B. 달리는 통계 조언과 국립 암 연구소 수상 P30 CA042014에 의해 지원 되는 이러한 기술 코어에 대 한 액세스에 대 한 유타 대학 생물 통계학 핵심 라이브러리 시퀀싱 및 K. 바우처에 대 한 유타 대학 게놈 코어에는 감사 합니다. 설명 하는 프로젝트는 국립 암 연구소 보조금 P01 CA073992 K01 CA128891와 사냥꾼 암 재단에 의해 지원 되었다.

<ol>
	<li>Bechard, A., Meagher, R., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+reduces+the+likelihood+of+alopecia+in+adult+C57BL/6J+mice.">Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice.</a> Journal of the American Association for Laboratory Animal Science : JAALAS. 50 (2), 171-174 (2011).</li><li>Jankowsky, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+mitigates+cognitive+deficits+in+a+mouse+model+of+Alzheimer's+disease.">Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease.</a> J Neurosci. 25 (21), 5217-5224 (2005).</li><li>Kondo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+ameliorates+a+motor+coordination+deficit+in+a+mouse+model+of+Rett+syndrome--Mecp2+gene+dosage+effects+and+BDNF+expression.">Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression.</a> Eur J Neurosci. 27 (12), 3342-3350 (2008).</li><li>Reichmann, F., Painsipp, E., Holzer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+and+gut+inflammation+modify+stress-induced+c-Fos+expression+in+the+mouse+corticolimbic+system.">Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system.</a> PLoS One. 8 (1), 54811 (2013).</li><li>Cao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+and+genetic+activation+of+a+brain-adipocyte+BDNF/leptin+axis+causes+cancer+remission+and+inhibition.">Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition.</a> Cell. 142 (1), 52-64 (2010).</li><li>Bice, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+Enrichment+Induces+Pericyte+and+IgA-Dependent+Wound+Repair+and+Lifespan+Extension+in+a+Colon+Tumor+Model.">Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model.</a> Cell reports. 19 (4), 760-773 (2017).</li><li>Moser, A. R., Pitot, H. C., Dove, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+dominant+mutation+that+predisposes+to+multiple+intestinal+neoplasia+in+the+mouse.">A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse.</a> Science. 247 (4940), 322-324 (1990).</li><li>Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T-cell+factor+4+functions+as+a+tumor+suppressor+whose+disruption+modulates+colon+cell+proliferation+and+tumorigenesis.">T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis.</a> Proc Natl Acad Sci U S A. 108 (12), 4914-4919 (2011).</li><li>Holmdahl, R., Malissen, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+need+for+littermate+controls.">The need for littermate controls.</a> Eur J Immunol. 42 (1), 45-47 (2012).</li><li>Ubeda, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Familial+transmission+rather+than+defective+innate+immunity+shapes+the+distinct+intestinal+microbiota+of+TLR-deficient+mice.">Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice.</a> J Exp Med. 209 (8), 1445-1456 (2012).</li><li>Spor, A., Koren, O., Ley, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unravelling+the+effects+of+the+environment+and+host+genotype+on+the+gut+microbiome.">Unravelling the effects of the environment and host genotype on the gut microbiome.</a> Nat Rev Microbiol. 9 (4), 279-290 (2011).</li><li>Fujiwara, R., Watanabe, J., Sonoyama, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+changes+in+composition+of+intestinal+microbiota+in+neonatal+BALB/c+mice+through+cluster+analysis+of+molecular+markers.">Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers.</a> Br J Nutr. 99 (6), 1174-1177 (2008).</li><li>Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+methods+in+newborn+C57BL/6+mice:+a+developmental+and+behavioural+evaluation.">Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation.</a> Lab Anim. 44 (2), 88-103 (2010).</li><li>Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Social+enrichment+during+postnatal+development+induces+transgenerational+effects+on+emotional+and+reproductive+behavior+in+mice.">Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice.</a> Frontiers in behavioral neuroscience. 3, 25 (2009).</li><li>National Research Council (U.S.). <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+of+the+Guide+for+the+Care+and+Use+of+Laboratory+Animals.">Update of the Guide for the Care and Use of Laboratory Animals.</a> Institute for Laboratory Animal Research (U.S.). , 220 (2011).</li><li>Silver, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Mouse genetics : concepts and applications. , (1995).</li><li>Chen, M., Kan, L., Ledford, B. T., He, J. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tattooing+Various+Combinations+of+Ears,+Tail,+and+Toes+to+Identify+Mice+Reliably+and+Permanently.">Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently.</a> Journal of the American Association for Laboratory Animal Science : JAALAS. 55 (2), 189-198 (2016).</li><li>Truett, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+PCR-quality+mouse+genomic+DNA+with+hot+sodium+hydroxide+and+tris+(HotSHOT).">Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).</a> Biotechniques. 29 (1), 52-54 (2000).</li><li>Cole, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+Database+Project:+data+and+tools+for+high+throughput+rRNA+analysis.">Ribosomal Database Project: data and tools for high throughput rRNA analysis.</a> Nucleic Acids Res. 42, 633-642 (2014).</li><li>Bosshard, P. P., Zbinden, R., Altwegg, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Turicibacter+sanguinis+gen.+nov.,+sp.+nov.,+a+novel+anaerobic,+Gram-positive+bacterium.">Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium.</a> Int J Syst Evol Microbiol. 52, 1263-1266 (2002).</li><li>Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+intestinal+lumen+and+mucosa-associated+microbiota+in+patients+with+colorectal+cancer.">Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer.</a> PLoS One. 7 (6), 39743 (2012).</li><li>16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina Available from: <a target="_blank" href="https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf">https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf</a> (2017)</li><li>Illumina Experiment Manager. Illumina Available from: <a target="_blank" href="https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html">https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html</a> (2017)</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nat Methods. 7 (5), 335-336 (2010).</li><li>Aronesty, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ea-utils:+Command-line+tools+for+processing+biological+sequencing+data.">ea-utils: Command-line tools for processing biological sequencing data.</a> Expression Analysis. , (2011).</li><li>Edgar, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Search+and+clustering+orders+of+magnitude+faster+than+BLAST.">Search and clustering orders of magnitude faster than BLAST.</a> Bioinformatics. 26 (19), 2460-2461 (2010).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PyNAST:+a+flexible+tool+for+aligning+sequences+to+a+template+alignment.">PyNAST: a flexible tool for aligning sequences to a template alignment.</a> Bioinformatics. 26 (2), 266-267 (2010).</li><li>DeSantis, T. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Greengenes,+a+chimera-checked+16S+rRNA+gene+database+and+workbench+compatible+with+ARB.">Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.</a> Appl Environ Microbiol. 72 (7), 5069-5072 (2006).</li><li>Moon, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vertically+transmitted+faecal+IgA+levels+determine+extra-chromosomal+phenotypic+variation.">Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation.</a> Nature. 521 (7550), 90-93 (2015).</li><li>Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+detailed+analysis+of+16S+ribosomal+RNA+gene+segments+for+the+diagnosis+of+pathogenic+bacteria.">A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria.</a> J Microbiol Methods. 69 (2), 330-339 (2007).</li><li>Chen, H. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+dietary+fiber+intake+and+structural+alteration+of+gut+microbiota+in+patients+with+advanced+colorectal+adenoma.">Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma.</a> Am J Clin Nutr. 97 (5), 1044-1052 (2013).</li><li>Zhu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+intestinal+lumen+microbiota+in+an+animal+model+of+colorectal+cancer.">Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer.</a> PLoS One. 9 (6), 90849 (2014).</li><li>Evans, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exercise+prevents+weight+gain+and+alters+the+gut+microbiota+in+a+mouse+model+of+high+fat+diet-induced+obesity.">Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity.</a> PLoS One. 9 (3), 92193 (2014).</li></ol>

저자는 그들은 충돌의 관심을가지고 선언.

이 절차는 microbiota의 자 정상 또는 종양 동물 베어링의 환경 풍부를 다음에서 분리 된의 분석에 대 한 수 있습니다. 다른 남녀의 genotypes 많은 동물을 얻기 위해 사육을 포함 하는 큰 실험 이기 때문에, 필수적 이다 동물 실험의 시작 전 사이 미생물 정상화 EE 비를 피하기 위해 관련 미생물에 대 한 효과 생물의 다양성입니다.
네브라스카 및 전자 상태 사이의 일관성을 위해 번 식 과정은 모든 마우스 처음 같은 미생물에 노출 해야 하 고, 따라서, 비슷한 미생물 내용 것으로 예상 된다 위해 수행 됩니다. 그것은 가능한, 그리고 그 마우스 유전자, 미생물 구성에 영향을 줍니다. 이러한 이유로, 유전자 형 당 마우스 숫자는 대변을 소비 하는 어떤 동물 든 지는 미생물의 유사한 다양성을 발생할 것입니다 특정 조건은 NE와 EE 사이 유지 됩니다.
실험 EE를 디자인할 때 몇 가지 어려움은 명백한 있습니다. 첫째, 동물 실험에 필요한 총 수 실험 내용에 따라 달라 집니다 하지만 총 수 또한 장에 허용 하는 동물의 수에 의해 제한 됩니다. 예를 들어 예비 EE 실험에서 기록 데이터 주변 마우스 생존 정의 이전 실험에서 관찰 메커니즘 기본 향상 된 생존 하는 동물의 수를 계산 하기 위해 사용 되었다. 이 데이터를 비교 그룹에 17 동물의 총 어디 알파 2 면 t-검정에 생존에 차이 감지 하는 80% 전원에 대 한 필요 했다 = 0.05. 그래서, 실험적인 그룹에 있는 감 금 소 당 20-24 (또는 41) 동물 대 제어 그룹에서 4-5 동물 파워 계산을 수용 해야 합니다. 따라서, 여러 가지 제어 그룹 연습장 실험 케이지 함께 필요 합니다. 또한, 복잡 한 genotypes, 그것 어렵다 필요한 번 식 암컷의 큰 번호를 필요로 각 유전자의 충분 한 동물 번호를 얻을. 그러나, 적은 유전자 변형 차이 현재 다른 모델, 동일한 유전자의 더 많은 동물 들이이 시스템에서 분석 될 수 있다와 적은 브리 더 필요 하다. 미국에서 12 임신 여성 공간 (표 2)의2 에서 633에 보관 수 있습니다. 이 문제는 새끼 나이가, 그들은 더 많은 공간을 차지. 남자 새끼는 14-21 일 여성 새끼에서 분리 되어, 그 특정 국가에 공간 규칙을 승인 된 예외 가능 있을 수 있습니다. 그렇지 않으면, 남성 및 여성 새끼 genotyped 수 선택 하 고 다음 최대 마우스 숫자 아래에 있어 어머니와 젊은 나이에 분리. 이러한 연구에 대 한 승인을 얻을 하 고 공간 제한에 현지 규칙을 준수 하는 필수적 이다. 마지막으로, microbiota, 함께 microbiota 구성에도 작은 차이 감지 하는 데 필요한 동물의 수는 선험적으로계산 하기 어려운. 이 연구에 (서) 동안 중요 한 차이 microbiota에 동물의 수가 증가 하는 것 이라고 microbiota EE 쥐 사이 더 많은 변수 또는 약간 변경 되는 EE에 의해 공개 수 그룹 당 4 동물 들과 함께 발견 됐다.
이 방법 문서에서는 특정 장비와 침구는 사용 되, 표면에는 필수적인 나타나지 않을 수 있습니다. 그러나, 일관성에 영향을 주는 여러 가지 비 명백한 문제 발생 될 수 있습니다 하 고 비싼,이 매우 큰에 착수 하 고 시간이 많이 걸리는 연구 이전에 해결 되어야 필요가 있다. 하나의 주요 문제는 케이지 환기. 장에 동물의 큰 숫자, 환기는 문제가 되 고 제어 및 실험적인 감 금 소 사이 일관 된 환경을 제공 하려고 할 때 대부분 연구자를 고려 하지 않습니다 문제입니다. 설명된 설정에서 모든 새 장을 실험에 걸쳐 환기를 맞춰야 하는 제어 통풍이 캐비닛에 배치 됩니다 새 장. 이 때 통풍이 캐비닛에 적합 하지는 않습니다 연습장 사용 하 여 수행할 수 없습니다. 다른 실험 사이 환기를 정상화 하 고 제어 하는 것을 의미 하지만 이러한 메서드는이 연구에서 탐험 하지 동물을 테스트 하 고 일관 되 게 적용, 수. 침구 비슷한 일관성 문제가 발생합니다. 이 연구에 사용 된 결 장 암 모델 시스템, 소화기 질환을가지고 있는 동물 침구, 특정 유형의 섭취는 특히 옥수수 속 침구, 소화 방해 및 질병. 그것은 동물 섭취 하지 않으면 점령, 제어 환경에서 침구를 경우 마음에 계속 해야 합니다. 이 현상 및 후속 일관성 없는 건강 효과 모든 데이터 뿌리깊은 영향을 줍니다.
16S ribosomal 유전자는 세균성 인구를 공부 하는 수단으로 사용 되었습니다. 그것은 유전 가변성, v 1-v 9과 세균성 종39사이 상대적으로 변함 산재 보존된 지역 9 개 지역 포함. V1-V3 지역 특히, 종 수준 id39의 높은 확률을 제공합니다. 유사한 V1-V3 대 장 암 (CRC)에 연구와 고급 대 장 Adenoma 관심의 3 문의 있는 변화: Bacteroidetes, Firmicutes, 및 Proteobacteria21,,4041. 그것은 또한 알려졌다 운동 미생물 인구 이동 하 고 Firmicutes42증가로 이어질 수 있습니다. 이러한 이유로이 연구 adenoma 및 CRC에 변경 될 것으로 알려져 이러한 문의에 잠재적으로 환경 농축의 효과 정의 하는 16 metagenomic 라이브러리 준비 프로토콜22 다음 V1-V3 뇌관을 사용 하 여 미생물 인구를 확인. 이 절차는 증폭 하 고 다른 변수 영역 16S rRNA 유전자의 순서를 수정할 수 있습니다. 한 가지 방법은 microbiota 프로브에 의해 식별 됩니다 샘플에 존재의 계통 발생 분류 이해 하 프로브 일치를 사용 하는 것입니다. 이 방법에서는, 프로브를 구체적으로 정의 하 고 phylogenetically 이익의 미생물 분류 대상 수 있습니다. 이 대변 샘플에 있는 microbiota의 다른 특성을 허용 하 고 종양 질병의 진행에 영향을 미칠 수 있습니다 마우스를 베어링의 미생물에서 추가 EE 종속 변경 공개 수 있습니다.
Sutterella 베어링 동물 종양의 EE를 따라 가장 변경된 속으로 확인 되었습니다 속이이 절차를 사용 하 여. 이 절차는 인간 질병의 유전자 변형된 모델에 미생물 구성에 섭 동 효과 분석 하는 것을 의미 하는 어떤 방법 든 지를 활용 하는 연구에 맞게 적용할 수 있습니다. 예를 들어 전자, 대신 마우스 Sutterella 접종 미생물 생물 다양성을 증가 하 고 16 주 된 남성 종양 동물 베어링에서 수리를 상처 충분 한 인지 정의를 Sutterella 로 주사 될 수 있습니다.
의심의 여지가,이 프로토콜의 가장 독특한 측면 EE 이전 microbiota 정상화 및 전자 연구에 걸쳐 미생물 다양성을 유지 하는 우려입니다. 미생물 연구는 지속적으로 개선 하 고, 이후 그것은 특성화는 미생물에 대 한 보다 강력한 방법, 발생 하 고이 프로토콜에 미생물 특성화 무용지물이 될 것입니다. 예를 들어 현재 연구 16S rRNA를 증폭 하는 데 사용 하는 프로브는 조사는 선택 되 고 모든 박테리아는 미생물에 특성화 하지 않습니다에 따라 바이어스를 있다. 조사는 미생물을 특성화 하는 데 사용 하는 방법을 향상 시킬 의심할 여 지 없이 것입니다, 디자인 하 고 실행 하는 전자의 기초 실험 전자 실험의 필수적인 패싯 유지 됩니다 염두에는 미생물의 정규화를 유지 하는 동안.

환경 농축 (EE) 연구 활용 사회적 자극 (대형 주택 새 장, 동물의 더 큰 그룹), 인지 자극 (오두막, 터널, 중첩 물자, 플랫폼) 및 신체 활동 (실행에 영향을 미칠 복잡 한 주택 매개 변수 바퀴)입니다. EE은 질병 개시 및 barbering 유도 탈모 증, 알 츠 하이 머 병을 포함 한 마우스 모델의 다양 한 배열을 사용 하 여 진행에 증가 한 활동 및 사회 및 인지 향상 된 상호 작용의 효과 이해 하는 많은 실험실에 의해 이용 되어 레트 증후군, 그리고 여러 종양 및 소화기 질병 모델1,2,,34,,56.
여러 마우스 모델 콜론 tumorigenesis 쥐에 연구 개발 되었습니다. 아마도 가장 잘 정의 된 모델은 Apc분 마우스. Apc분 마우스 19907, 윌리엄 비둘기의 실험실에서 개발 되었다 그리고 일반적으로 인간 대 장 암 연관 된 APC 유전자에 돌연변이의 마우스 모델 사용 되었습니다. APC 돌연변이 은닉 하는 인간, 달리 Apc분 마우스는 주로 결 장 종양의 아주 드문와 작은 창 자 종양을 개발 합니다. 그러나, Tcf4에 단일 쫓 고 녹아웃 heterozygous 돌연변이와 Tcf4Het 대립 유전자는 훨씬 콜론 tumorigenesis Apc분 대립 유전자8과 결합 될 때 증가 합니다. 최근, 콜론 tumorigenesis의이 마우스 모델 콜론 tumorigenesis6EE의 효과 결정 하기 위해 사용 되었습니다. 바이스 외에 공부, 남성 및 여성 4 개의 다른 마우스 라인에 EE의 생리 및 phenotypic 효과 (야생-타입 (WT), Tcf4Het / + Apc+ +, Tcf4+ + Apc분 / +, 및 Tcf4 Het / + Apc분 / +)) 정의 된. 아마도 가장 흥미로운 발견 EE 크게 둘 다 남성과 여성 결 장 종양 베어링 동물의 수명을 증가 했다. 이 시연 EE 적어도 줄일 수 있습니다 일부 증상의 콜론 tumorigenesis, 연관 및 동물 건강을 개선. 놀랍게도, 남성에서이 향상 된 수명 감소 tumorigenesis의 직접적인 결과 이며 대신 종양 상처 치유 향상 된 미생물 생물 다양성6을 포함 하는 응답의 개시에 연결 했다.
재미 있는 결과 함께 몇 가지 EE 특정 연구 출판 되었습니다. 그러나, 기술적인 관점에서 중요 한 결과 종종 없습니다 다른 실험실에 번역. 매우 복잡 한 문제, 아니라 농축 장치 및 주택 사용, 하지만 또한 침구, 음식, 환기, 번 식, 유전학, 방, 그리고 동물 프로토콜에서 활동은 다른 실험실 간의 동일한 EE 방법론을 유지 요구 사항, 다른 사람의 사이에서9,,1011. 한 예로 어디 동물 안정적으로 통합 마우스 식민지 따라서 유전 배경 및 식단 구성, 비 처리 관련된 효과 피하기 위해 정규화 동물의 통합 이다. 추가로, 많은 전자 연구 질병, 그리고 일반적인 마우스 농업 관행 본질적인 미생물10,12의 구성에 영향을 수 있습니다 방법에 미생물의 중요성의 실현 하기 전에 완료 되었습니다.
제대로 수행 하지 경우 전자에서 번 식 전략 및 동물 배치 스트레스를 증가 시킬 수 있습니다. 이후 EE 연구 다 수의 남성과 여성의 동물과 여러 genotypes 활용, 실험적인 체제 어려울 수 있습니다 결합 될 여러 새끼에서 동물에 대 한 요구를 주어진. 따라서, 한 번 식 및 전략 이유 다른 담가에서 올바른 유전자의 이유 동물의 결합을 위한 허용 하도록 개발 되었다. 이 대 한 기본 근거 새끼 중 microbiota를 정상화 하 고 스트레스를 줄이기 위해 동물 실험 환경으로 이동 하는 때 이었다. 미생물 댐10에서 전달 되었다. 식민지에 미생물 다양성을 제공 하려면 여성 잭슨 실험실에서 구입 하 고 실험9,,1012시작 하기 전에 한 달 동안 식민지에 통합 했다. 더 정상화 미생물 생물 다양성 동물 사이, 여성 공동 사육 이전 지 내게 했다. 번 식, 양육 하는 동안 공동 주택 및 탈출 하는 능력에 따라 간호 새끼 모성 배려13,14, 미생물 정규화를 가능 하 게 발전의 스트레스 수준을 향상. 비-전자를 방지 하기 위해 관련은 미생물에 대 한 효과, 모든 실험 동물의이 공동 주택 방지 한 실험으로 다른 담가에서 여러 남성을 결합할 때 발생 한 전투 및 추가적인 스트레스. 마지막으로, 모든 genotypes의 동물의 동등한 숫자는 연습장에 포함 됐다. 이 genotypes, 전반에 걸쳐 향상 된 microbiota 생물 다양성에 대 한 기회를 제공 하 고 제거 coprophagia (동물의 경향이 자 소비) 또는 전체 연구. 에 가능한 유전자 형 관련 행동 차이의 기여
이 프로토콜은 이전 EE 연구 미생물 연구, 더 균일 한 미생물 인구 수 있도록 microbiota 정규화 microbiota 전송 및 동물 식민지 통합의 알려진된 측면을 포함 하도록 확장 하는 전략을 제공 합니다. 사이 실험 동물. 이러한 예방 조치를 주의 하는 것은 수 비 처리 관련된 microbiota 차이의 연구 결과 혼동 때문 필수적 이다. 제거 하는 비-전자 관련 microbiota 변화 특히 질병 개발 및 진행 하는 동안 microbiota 구성에 EE의 역할을 정의 하는 연구자 수 있게 된다.

<table><tbody><tr><td>Teklad Diets/Harlan Labs Chow</td><td>Harlan Labs</td><td>3980X</td><td>Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.</td></tr><tr><td>Cell-Sorb Plus bedding</td><td>Fangman Specialties</td><td>82010</td><td>Autoclave prior to use.</td></tr><tr><td>AIMS Tattooing System For Neonates</td><td>AIMS</td><td>NEO-9</td><td>https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.</td></tr><tr><td>Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system</td><td>Lab Products</td><td>82120ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Zyfone One Cage 2100 Life Span Enrichment Device</td><td>Lab Products</td><td>82109ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Zyfone One Cage 2100 Cage 13-7/8&quot; Length X 19-1/16&quot; Width X 7-3/4&quot; Depth</td><td>Lab Products</td><td>82100ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Zyfone One Cage 2100 AllerZone Micro-Isolator filter top</td><td>Lab Products</td><td>82101ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Tunnel</td><td>Bio-Serv</td><td>K3323 or K3332</td><td>Connect cages together and use for enrichment</td></tr><tr><td>Grommet to connect Tunnel to cages</td><td>Fabricated by the University of Utah Machine Shop</td><td>n/a</td><td>Be certain the material is resistant to chewing and autoclavable</td></tr><tr><td>Fast-track wheel</td><td>Bio-Serv</td><td>K3250 or K3251</td><td>Use with mouse igloo and floor</td></tr><tr><td>Mouse Igloo</td><td>Bio-Serv</td><td>K3328, K3570 or K3327</td><td>Use with Fast-track wheel and floor</td></tr><tr><td>Mouse Igloo floor</td><td>Bio-Serv</td><td>K3244</td><td>Use with mouse Igloo and Fast-Track</td></tr><tr><td>Mouse Hut</td><td>Bio-Serv</td><td>K3272, K3102 or K3271</td><td></td></tr><tr><td>Crawl Ball</td><td>Bio-Serv</td><td>K3330 or K3329</td><td></td></tr><tr><td>Bio-hut</td><td>Bio-Serv</td><td>K3352</td><td>Wood pulp hut used for sheltering and nesting</td></tr><tr><td>Adhesive film&amp;nbsp;</td><td>VWR</td><td>60941-072</td><td>Use to temporarily cover drilled hole in large cage to prevent mice from escaping</td></tr><tr><td>Laminar Flow Ventilated Rack</td><td>Techniplast</td><td>Bio-C36</td><td>The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.</td></tr><tr><td>1.5 mL Microfuge Tube- RNAse and DNAse free</td><td>Any supplier</td><td></td><td></td></tr><tr><td>QIAamp DNA Stool MiniKit</td><td>Qiagen</td><td>51504</td><td>This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE</td></tr><tr><td>Waterbath (capable of heating to 95)</td><td>Any supplier</td><td></td><td>For 94 degree incubation of stool samples to lyse cells.</td></tr><tr><td>Waterbath (capable of heating to 70 degrees)</td><td>Any supplier</td><td></td><td>For 70 degree incubation of stool samples&amp;nbsp;</td></tr><tr><td>Ethanol (200 proof)</td><td>Sigma Aldrich</td><td>E7023</td><td></td></tr><tr><td>Fluorometer: Qubit</td><td>ThermoFisher Scientific</td><td>Q33216</td><td></td></tr><tr><td>Qubit dsDNA broad Range Assay Kit</td><td>ThermoFisher Scientific</td><td>Q32850</td><td></td></tr><tr><td>EB Buffer or 10 mM Tris pH 8.5</td><td>Qiagen</td><td>19086</td><td></td></tr><tr><td>Experiment specific primers</td><td>Any Supplier</td><td></td><td></td></tr><tr><td>PCR grade water</td><td>Any supplier</td><td></td><td></td></tr><tr><td>2X KAPA HiFi HotStart Ready Mix&amp;nbsp;</td><td>Kapa Biosystems</td><td>KK2601</td><td>For Amplicon Amplification (1.25 mL allows 100 rxns).</td></tr><tr><td>Agarose for running diagnostic gels</td><td>Any supplier</td><td></td><td></td></tr><tr><td>TapeStation High Sensitivity D1000 Screen Tape Trace</td><td>Agilent</td><td>5067-5583</td><td>TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.</td></tr><tr><td>Agencourt AMPure XP Magnetic Beads</td><td>Beckman Coulter</td><td>A63880</td><td>Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions</td></tr><tr><td>Magnetic stand</td><td>Life Technologies</td><td>AM10027</td><td></td></tr><tr><td>Library Preparation Guide</td><td>Illumina</td><td></td><td>Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.</td></tr><tr><td>Unique Dual Indexing</td><td>Illumina</td><td>Illumina Experiment Manager Software</td><td>Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html</td></tr><tr><td>Nextera XT 96 Index Kit</td><td>Illumina</td><td>FC-131-1002</td><td>Used to add barcodes to amplicons</td></tr><tr><td>MicroAmp Optical 96-well reaction plate</td><td>Applied Biosystems/ThermoFisher</td><td>N8010560</td><td></td></tr><tr><td>TruSeq Index Plate Fixture</td><td>Illumina</td><td>FC-130-1005</td><td></td></tr><tr><td>Adhesive clear plate seal</td><td>Applied Biosystems /ThermoFisher</td><td>4360954</td><td>Applied Biosystems/ThermoFisher Microamp adhesive film</td></tr><tr><td>Sequencing by MiSeq with v3 reagents and dual 300 bp reads</td><td>Illumina</td><td>MS-102-3003</td><td></td></tr><tr><td>PhiX Control Kit</td><td>Illumina</td><td>FC-110-3001</td><td></td></tr><tr><td>Proteinase K (600 mAU/ml)</td><td>Qiagen</td><td>19131</td><td>Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit</td></tr><tr><td>Data Analysis Tools</td><td>Qiime</td><td>QIIME software Tools</td><td>Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime</td></tr><tr><td>Step 13.2.</td><td>Qiime</td><td>FastQ Join method</td><td>&amp;nbsp;(http://code.google.com/p/ea-utils &amp;nbsp;).&amp;nbsp; For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).</td></tr><tr><td>Step 13.3.</td><td>Qiime</td><td>De-Novo OTU picking protocol</td><td>http://qiime.org/scripts/pick_de_novo_otus.html.</td></tr><tr><td>Step 13.3.1.</td><td></td><td>Open Taxonomic Units (OTUs) using Uclust</td><td>Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).</td></tr><tr><td>Step 13.3.1.</td><td>Pynast</td><td>Pynast</td><td>Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010).&amp;nbsp;</td></tr><tr><td>Step 13.3.1.</td><td>Pynast</td><td>Pynast_Greengenes</td><td>DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study</td></tr><tr><td>13.3.1. Note:&amp;nbsp;</td><td>Qiime</td><td>Multiple Split Libraries</td><td>http://qiime.org/scripts/multiple_split_libraries_fastq.html.</td></tr><tr><td>13.3.1. Note:&amp;nbsp;</td><td>Qiime</td><td>Pick de novo OTUs script</td><td>http://qiime.org/scripts/pick_de_novo_otus.html&amp;nbsp;</td></tr><tr><td>Step 13.2.2.</td><td>Qiime</td><td>Create a mapping file</td><td>http://qiime.org/documentation/file_formats.html.</td></tr><tr><td>Step 13.2.2.</td><td>Qiime</td><td>Validate a mapping file</td><td>http://qiime.org/scripts/validate_mapping_file.html.</td></tr><tr><td>Step 13.3.3.</td><td>Qiime</td><td>Link the OTU to sample description to mapping file</td><td>http://qiime.org/scripts/make_otu_network.html.</td></tr><tr><td>Step 13.3.4.</td><td>Qiime</td><td>Summarize Taxa through plots</td><td>http://qiime.org/scripts/summarize_taxa_through_plots.html.</td></tr><tr><td>Step 13.3.5.</td><td>Qiime</td><td>Biome Summarize table</td><td>http://biom-format.org/documentation/summarizing_biom_tables.html&amp;nbsp; In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.</td></tr></tbody></table>

a method to define the effects of environmental enrichment on colon microbiome biodiversity in a mouse colon tumor model

여러 최근 연구 인간의 질병 개선에 풍부한 환경에서 생활의 유익한 효과 설명 했습니다. 마우스에서 환경 농축 (EE) tumorigenesis 마우스 면역 시스템을 활성화 하는 것을 줄여 또는 종양 microenvironment에서 향상 된 미생물 다양성을 포함 하 여 상처 복구 응답을 자극 하 여 종양 베어링 동물 생존에 영향을 줍니다. 여기에 마우스 대 장 종양 모델에서 미생물의 생물 다양성에 환경 농축의 효과 평가 하기 위해 자세한 절차입니다 제공. 동물 사육 및 동물 유전자 형 및 마우스 식민지 통합을 위한 고려 사항에 관한 주의 사항 설명, 모두는 궁극적으로 미생물 생물 다양성에 영향을. 이러한 예방 조치를 주의 더 균일 한 미생물 전송, 수 하 고 따라서 연구 결과 혼동 수 비 처리 종속 효과 완화할 것 이다. 또한,이 절차에서는 microbiota 변경 다음 장기 환경 농축 원심 결에서 수집 하는 자에서 분리 된 DNA의 16S rDNA 시퀀싱을 사용 하 여 특징입니다. 본질적인 microbiota 불균형은 염증 성 장 질환과 결 장 암, 뿐만 아니라 비만 및 다른 사람의 사이에서 당뇨병의 병 인에 연관 된다. 중요 한 것은, 다양 한 인간 질병을 정리 할 수 있는 존재 하는 강력한 마우스 모델 질병에서 미생물 병 인의 역할을 연구 하기 EE 및 미생물 분석을 위한이 프로토콜을 활용할 수 있습니다.

여러 연구 결과 정신 신체 의학의 실천 건강 결과 개량 한다 설명 했다. 마찬가지로, 마우스, 환경 농축 향상 된 수명 등 종양 상처 복구6결과 향상 시킵니다. 따라서, 전자 절차는 첫 번째 실험 (그림 1)의 개시 전에 미생물을 정상화 하는 동안이 표현 형에 microbiota의 역할을 정의 하는 것을 목적으로 개발 되었다. 중요 한 것은, 모든 사육 동물의 번 식, 시작 전 적어도 한 달 동안 마우스 식민지에 통합 되어 있으며 신생아 강아지 공동 실험 전에 microbiota 전송 정상화를 하나의 큰 감 금 소에 어머니와 함께 지 내게. 동물 21, 28 일 사이, 각 유전자 형의 동등한 숫자는 투약를 중단 시킨 그들의 각각 주택, EE 또는 북동 환경 (그림 2A)으로. 16 주에 수집 되는 모든 동물에서 자 고 무 균된 (그림 2B), 세균성 DNA 분리 뒤. 마지막으로, 16S amplicons에서 증폭 됩니다 대변 미생물 DNA와 바코드 동시에 모든 미생물 라이브러리의 시퀀싱에 대 한 수 있도록 인덱스 (그림 3). WT 및 종양 동물 NE와 EE 조건에서 베어링에서 식별 된 고유 시퀀스는 그림 4에 나와 있습니다. 흥미롭게도, EE WT 동물, 생물 다양성을 향상 되지 않습니다 하지만 성은이 방법은 생물 다양성 개선 수 보여주는 종양 베어링 동물 (그림 4), 생물 다양성 증가. 생물 다양성이 증가 문 Proteobacteria, 중요 한으로 Alphaproteobacteria, Betaproteobacteria, 클래스에서 증가 하 고 병원 성 Gammaproteobacteria (그림 5에서에서 감소의 증가 존재에 기 인할 수 있다 ; 추가 표 1)입니다. 가장 큰 증가 Betaproteobacteria에는 속 Sutterella, 가능성이 공생 분 비 IgA 저하 (그림 6,38도 참조)에 참여 하는 클래스 이다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57182/57182fig1.jpg"> 그림 1 : 실험 일정의 표현. 프로토콜의 대부분은 7 일 단위로 수행으로 짧은 밴드 7 일 창을 나타냅니다. 이 또한 실험에서 강아지 나가의 범위의 시각화에 에이즈. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57182/57182fig2.jpg"> 그림 2 : EE와 북동 주택 조건 및의 자 homogenates (로 프로토콜에서 설명). <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57182/57182fig3.jpg"> 그림 3 : 16 미생물 라이브러리 준비. (A)의 자 genomic DNA에서 파생 된 Unpurified PCR amplicon 제품. (B) 인덱싱 플레이트 그래픽 사용 하는 소프트웨어에 의하여 설계 (테이블의 재료, 23). 듀얼 인덱스 조합, I7 (인덱스 1; 행) 및 I5 (색인 2; 열), 각 샘플에 대 한 표시 됩니다. 각 인덱스는 8 길이 혈압. 샘플 번호 EE 연구에서 각각 마우스 숫자를 참조 하십시오. (C) Unpurified 인덱스 PCR 제품. (D) 최종의 품질 분석 및 순화 16S 라이브러리 풀링된. (A, C, D) 검은 화살표 550 bp amplicon 및 668 bp 인덱싱된 라이브러리를 나타냅니다. 빨간색 화살표 표시 디 와 같이 정화 다음 제거 하는 일반적인 제품 위 더 낮은 표식 크기 표식 크기 기준에 대 한 샘플에 추가 되며. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57182/57182fig4.jpg"> 그림 4 : 알파 다양성의 EE를 다음 변경 내용을 Tcf4Het / + Apc분 / + 동물. WT의 알파 다양성 및 Tcf4Het / + Apc분 / + 베어링 동물 종양. 20000 읽기, NE 및 pWT EE에서 0.64와 네브라스카의 EE = Tcf4Het / + Apc분 / +, p= 0.03 웰 치 교정으로 2-표본 t-검정을 사용 하 여. 바이스 외에서 적응. 2017,6. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57182/57182fig5.jpg"> 그림 5 : EE 중재 변경 다음의 EE Tcf4Het / + Apc분 / + 동물. R-ggplot2 문 Proteobacteria와 Alphaproteobacteria, Betaproteobacteria, 및 Gammaproteobacteria 클래스에에서 변화를 나타내는 상자-수염 음모를 생성. Outliers는 원으로 표시 됩니다. p= 0.005 웰 치 정정 2 샘플 t-테스트를 사용 하 여. 오류 바 평균 (SEM)의 표준 오차를 사용 하 여 계산. 바이스 외에서 적응. 2017,6. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57182/57182fig6.jpg"> 그림 6 : Sutterella 다음의 EE의 관계 되는 풍부의 변화 Tcf4Het / + Apc분 / + 동물. Outliers는 원으로 표시 됩니다. p= 0.005 웰 치 교정으로 2-표본 t-검정을 사용 하 여. 바이스 외에서 SEM. 적응을 사용 하 여 계산 된 오차 막대. 2017,6. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Supplemental Table 1" src="/files/ftp_upload/57182/57182suptable1.jpg"> 보충 표 1: 분류의 박테리아 로부터 격리 NE와 EE 쥐에서 수집 된의 자. (A) 문, (B) 클래스, (C) 주문, (D) 가족, 및 (E) 속 수준 genotypes 걸쳐 분류. 네브라스카와 동일한 유전자 형의 EE 또는 하 WT의 비교 Tcf4Het / + Apc분 / +. P-값은 웰 치 교정으로 2-표본 t-검정을 사용 하 여 계산 됩니다. 바이스 외에서 적응. 2017,6. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/Supplemental_Table_1_Fuller_et_al.xlsx" target="_blank">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>항목</td>
			<td>총 면적 (2인치)</td>
			<td>총 면적 (cm2)</td>
			<td>케이지 크기 (인치) 패 x 폭 x 높이</td>
			<td>케이지 크기 (cm) 패 x 폭 x 높이</td>
		</tr>
<tr>
<td>한 컨트롤 케이지 (네브라스카)</td>
			<td>68.25</td>
			<td>440.32</td>
			<td>10.5 x 6.5 x 5.5</td>
			<td>26.67 x 16.51 x 13.97</td>
		</tr>
<tr>
<td>하나의 큰 케이지 (EE)</td>
			<td>264.36</td>
			<td>1706.32</td>
			<td>13.87 x 19.06 x 7.75</td>
			<td>35.24 x 48.42 x 19.69</td>
		</tr>
<tr>
<td>두 명의 큰 감 금 소 (EE)</td>
			<td>528.72</td>
			<td>3412.64</td>
			<td>13.87 x 19.06 x 7.75 @ 2</td>
			<td>35.24 x 48.42 x 19.69 @ 2</td>
		</tr>
<tr>
<td>두 가지 플랫폼 (EE)</td>
			<td>93</td>
			<td>600</td>
			<td>11.8 x 3.94 x 2.95 @ 2</td>
			<td>30 x 10 x 7.5 @ 2</td>
		</tr>
<tr>
<td>두 가지 플랫폼 (EE)와 두 명의 큰 연습장</td>
			<td>621.72</td>
			<td>4013</td>
			<td>13.87 x 19.06 x 7.75 + 2 11.8 x 3.94 x 2.95 @ @ 2</td>
			<td>35.24 x 48.42 x 19.69 + 2 30 x 10 x 7.5 @ @ 2</td>
		</tr>
</tbody></table>표 1: EE와 네브라스카 케이지 크기와 평.
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>동물 감 금 소에 허용</td>
			<td>필요한 인치 동물 당 제곱</td>
			<td>EE 케이지 지역 (2인치)</td>
			<td>총 동물 수</td>
		</tr>
<tr>
<td>최대 25</td>
			<td>12</td>
			<td>2 (4013 cm2) 622</td>
			<td>최대 25</td>
		</tr>
<tr>
<td>25 +</td>
			<td>15</td>
			<td>2 (4013 cm2) 622</td>
			<td>최대 41</td>
		</tr>
<tr>
<td>쓰레기와 여성</td>
			<td>51</td>
			<td>2 (4013 cm2) 622</td>
			<td>최대 12</td>
		</tr>
</tbody></table>표 2: 공간에 따라 장에 동물의 숫자를 허용 15 .
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td colspan="4">Amplicon PCR 뇌관</td>
		</tr>
<tr>
<td>앞으로</td>
			<td colspan="3">5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '</td>
		</tr>
<tr>
<td>역</td>
			<td colspan="3">5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '</td>
		</tr>
<tr>
<td colspan="4">로커 스 특정 시퀀스는 굵게 표시 됩니다 그리고 비-굵게 오버행 어댑터 시퀀스.</td>
		</tr>
</tbody></table>표 3: Amplicon PCR 뇌관.
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>Amplicon PCR 반응 설정</td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td>볼륨</td>
		</tr>
<tr>
<td></td>
			<td></td>
		</tr>
<tr>
<td>미생물 DNA (5ng/μ)</td>
			<td>2.5 μ</td>
		</tr>
<tr>
<td>뇌관을 전달 (1 μ M; 5.1.2 단계에서)</td>
			<td>5.0 μ</td>
		</tr>
<tr>
<td>반전 뇌관 (1 μ M; 5.1.2 단계에서)</td>
			<td>5.0 μ</td>
		</tr>
<tr>
<td>뜨거운 시작 준비 믹스 X 2</td>
			<td>12.5 μ</td>
		</tr>
<tr>
<td>총</td>
			<td>25.0 μ</td>
		</tr>
</tbody></table>표 4: Amplicon PCR 혼합.
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td colspan="2">Amplicon PCR 설정</td>
		</tr>
<tr>
<td>3 분 동안 95 ° C</td>
			<td></td>
		</tr>
<tr>
<td>25 주기:</td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td>30 초 동안 95 ° C</td>
		</tr>
<tr>
<td></td>
			<td>30 초 동안 55 ° C</td>
		</tr>
<tr>
<td></td>
			<td>60 초 동안 72 ° C</td>
		</tr>
<tr>
<td>3 분 동안 72 ° C</td>
			<td></td>
		</tr>
<tr>
<td>4 ° C에서 개최</td>
			<td></td>
		</tr>
</tbody></table>표 5: Amplicon PCR 프로그램을 설정합니다.
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td colspan="2">인덱스 PCR 바코드 어셈블리</td>
		</tr>
<tr>
<td>DNA</td>
			<td>2.5 μ</td>
		</tr>
<tr>
<td>인덱스 뇌관 1 (N7XX)</td>
			<td>2.5 μ</td>
		</tr>
<tr>
<td>인덱스 뇌관 2 (S5XX)</td>
			<td>2.5 μ</td>
		</tr>
<tr>
<td>뜨거운 시작 준비 믹스 X 2</td>
			<td>12.5 μ</td>
		</tr>
<tr>
<td>PCR 학년 물</td>
			<td>5 μ</td>
		</tr>
<tr>
<td>총</td>
			<td>25 μ</td>
		</tr>
</tbody></table>표 6: PCR 혼합 색인.
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td colspan="2">인덱스 PCR 설치</td>
		</tr>
<tr>
<td>3 분 동안 95 ° C</td>
			<td></td>
		</tr>
<tr>
<td>8 주기:</td>
			<td></td>
		</tr>
<tr>
<td></td>
			<td>30 초 동안 95 ° C</td>
		</tr>
<tr>
<td></td>
			<td>30 초 동안 55 ° C</td>
		</tr>
<tr>
<td></td>
			<td>30 초 동안 72 ° C</td>
		</tr>
<tr>
<td>5 분 동안 72 ° C</td>
			<td></td>
		</tr>
<tr>
<td>4 ° C에서 개최</td>
			<td></td>
		</tr>
<tr>
<td>-20 ° C에서 저장소</td>
			<td></td>
		</tr>
</tbody></table>표 7: 인덱스 PCR 프로그램 설정 최대
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>풀링을 위해 수식 농도</td>
		</tr>
<tr>
<td>(Ng/μ에 DNA 농도) x 106 nM에서 농도 = (평균 라이브러리 크기 x 660 g/mol)</td>
		</tr>
<tr>
<td>이 연구에서 예가입니다.</td>
		</tr>
<tr>
<td>(85.2 ng/μ) x 10 ^6 = 193.3 nM (660 g / mol x 668 bp)</td>
		</tr>
</tbody></table>표 8: 샘플 풀링 하기 전에 정규화에 대 한 수식

Watch this Scientific Journal Video about A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model at JoVE.com

A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model

환경 농축 (EE) 생활, 스트레스, 질병 사이 연결의 기반이 되는 메커니즘을 공개 하는 데 사용 되는 동물 주택 환경입니다. 이 프로토콜에서는 콜론 tumorigenesis EE의 마우스 모델을 사용 하 여 특별히 microbiota 생물 다양성 동물 사망률에 영향을 줄 수 있는 변경을 정의 하는 프로시저를 설명 합니다.

마우스 결 장 종양 모델에서 콜론 미생물 생물 다양성에 환경 농축의 효과 정의 하는 방법

Several recent studies have illustrated the beneficial effects of living in an enriched environment on improving human disease. In mice, environmental ...

a-method-to-define-effects-environmental-enrichment-on-colon

Nanyang Technological University

Research

JoVE Journal

Cancer Research

8.7K 조회수.  University of Utah. 환경 농축 (EE) 생활, 스트레스, 질병 사이 연결의 기반이 되는 메커니즘을 공개 하는 데 사용 되는 동물 주택 환경입니다. 이 프로토콜에서는 콜론 tumorigenesis EE의 마우스 모델을 사용 하 여 특별히 microbiota 생물 다양성 동물 사망률에 영향을 줄 수 있는 변경을 정의 하는 프로시저를 설명 합니다.

비디오: A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model

A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Genetically engineered mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in large organs such as the colon in which only a single tumor is desired.
As a result, an immunocompetent, genetically engineered mouse model of colorectal cancer was developed which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor development is initiated by surgical, segmental infection of the distal colon with adeno-cre virus in compound conditionally mutant mice. The tumors can be easily detected and monitored via colonoscopy. We here describe the surgical technique of segmental adeno-cre infection of the colon, the surveillance of the tumor via high-resolution colonoscopy and present the resulting colorectal tumors.

A protocol for the establishment of a genetically engineered mouse model of colorectal cancer by segmental adeno-cre infection and its surveillance via high-resolution colonoscopy is presented.

산발성 대장 암의 유 전적으로 조작 된 마우스 모델

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations ...

연구

암 연구학

A Protocol for Housing Mice in an Enriched Environment

Environmental enrichment (EE) is a housing environment for mice that boosts mental and physical health compared to standard laboratory housing. Our recent studies demonstrate that environmental enrichment decreases adiposity, increases energy expenditure, resists diet induced obesity, and causes cancer remission and inhibition in mice. EE typically consists of larger living space, a variety of &#8216;toys&#8217; to interact with, running wheels, and can include a number of other novel environmental changes. All of this fosters a more complex social engagement, cognitive and physical stimulations. Importantly, the toy location and type of toy is changed regularly, which encourages the mice to adapt to a frequently changing and novel environment. Many variables can be manipulated in EE to promote health effects in mice. Thus these approaches are difficult to control and must be properly managed to successfully replicate the associated phenotypes. Therefore, the goal of this video is to demonstrate how EE is properly set up and maintained to assure a complex, challenging, and controlled environment so that other researchers can easily reproduce the protective effects of EE against obesity and cancer.

Environmental enrichment for mice requires a complex and challenging setup, as well as comprehensive husbandry and handling techniques to assure robust metabolic and anti-cancer effects in the mice. This protocol provides detailed procedures to reproduce the above mentioned effects in mice.

풍부한 환경에서의 주택 마우스를위한 프로토콜

Environmental enrichment (EE) is a housing environment for mice that boosts mental and physical health compared to standard laboratory housing. Our recent ...

행동분석학

Orthotopic Mouse Model of Colorectal Cancer

The traditional subcutaneous tumor model is less than ideal for studying colorectal cancer. Orthotopic mouse models of colorectal cancer, which feature cancer cells growing in their natural location, replicate human disease with high fidelity. Two techniques can be used to establish this model. Both techniques are similar and require mouse anesthesia and laparotomy for exposure of the cecum. One technique involves injection of a colorectal cancer cell suspension into the cecal wall. Cancer cells are first grown in culture, harvested when subconfluent and prepared as a single cell suspension. A small volume of cells is injected slowly to avoid leakage. The other technique involves transplantation of a piece of subcutaneous tumor onto the cecum. A mouse with a previously established subcutaneous colorectal tumor is euthanized and the tumor is removed using sterile technique. The tumor piece is divided into small pieces for transplantation to another mouse. Prior to transplantation, the cecal wall is lightly damaged to facilitate tumor cell infiltration. The time to developing primary tumors and liver metastases will vary depending on the technique, cell line, and mouse species used. This orthotopic mouse model is useful for studying the natural progression of colorectal cancer and testing new therapeutic agents against colorectal cancer.

Two techniques can be used to establish this model: injection of a cancer cell suspension into the cecal wall or transplantation of a piece of subcutaneous tumor onto the cecum. This model is useful for studying the natural progression of colorectal cancer and testing new therapeutic agents against colorectal cancer.

대장암의 Orthotopic 마우스 모델

The traditional subcutaneous tumor model is less than ideal for studying colorectal cancer. Orthotopic mouse models of colorectal cancer, which feature ...

생물학

Enrichment and Characterization of the Tumor Immune and Non-immune Microenvironments in Established Subcutaneous Murine Tumors

The tumor immune microenvironment (TIME) has recently been recognized as a critical mediator of treatment response in solid tumors, especially for immunotherapies. Recent clinical advances in immunotherapy highlight the need for reproducible methods to accurately and thoroughly characterize the tumor and its associated immune infiltrate. Tumor enzymatic digestion and flow cytometric analysis allow broad characterization of numerous immune cell subsets and phenotypes; however, depth of analysis is often limited by fluorophore restrictions on panel design and the need to acquire large tumor samples to observe rare immune populations of interest. Thus, we have developed an effective and high throughput method for separating and enriching the tumor immune infiltrate from the non-immune tumor components. The described tumor digestion and centrifugal density-based separation technique allows separate characterization of tumor and tumor immune infiltrate fractions and preserves cellular viability, and thus, provides a broad characterization of the tumor immunologic state. This method was used to characterize the extensive spatial immune heterogeneity in solid tumors, which further demonstrates the need for consistent whole tumor immunologic profiling techniques. Overall, this method provides an effective and adaptable technique for the immunologic characterization of subcutaneous solid murine tumors; as such, this tool can be used to better characterize the tumoral immunologic features and in the preclinical evaluation of novel immunotherapeutic strategies.

Here we describe a method to separate and enrich components of the tumor immune and non-immune microenvironment in established subcutaneous tumors. This technique allows for the separate analysis of tumor immune infiltrate and non-immune tumor fractions which can permit comprehensive characterization of the tumor immune microenvironment.

농축 및 설립된 피하 Murine 종양에서 종양 면역 및 비 면역 Microenvironments의 특성

The tumor immune microenvironment (TIME) has recently been recognized as a critical mediator of treatment response in solid tumors, especially for ...

Modeling Colitis-Associated Cancer with Azoxymethane (AOM) and Dextran Sulfate Sodium (DSS)

Individuals with inflammatory bowel disease (IBD), such as Crohn's disease (CD) or ulcerative colitis (UC) are at increased risk of developing colorectal cancer (CRC) over healthy individuals. This risk is proportional to the duration and extent of disease, with a cumulative incidence as high as 30% in individuals with longstanding UC with widespread colonic involvement.1 Colonic dysplasia in IBD and colitis associated cancer (CAC) are believed to develop as a result of repeated cycles of epithelial cell injury and repair while these cells are bathed in a chronic inflammatory cytokine milieu.2 While spontaneous and colitis-associated cancers share the quality of being adenocarcinomas, the sequence of underlying molecular events is believed to be different.3 This distinction argues the need for specific animal models of CAC.
Several mouse models currently exist for the study of CAC. Dextran sulfate sodium (DSS), an agent with direct toxic effects on the colonic epithelium, can be administered in drinking water to mice in multiple cycles to create a chronic inflammatory state. With sufficient duration, some of these mice will develop tumors.4 Tumor development is hastened in this model if administered in a pro-carcinogenic setting. These include mice with genetic mutations in tumorigenesis pathways (APC, p53, Msh2), as well as mice pre-treated with genotoxic agents (azoxymethane [AOM], 1,2-dimethylhydrazine [DMH]).5 
The combination of DSS with AOM as a model for colitis associated cancer has gained popularity for its reproducibility, potency, low price, and ease of use. Though they have a shared mechanism, AOM has been found to be more potent and stable in solution than DMH. While tumor development in other models generally requires several months, mice injected with AOM and subsequently treated with DSS develop adequate tumors in as little as 7-10 weeks.6, 7 Finally, AOM and DSS can be administered to mice of any genetic background (knock out, transgenic, etc.) without cross-breeding to a specific tumorigenic strain. Here, we demonstrate a protocol for inflammation-driven colonic tumorigenesis in mice utilizing a single injection of AOM followed by three seven-day cycles of DSS over a 10 week period. This model induces tumors with histological and molecular changes closely resembling those occurring in human CAC and provides a highly valuable model for the study of oncogenesis and chemoprevention in this disease.8

Modeling Colitis-Associated Cancer with Azoxymethane AOM and Dextran Sulfate Sodium DSS

We demonstrate a protocol in which administration of the genotoxic agent azoxymethane (AOM) followed by three cycles of the pro-inflammatory agent dextran sulfate sodium (DSS) rapidly and consistently generates colon tumors in mice with morphologic and molecular similarities to those seen in human colitis-associated cancer.

Azoxymethane (AOM)과 Dextran의 황산 나트륨 (DSS)와 모델링 대장염 - 관련 암

Individuals with inflammatory bowel disease (IBD), such as Crohn's disease (CD) or ulcerative colitis (UC) are at increased risk of developing colorectal ...

의학

Non-invasive Assessment of the Efficacy of New Therapeutics for Intestinal Pathologies Using Serial Endoscopic Imaging of Live Mice

Animal models of inflammatory bowel disease (IBD) and colorectal cancer (CRC) have provided significant insight into the cell intrinsic and extrinsic mechanisms that contribute to the onset and progression of intestinal diseases. The identification of new molecules that promote these pathologies has led to a flurry of activity focused on the development of potential new therapies to inhibit their function. As a result, various pre-clinical mouse models with an intact immune system and stromal microenvironment are now heavily used. Here we describe three experimental protocols to test the efficacy of new therapeutics in pre-clinical models of (1) acute mucosal damage, (2) chronic colitis and/or colitis-associated colon cancer, and (3) sporadic colorectal cancer. We also outline procedures for serial endoscopic examination that can be used to document the therapeutic response of an individual tumor and to monitor the health of individual mice. These protocols provide complementary experimental platforms to test the effectiveness of therapeutic compounds shown to be well tolerated by mice.

We describe methods for longitudinal monitoring of the efficacy of therapeutics for the treatment of colonic pathologies in mice using a rigid endoscope. This protocol can be readily used for the characterization of the therapeutic response of an individual tumor in live mice and also for monitoring potential disease relapse.

라이브 마우스의 직렬 내시경 이미징을 사용하여 소장 병변에 대한 새로운 치료제의 효능의 비 침습적 평가

Animal models of inflammatory bowel disease (IBD) and colorectal cancer (CRC) have provided significant insight into the cell intrinsic and extrinsic ...

Murine Distal Colostomy, A Novel Model of Diversion Colitis in C57BL/6 Mice

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a diverting enterostomy. The etiology of this disease remains ill-defined but appears to differ from that of classical inflammatory bowel diseases such as Crohn's disease and ulcerative colitis. Research aimed to decipher the pathophysiological mechanisms leading to the development of this disease has been severely hampered by the lack of an appropriate murine model. This protocol generates a murine model of DC that facilitates the study of the immune system's role and its interaction with the microbiome in the development of DC. In this model using C57BL/6 animals, distal parts of the colon are excluded from the fecal stream by creating a distal colostomy, triggering the development of mild to moderate inflammation in the excluded bowel segments and reproducing the hallmark lesions of human DC with a moderate systemic inflammatory response. In contrast to the rat model, a large number of genetically-modified murine models on the C57BL/6 background are available. The combination of these animals with our model allows the potential roles of individual cytokines, chemokines, or receptors of bioactive molecules (e.g., interleukin (IL)-17; IL-10, chemokine CXCL13, chemokine receptors CXCR5 and CCR7, and the sphingosine-1-phosphate receptor 4) to be assessed in the pathogenesis of DC. The availability of congenic mouse strains on the C57BL/6 background largely facilitates transfer experiments to establish the roles of distinct cell types involved in the etiology of DC. Finally, the model offers the opportunity to assess the influences of local interventions (e.g., modification of the local microbiome or local anti-inflammatory therapy) on mucosal immunity in affected and non-affected bowel segments and the on systemic immune homeostasis.

Murine distal colostomy provides a murine model for human diversion colitis, a predominantly lymphocytic colitis in colon segment excluded from the fecal stream.

Murine 원심 인공, C57BL/6 마우스에 전환 Colitis의 새로운 모델

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a ...

Liujunzi 달인: UC-CRC 예방을 위한 효과적인 치료

Establishment of Coloproctitis Cancer Model in Mice and Evaluation of Therapeutic Effect of Chinese Medicine

Colorectal cancer (CRC) is a common malignancy of the digestive system and has become the third most common malignancy worldwide and the second leading cause of malignancy-related death. Ulcerative coloproctitis (UC) is a precancerous lesion, and UC-associated CRC (UC-CRC) is the most common subtype of CRC. Therefore, a reasonable UC-CRC model is the cornerstone and guarantee of new drug development. Traditional Chinese medicine (TCM) has been widely used in the treatment of UC-CRC due to its good efficacy. As a classic tonic prescription of TCM, Liujunzi decoction (LJZD) has been widely used in the treatment of UC-CRC. In this study, a UC-CRC model was established by combining azomethane and dextran sulfate sodium, and the LJZD was administered. The data confirmed that LJZD can effectively inhibit cancer transition in UC-CRC by using mouse body weight, colorectal length, pathological and inflammatory factors, colorectal barrier function, and cancer markers. This protocol provides a system for evaluating the efficacy of TCM in the prevention and treatment of UC-CRC.

저자 스포트라이트: 대장막염 암에 대한 중국 전통 치료법으로서의 Liujunzi 달인

This protocol provides a mouse model of ulcerative coloproctitis-associated colorectal cancer induced by azomethane combined with dextran sulfate sodium. The model was used to evaluate the efficacy of traditional Chinese medicine compounds in the prevention and treatment of colorectal cancer.

생쥐의 대장염 암 모델 확립 및 한의학 치료 효과 평가

Colorectal cancer (CRC) is a common malignancy of the digestive system and has become the third most common malignancy worldwide and the second leading ...

마우스 결 장 종양 모델에서 콜론 미생물 생물 다양성에 환경 농축의 효과 정의 하는 방법

요약

더 많은 비디오 탐색

이 비디오의 챕터

산발성 대장 암의 유 전적으로 조작 된 마우스 모델

풍부한 환경에서의 주택 마우스를위한 프로토콜

대장암의 Orthotopic 마우스 모델

농축 및 설립된 피하 Murine 종양에서 종양 면역 및 비 면역 Microenvironments의 특성

Azoxymethane (AOM)과 Dextran의 황산 나트륨 (DSS)와 모델링 대장염 - 관련 암

라이브 마우스의 직렬 내시경 이미징을 사용하여 소장 병변에 대한 새로운 치료제의 효능의 비 침습적 평가

Murine 원심 인공, C57BL/6 마우스에 전환 Colitis의 새로운 모델

생쥐의 대장염 암 모델 확립 및 한의학 치료 효과 평가

생쥐의 대장염 암 모델 확립 및 한의학 치료 효과 평가

생쥐의 대장염 암 모델 확립 및 한의학 치료 효과 평가