable level.

심장의 환자 별 모델링 : 심실 섬유 오리엔테이션의 추정

Patient-specific  simulations of heart (dys)function aimed at personalizing cardiac therapy are hampered  by the absence of in vivo imaging technology for ...

Creating Adhesive and Soluble Gradients for Imaging Cell Migration with Fluorescence Microscopy

Cells can sense and migrate towards higher concentrations of adhesive cues such as the glycoproteins of the extracellular matrix and soluble cues such as growth factors. Here, we outline a method to create opposing gradients of adhesive and soluble cues in a microfluidic chamber, which is compatible with live cell imaging. A copolymer of poly-L-lysine and polyethylene glycol (PLL-PEG) is employed to passivate glass coverslips and prevent non-specific adsorption of biomolecules and cells. Next, microcontact printing or dip pen lithography are used to create tracks of streptavidin on the passivated surfaces to serve as anchoring points for the biotinylated peptide arginine-glycine-aspartic acid (RGD) as the adhesive cue. A microfluidic device is placed onto the modified surface and used to create the gradient of adhesive cues (100% RGD to 0% RGD) on the streptavidin tracks. Finally, the same microfluidic device is used to create a gradient of a chemoattractant such as fetal bovine serum (FBS), as the soluble cue in the opposite direction of the gradient of adhesive cues.

A method for the assembly of adhesive and soluble gradients in a microscopy chamber for live cell migration studies is described. The engineered environment combines antifouling surfaces and adhesive tracks with solution gradients and therefore allows one to determine the relative importance of guidance cues.

형광 현미경과 영상 셀 마이그레이션을위한 접착제 및 가용성식이 그라디언트를 만들기

Cells can sense and migrate towards higher concentrations of adhesive cues such as the glycoproteins of the extracellular matrix and soluble cues such as ...

3D Orbital Tracking in a Modified Two-photon Microscope: An Application to the Tracking of Intracellular Vesicles

The objective of this video protocol is to discuss how to perform and analyze a three-dimensional fluorescent orbital particle tracking experiment using a modified two-photon microscope1. As opposed to conventional approaches (raster scan or wide field based on a stack of frames), the 3D orbital tracking allows to localize and follow with a high spatial (10 nm accuracy) and temporal resolution (50 Hz frequency response) the 3D displacement of a moving fluorescent particle on length-scales of hundreds of microns2. The method is based on a feedback algorithm that controls the hardware of a two-photon laser scanning microscope in order to perform a circular orbit around the object to be tracked: the feedback mechanism will maintain the fluorescent object in the center by controlling the displacement of the scanning beam3-5. To demonstrate the advantages of this technique, we followed a fast moving organelle, the lysosome, within a living cell6,7. Cells were plated according to standard protocols, and stained using a commercially lysosome dye. We discuss briefly the hardware configuration and in more detail the control software, to perform a 3D orbital tracking experiment inside living cells. We discuss in detail the parameters required in order to control the scanning microscope and enable the motion of the beam in a closed orbit around the particle. We conclude by demonstrating how this method can be effectively used to track the fast motion of a labeled lysosome along microtubules in 3D within a live cell. Lysosomes can move with speeds in the range of 0.4-0.5 &#181;m/sec, typically displaying a directed motion along the microtubule network8.

In this video protocol we track - at high speed and in three dimensions - fluorescently labeled lysosomes within living cells, using the orbital tracking method in a modified two-photon microscope.

수정 된 두 개의 광자 현미경에서 3D 궤도 추적 : 세포 내 소포의 추적에 응용

The objective of this video protocol is to discuss how to perform and analyze a three-dimensional fluorescent orbital particle tracking experiment using a ...

Single Molecule Fluorescence Microscopy on Planar Supported Bilayers

In the course of a single decade single molecule microscopy has changed from being a secluded domain shared merely by physicists with a strong background in optics and laser physics to a discipline that is now enjoying vivid attention by life-scientists of all venues 1. This is because single molecule imaging has the unique potential to reveal protein behavior in situ in living cells and uncover cellular organization with unprecedented resolution below the diffraction limit of visible light 2. Glass-supported planar lipid bilayers (SLBs) are a powerful tool to bring cells otherwise growing in suspension in close enough proximity to the glass slide so that they can be readily imaged in noise-reduced Total Internal Reflection illumination mode 3,4. They are very useful to study the protein dynamics in plasma membrane-associated events as diverse as cell-cell contact formation, endocytosis, exocytosis and immune recognition. Simple procedures are presented how to generate highly mobile protein-functionalized SLBs in a reproducible manner, how to determine protein mobility within and how to measure protein densities with the use of single molecule detection. It is shown how to construct a cost-efficient single molecule microscopy system with TIRF illumination capabilities and how to operate it in the experiment.

Preparation of protein-functionalized planar glass-supported lipid bilayers, determination of protein mobility within and measurement of protein densities is shown here. A roadmap to building a noise-reduced Total Internal Reflection microscope is outlined, which allows visualizing single bilayer-resident fluorochromes with high spatiotemporal resolution.

평면에 단일 분자 형광 현미경은 이중층 지원

In the course of a single decade single molecule microscopy has changed from being a secluded domain shared merely by physicists with a strong background ...

Light-sheet Fluorescence Microscopy for the Study of the Murine Heart

Light-sheet fluorescence microscopy has been widely used for rapid image acquisition with a high axial resolution from micrometer to millimeter scale. Traditional light-sheet techniques involve the use of a single illumination beam directed orthogonally at sample tissue. Images of large samples that are produced using a single illumination beam contain stripes or artifacts and suffer from a reduced resolution due to the scattering and absorption of light by the tissue. This study uses a dual-sided illumination beam and a simplified CLARITY optical clearing technique for the murine heart. These techniques allow for deeper imaging by removing lipids from the heart and produce a large field of imaging, greater than 10 x 10 x 10 mm3. As a result, this strategy enables us to quantify the ventricular dimensions, track the cardiac lineage, and localize the spatial distribution of cardiac-specific proteins and ion-channels from the post-natal to adult mouse hearts with sufficient contrast and resolution.

This study uses a dual-sided illumination light-sheet fluorescence microscopy (LSFM) technique combined with optical clearing to study the murine heart.

Murine 심장 연구에 대 한 빛-시트 형광 현미경 검사 법

Light-sheet fluorescence microscopy has been widely used for rapid image acquisition with a high axial resolution from micrometer to millimeter scale. ...

Gene Expression Analysis of Endothelial Cells Exposed to Shear Stress Using Multiple Parallel-plate Flow Chambers

We describe a workflow for the analysis of gene expression from endothelial cells subject to a steady laminar flow using multiple monitored parallel-plate flow chambers. Endothelial cells form the inner cellular lining of blood vessels and are chronically exposed to the frictional force of blood flow called shear stress. Under physiological conditions, endothelial cells function in the presence of various shear stress conditions. Thus, the application of shear stress conditions in in vitro models can provide greater insight into endothelial responses in vivo. The parallel-plate flow chamber previously published by Lane et al.9 is adapted to study endothelial gene regulation in the presence and absence of steady (non-pulsatile) laminar flow. Key adaptations in the set-up for laminar flow as presented here include a large, dedicated environment to house concurrent flow circuits, the monitoring of flow rates in real-time, and the inclusion of an exogenous reference RNA for the normalization of quantitative real-time PCR data. To assess multiple treatments/conditions with the application of shear stress, multiple flow circuits and pumps are used simultaneously within the same heated and humidified incubator. The flow rate of each flow circuit is measured continuously in real-time to standardize shear stress conditions throughout the experiments. Because these experiments have multiple conditions, we also use an exogenous reference RNA that is spiked-in at the time of RNA extraction for the normalization of RNA extraction and first-strand cDNA synthesis efficiencies. These steps minimize the variability between samples. This strategy is employed in our pipeline for the gene expression analysis with shear stress experiments using the parallel-plate flow chamber, but parts of this strategy, such as the exogenous reference RNA spike-in, can easily and cost-effectively be used for other applications.

Here, a workflow for the culture and gene expression analysis of endothelial cells under fluid shear stress is presented. Included is a physical arrangement for simultaneously housing and monitoring multiple flow chambers in a controlled environment and the use of an exogenous reference RNA for quantitative PCR.

가 여러 명의 병렬 접시 흐름 챔버를 사용 하 여 스트레스에 노출 된 내 피 세포의 유전자 표정 분석

We describe a workflow for the analysis of gene expression from endothelial cells subject to a steady laminar flow using multiple monitored parallel-plate ...

Live Cell Analysis of Shear Stress on Pseudomonas aeruginosa Using an Automated Higher-Throughput Microfluidic System

A higher-throughput microfluidic in vitro bioreactor coupled with fluorescence microscopy has been used to study bacterial biofilm growth and morphology, including Pseudomonas aeruginosa (P. aeruginosa). Here, we will describe how the system can be used to study the growth kinetics and the morphological properties such as the surface roughness and textural entropy of P. aeruginosa strain PA01 that expresses an enhanced green fluorescent protein (PA01-EGFP). A detailed protocol will describe how to grow and seed PA01-EGFP cultures, how to set up the microscope and autorun, and conduct the image analysis to determine growth rate and morphological properties using a variety of shear forces that are controlled by the microfluidic device. This article will provide a detailed description of a technique to improve the study of PA01-EGFP biofilms which eventually can be applied towards other strains of bacteria, fungi, or algae biofilms using the microfluidic platform.

Live Cell Analysis of Shear Stress on Pseudomonas aeruginosa Using an Automated Higher-Throughput Microfluidic System

Here, we describe the use of a higher-throughput microfluidic bioreactor coupled with a fluorescent microscope for the analysis of shear stress effects on Pseudomonas aeruginosa biofilms expressing green fluorescent proteins, including instrument set up, the determination of biofilm coverage, growth rate, and morphological properties.

라이브 셀 분석의 전단 응력에 녹 농 균 등 처리량 미세 자동 시스템을 사용 하 여

A higher-throughput microfluidic in vitro bioreactor coupled with fluorescence microscopy has been used to study bacterial biofilm growth and morphology, ...

Biaxial Mechanical Characterizations of Atrioventricular Heart Valves

Extensive biaxial mechanical testing of the atrioventricular heart valve leaflets can be utilized to derive&#160;optimal parameters used in constitutive models, which provide a mathematical representation of the mechanical function of those structures. This presented biaxial mechanical testing protocol involves (i) tissue acquisition, (ii) the preparation of tissue specimens, (iii) biaxial mechanical testing, and (iv) postprocessing of the acquired data. First, tissue acquisition requires obtaining porcine or ovine hearts from a local Food and Drug Administration-approved abattoir for later dissection to retrieve the valve leaflets. Second, tissue preparation requires using tissue specimen cutters on the leaflet tissue to extract a clear zone for testing. Third, biaxial mechanical testing of the leaflet specimen requires the use of a commercial biaxial mechanical tester, which consists of force-controlled, displacement-controlled, and stress-relaxation testing protocols to characterize the leaflet tissue&#39;s mechanical properties. Finally, post-processing requires the use of data image correlation techniques and force and displacement readings to summarize the tissue&#39;s mechanical behaviors in response to external loading. In general, results from biaxial testing demonstrate that the leaflet tissues yield a nonlinear, anisotropic mechanical response. The presented biaxial testing procedure is advantageous to other methods since the method presented here allows for a more comprehensive characterization of the valve leaflet tissue under one unified testing scheme, as opposed to separate testing protocols on different tissue specimens. The proposed testing method has its limitations in that shear stress is potentially present in the tissue sample. However, any potential shear is presumed negligible.

This protocol involves characterizations of atrioventricular valve leaflets with force-controlled, displacement-controlled, and stress-relaxation biaxial mechanical testing procedures. Results acquired with this protocol can be used for constitutive model development to simulate the mechanical behavior of functioning valves under a finite element simulation framework.

Biaxial 기계 Characterizations 것 심장 밸브의

Extensive biaxial mechanical testing of the atrioventricular heart valve leaflets can be utilized to derive&#160;optimal parameters used in constitutive ...