우리 기술 지원에 대 한 A. Talal 닥터 R 스톡 BCG 파스퇴르 스트레인에 대 한 감사합니다. 우리는 또한 유전자 합성에 대 한 GenScript을 감사합니다.

모든 동물 동물 관리 및 사용 위원회 브리티시 컬럼비아의 대학에 의해 찬성 하는 프로토콜에 따라 유지 되었다. 실험 동물 관리 및 사용 위원회에 의해 승인 되었고 캐나다 위원회 동물 관리 지침에 따라 수행. 동물 보증 복지 수는 A11-0247.
1. 플라스 미드를 표현 하는 단위체 Avidin 융해 단백질의 생성
<ol><li>하위 단위체 avidin 시퀀스12 133에 해당 하는 "CTC"와 "GAA" 사이트 사이 pDEST17 플라스 미드로 복제-134bp. (즉, 6-histag와 pDEST17 Attr1 재결합 사이트 사이) p17-Avi를. 참고: 단위체 avidin DNA 순서는 다음과 같습니다. 단위체 avidin를 야생-타입 Avidin에 도입 된 3 개의 돌연변이 굵게 문자에서 표시 됩니다. gccagaaagtgctcg ctgactggga aatggaccaa cgatctgggc tccATCatga ccatcggggc tgtgaacagc agaggtgaat tcacaggcac ctacatcaca gccgtaacag ccacatcaaa tgagatcaaa gagtcaccac tgcatgggac acaaGCTacc atcaacaaga ggacccagcc cacctttggc ttcaccgtca attggaagtt ttcagagtcc accactgtct tcacgggcca gtgcttcata gacaggaatg ggaaggaggt cctgaagacc atgtggctgc tgcggtcaag tgttaatgac attggtgatg acAAAaaagc taccagggtc ggcatcaaca tcttcactcg cctgcgcaca cagaaggagt가</li>
	<li>At & tb 1과 b 2를 at & t사이트에 해당 OVA polypeptide757-1035 하 형벌 뇌관 디자인 (-Ab-와 H-2_Kb-epitopes를 제한) DNA 순서. 뇌관 순서는: Attb1-OVA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTTGAGCAGCTTGAGAGTAT와 at & tb 2-OVA GGGGACCACTTTGTACAAGAAAGCTGGGTGTTACCCTACCACCTCTCTGC입니다. (At & tb 1과 b2 시퀀스를 at & t는 굵게 표시)입니다.<ol>
<li>PCR 증폭 OVA polypeptide757-1035 DNA 시퀀스를 템플릿으로 pUC57 OVA 플라스 미드를 사용 하 여 뇌관으로.</li>
		<li>사이트별 생체 외에서 재결합 반응 (예를 들어, BP Clonase) pDONR-OVA를 통해 pDONR-221에 PCR 제품을 복제.</li>
	</ol>
</li>
	<li>P17-Avi p17-Avi-OVA를 LR Clonase 반응 사용에 관심사의 유전자를 전송 합니다. 참고: 혈압 및 LR 재조합 복제의 내용은 제조업체의 설명서 참조.</li>
</ol>2. 단위체 Avidin 퓨전 단백질 표정, 정화, 및 Refolding
<ol><li>P17-Avi-OVA 플라스 미드를 대장균 BL21 변환 및 대장균 BL21 문화 IPTG (0.1 m M)를 37 ° c.에 3 h의 250 mL를 유도</li>
	<li>
포함 시체 가용 화 및 박테리아의 lysis
	<ol>
<li>원심 분리 g x 4000와 4 ° c.의 30 분 유도 BL21 문화의 250 mL 작은</li>
		<li>세포의 용 해 버퍼의 10 mL에 알 약을 수집 (50 m Tris HCL, 150 m NaCl, m 6 m M Guanidine-HCL, pH 1.5-2.5)와 95 ° c.에 15 분 동안 품 어 회전자에 실 온에서 하룻밤를 품 어.</li>
		<li>30 분 x g와 4 ° C와 수집 상쾌한 15000 원심</li>
	</ol>
</li>
	<li>
Avi-OVA에서 상쾌한 (포함 시체 Solubilized 분수) Ni NTA 열을 사용 하 여 정화.
	<ol>
<li>세포의 용 해 버퍼 포함 시체 1:2 희석.</li>
		<li>Ni NTA 수 지 문화 파생 포함 시체의 250 mL 당 4 mL를 사용 합니다.</li>
		<li>3 배 (pH 7.0) 세포의 용 해 버퍼의 10 mL와 함께 씻으십시오.</li>
		<li>차입 버퍼 (세포의 용 해 버퍼 pH 7.0 250mm 이미와) 10 mL와 함께 elute.</li>
	</ol>
</li>
	<li>점진적으로 희석 (1:10)에 의해 eluted 단백질 refold Tris 버퍼 (pH 7.5)에 급속 한 vortexing 포함 1mm DTT, 200 m m NDSB256 (3-(Benzyldimethylammonio)propanesulfonate), 0.5 m 트윈 80 m, 500mm 아르기닌, 그리고 200 m m NaCl 실 온에서 30 분.</li>
	<li>드 소금과 버퍼 교환 제조 업체의 프로토콜에 따라 단백질 집중으로 PBS에 Tris 버퍼에서 단백질을 refolded.</li>
	<li>3500 x g 와 4 ° C에서 30 분 동안 원심 분리 하 여 집계를 제거 하 고-20 ° c.에 녹는 단백질의 aliquots를 저장</li>
</ol>3입니다. BCG 세포 표면 Biotinylation
<ol><li>미들 7 H에에서 BCG 성장 9 국물 10 %OADC (올레산, 알 부 민 및 포도 당 솔루션) 및 0.05% 트윈 80 세까지 50 rpm에서 통 플랫폼에서 37 ° C에서 0.5-1 =. 참고: BCG biosafety 수준 2 병원 체 이며 모든 실험에 관한 BCG biosafety 적절 한 개인 보호 장비와 캐비닛에서 이루어져야 한다.</li>
	<li>500 µ L의 얼음도 무료 PBS 플러스 0.1 %Tween80 (PBST) (pH 8.0)와 109 BCG 3 번 세척. 메 마른 내 무료 PBS에 BCG 펠 릿을 일시 중단 합니다.</li>
	<li>
즉시 사용 하기 전에 살 균 필터링 된 물에 10 m m Sulfo NHS SS biotin의 1 mL를 준비 합니다.
	<ol>
<li>30 분 동안 실내 온도에 Sulfo NHS SS biotin의 0.5 m m의 1 mL와 함께 박테리아를 품 어.</li>
	</ol>
</li>
	<li>
3 번 비 반응 biotinylation 시 약을 제거 하 아이스 콜드 PBST의 500 µ L로 레이블이 지정 된 박테리아를 씻으십시오.
	<ol>
<li>다시 PBST의 1 mL에 펠 릿을 일시 중단 합니다.</li>
	</ol>
</li>
	<li>
Biotinylation 효율성 평가, 20 분 동안 실 온에서 108 biotinylated Streptavidin FITC (1: 100, 25 µ L)으로 BCG를 얼룩.
	<ol>
<li>2%의 1 mL에 얼룩진된 박테리아를 품 어 실 온에서 20 분 동안 PFA와 교류 cytometry 분석에 의해 biotinylation의 레벨을 검사 하 여 다음.</li>
	</ol>
</li>
</ol>4. Biotinylated Mycobacteria의 표현 형: 성장 및 생존
<ol><li>
미들 7 H에에서 BCG 긴장 성장 9 국물 10 %OADC (올레산, 알 부 민 및 포도 당 솔루션) 및 0.05% 트윈 80 50 rpm에서 통 플랫폼에서 37 ° C에서.
	<ol>
<li>8 일 동안 세균성 문화의 광학 밀도 (OD600)를 기록 합니다.</li>
	</ol>
</li>
	<li>
대 식 세포에 박테리아의 생존을 감지 하 BCG-뤽 (앞에서 설명한9)를 사용 합니다.
	<ol>
<li>Biotinylated BCG-루크 (나 10:1)와 RAW264.7 세포를 감염 또는 BCG-뤽 (제어) 치료 및 48 h 동안 37 ° C에서 incubated 기간.</li>
		<li>셀 monolayers 세척 하 고 0.025 %SDS 섭취 박테리아를 출시와 함께 다음 lyse.</li>
		<li>생물 발광 Luciferase 분석 결과 시스템 루미 노 생산을 측정 합니다. 참고: 발광 신호는 세균 생존 능력의 지표 이다. Luciferase 분석 결과의 내용은 제조업체의 설명서를 참조 하십시오.</li>
	</ol>
</li>
</ol>5. Biotinylated BCG 표면에 단위체 Avidin-퓨전 단백질 바인딩
<ol><li>Avi-단백질 (PBS-T의 최종 10 μ g/mL) 5 x 108 biotinylated BCG 통 플랫폼에 실 온에서 1 h에 대 한 믹스.</li>
	<li>아이스 콜드 PBST와 얼룩 토끼 방지 avidin 항 체 (Ab) (1: 100 희석, 앞에서 설명한10) 실 온에서 20 분 및 다음 FITC 500 µ L로 3 번 세척 박테리아 염소-토끼 IgG Ab는 동일한 조건에서 활용.</li>
	<li>3 번과 PBST의 500 µ L 세균을 세척 하 고 cytometry 표면 장식의 정도 평가 하 여 분석.</li>
</ol>6입니다. Mycobacteria의 동결
<ol><li>Biotinylate 박테리아 단계 3.1-3.4와 코트 biotinylated 박테리아에 따라 Avi OVA와 단계 5.1에 따라.</li>
	<li>Aliquot biotinylated 및 코팅된 박테리아 (108), PBS로 세척 하 고 다시 0.5 mL 동결은 미디어에서 일시 중지 (25 %Sauton 매체, 75% H2O, 그리고 1.5% 나 조미료).</li>
	<li>유리 튜브에 박테리아를 전송 하 고 하룻밤-80 ° C 냉동 고에서 얼어.</li>
	<li>동결 건조 기를 사용 하 여 24 시간 냉동된 채워진된 유리 튜브 lyophilize</li>
	<li>실 온에서 말린된 견본을 저장 하 고 필요할 때 PBS에서 다시 구성.</li>
	<li>3.5 biotinylation 및 표면 코팅 안정성 평가를 단계를 반복 합니다.</li>
</ol>7. 먹어서 분석 결과
<ol><li>70-80 %confluency 10 cm 직경 문화 요리 DMEM 매체 포함 5 %FCS, 1%의 L-글루타민, HEPES, 비필수 아미노산, 그리고 페니실린과 스에에서 RAW 264.7 대 식 세포 세포를 성장 한다.</li>
	<li>6 잘 플레이트에서 2 x 106 RAW 264.7 대 식 세포 세포 씨앗 37 ° C, 5% CO2에서 하룻밤 준수를 셀 수 있습니다.</li>
	<li>DsRed BCG 생성 단계 3.1-3.4 및 5.1 Avi-OVA (DsRed BCG-Avi-OVA) 장식 (앞에서 설명한9).</li>
	<li>DsRed BCG-Avi-OVA 또는 치료 DsRed BCG 나 37 ° c.에 24 h에 대 한 20: 1에서 원시 세포를 감염</li>
	<li>셀 세 번 세척 하 고 10 분 동안 37 ° C에서 부분적으로 분리 된 박테리아를 제거 하 0.25 %trypsin 1 mL를 사용 하 여 trypsinize.</li>
	<li>2.5%에서 수정 PFA 실 온에서 20 분에 대 한 PBS에.</li>
	<li>PBS로 3 회 세척 하 고 cytometry 분석.</li>
</ol>8. 대 식 세포에 BCG Biotinylated 장식의 OVA 세포내 매매
<ol><li>
형광 현미경 검사 법
	<ol>
<li>Coverslips 24-잘 접시에서에 3 x 105 RAW 264.7 대 식 세포 세포 씨앗 37 ° C, 5% CO2에서 하룻밤 준수를 셀 수 있습니다.</li>
		<li>유지 보수 미디어에서 37 ° C, 5% CO2 4 ~ 24 h에 대 한 항생제 없이 mycobacteria (나 10:1)와 대 식 세포 세포를 감염.</li>
		<li>세포를 세척 하 고 단계 7.5로 표면 부착, 비 섭취 박테리아를 제거 하는 trypsinize.</li>
		<li>2.5%에서 감염 수정 셀 PFA 실 온에서 20 분에 대 한 PBS에 PBS 가진 3 세척 옵니다.</li>
		<li>차단/permeabilization 버퍼에 세포를 permeabilize (0.1% 트라이 톤 X-100, PBS에 3 %BSA) 실 온에서 20 분.<ol>
<li>관심의 사용 하 여 특정 항 체 (예, 안티 avidin Ab 토끼) permeabilization에서 10 μ g/mL에서 실 온에서 20 분에 대 한 버퍼 다음 이차 항 체 (예를 들어, FITC 염소-토끼 IgG) 20 분.</li>
		</ol>
</li>
		<li>워시 번와 물, 형광 photobleaching를 최소화 하기 위해 수성 장착 매체의 10 μ에 슬라이드에 PBS 가진 3 배 세포.</li>
		<li>슬라이드 63 x를 갖춘 epifluorescence 현미경을 사용 하 여 디지털 confocal 현미경 검사 법으로 검사 / 1.4 계획 Apochromat 목표. 디지털 카메라를 사용 하 여 이미지를 기록 현미경 소프트웨어를 결합.</li>
	</ol>
</li>
	<li>
Immunogold 얼룩 및 전자 현미경 검사 법
	<ol>
<li>6 잘 플레이트에서 2 x 106 RAW 264.7 대 식 세포 세포 씨앗</li>
		<li>4%로 BCG 감염 세포 수정 PFA 실 온에서 4 시간.</li>
		<li>PBS와 두 번 씻는 다.</li>
		<li>4% 낮은 융 점 agarose에서 샘플을 포함 하 고 70% 에탄올에서 탈수.</li>
		<li>아크릴 수 지에 샘플을 전송 하 고 50 ° c.에 유해</li>
		<li>톰으로 60 nm 섹션을 잘라내어 니켈 격자에 섹션을 수집.</li>
		<li>1 시간 실 온에서 또는 부 화 솔루션 (PBS와 0.1 %BSA) 4 ° C 하룻밤에 10 μ g/mL avidin 항 체와 고 부 화 솔루션 금 활용 된 F(ab')2 매우 작은 염소-안티-토끼의 다음 세척 실에서 1 시간 (1/20) IgG 부 화 솔루션에 온도입니다.</li>
		<li>섹션 증류수에 세척, 2%도 얼룩, 다시, 건조, 공기 세척 및 전자 현미경으로 검사.</li>
	</ol>
</li>
</ol>9. 동물 면역 및 장기 처리
참고: 모든 단계는 biosafety 내각에서 행해져야 한다.
<ol><li>패스 biotinylated 및 단백질 코팅 박테리아 271/2G 바늘을 통해 10 번 단일 세포 현 탁 액을 만들기 위해.</li>
	<li>
1 x 106 박테리아도 무료 PBS의 100 μ에 고는 여성 C57BL/6 쥐 (-Ab, H-2 Kb, 5-6 주 이전) 목에의 아저씨 피하에 면역.
	<ol>
<li>혼자 PBS의 100 μ와 통제 쥐를 주사.</li>
	</ol>
</li>
	<li>
뒤에 자 궁 경부 전위 공동2 흡입에 의해 면역된 쥐 20 일 사후 예방 접종을 안락사.
	<ol>
<li>비장을 분리 하 고 RPMI 미디어로 전송 합니다.</li>
	</ol>
</li>
	<li>
5 mL 주사기 플런저와 70 µ m 셀 스 트레이너를 통해 비장을 매쉬.
	<ol>
<li>RPMI의 5 mL로 씻으십시오. 원심 분리기 (800 x g, 3 분) 단일 세포 현 탁 액을</li>
		<li>Biotin-Ter119/Erythroid 셀 Ab 마우스 biotin 긍정적인 선택 장비로 RBC 고갈 합니다.</li>
		<li>완전 한 RPMI (FCS가 10%, 1 %L-글루타민, 1% 페니실린, 1% 스, 및 50 μ M 2-ME) 10 mL에 원심 분리기와 다시 중단 셀.</li>
	</ol>
</li>
</ol>10. 난-Ab tetramer 항 원 특정 CD4 주파수+ T 세포 및 결정 주파수의 항 원 특정 T 세포 방출 Cytokines 예방 접종 동물에서을 얼룩이 지는 세포내 Cytokine 확인 얼룩
<ol><li>
Tetramer 얼룩
	<ol>
<li>제어 및 PE 활용-Ab면역된 생쥐 (~ 20 x 106 셀)에서 splenocytes 얼룩-OVA323-339 tetramers (1/12.5 희석) 바인딩 버퍼 (PBS FCS 2%와 0.1% 할머니3)에서 37 ° C에서 1 시간.</li>
		<li>실 온에서 20 분 동안 splenocytes를 AF647 CD4 Ab (1:25)와 7-AAD (죽은 세포를 감지)를 추가 합니다.</li>
		<li>Cytometry에 의해 샘플을 분석 합니다.</li>
		<li>500000 이벤트 tetramer 포지티브 이벤트의 빈도 결정 하는 CD4 긍정적인 지역에서 획득. 참고: 총 splenocytes로 정의 됩니다 SSC/FSC 점 오에 의해 7 AAD 긍정적인 이벤트의 배제에 의해 라이브 세포와 CD4 하위 집합 게이팅 AF647 긍정적인 이벤트.</li>
	</ol>
</li>
	<li>
발표 T 세포는 항 원 특정 세포내 Cytokine의 주파수
	<ol>
<li>6 잘 플레이트 또는 재조합 OVA 없이 완전 한 RPMI 매체의 4 mL로 나누며 약 1 × 107 splenocytes (10 µ g/mL)와 16 h에 대 한 품 어.</li>
		<li>Brefeldin A (1:1, 000)는 추가 5 h에 대 한 셀을 취급 합니다.</li>
		<li>다음과 같이 얼룩이 지는 세포내 cytokine 및 PBS로 세척:<ol>
<li>30 분 동안 실내 온도에 PE CD8 또는 PE-Cy7-CD4 Ab (바인딩 버퍼에 1:50) 셀 샘플을 얼룩.</li>
			<li>4%에서 수정 PFA 20 분 동안 실내 온도에.</li>
			<li>Permeabilize permeabilization 솔루션을 사용 하 여 제조업체의 지침에 따라.</li>
			<li>실 온에서 AF647 활용 IFN-γ Ab (1:50) 20 분에 대 한 레이블을 셀 씻으십시오.</li>
			<li>세포를 세척 하 고 위에서 설명한 대로 흐름 cytometry 분석 대상.</li>
		</ol>
</li>
	</ol>
</li>
</ol>

<ol>
	<li>Horwitz, M. A., Harth, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+vaccine+against+tuberculosis+affords+greater+survival+after+challenge+than+the+current+vaccine+in+the+guinea+pig+model+of+pulmonary+tuberculosis.">A new vaccine against tuberculosis affords greater survival after challenge than the current vaccine in the guinea pig model of pulmonary tuberculosis.</a> Infect. Immun. 71 (4), 1672-1679 (2003).</li><li>Pym, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+BCG+exporting+ESAT-6+confers+enhanced+protection+against+tuberculosis.">Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis.</a> Nat Med. 9 (5), 548-553 (2003).</li><li>Grode, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+vaccine+efficacy+against+tuberculosis+of+recombinant+Mycobacterium+bovis+bacille+Calmette-Guerin+mutants+that+secrete+listeriolysin.">Increased vaccine efficacy against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin mutants that secrete listeriolysin.</a> The J Clin Invest. 115 (9), 2472-2479 (2005).</li><li>Bastos, R. G., Borsuk, S., Seixas, F. K., Dellagostin, O. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+Mycobacterium+bovis+BCG.">Recombinant Mycobacterium bovis BCG.</a> Vaccine. 27 (47), 6495-6503 (2009).</li><li>Mederle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmidic+versus+insertional+cloning+of+heterologous+genes+in+Mycobacterium+bovis+BCG:+impact+on+in+vivo+antigen+persistence+and+immune+responses.">Plasmidic versus insertional cloning of heterologous genes in Mycobacterium bovis BCG: impact on in vivo antigen persistence and immune responses.</a> Infect Immun. 70 (1), 303-314 (2002).</li><li>Singh, N. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+Approach+to+Cancer+Immunotherapy+Tumor+Cells+Decorated+with+CD80+Generate+Effective+Antitumor+Immunity+A+Novel+Approach+to+Cancer+Immunotherapy+Tumor+Cells+Decorated+with+CD80+Generate+Effective+Antitumor+Immunity.">A Novel Approach to Cancer Immunotherapy Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity A Novel Approach to Cancer Immunotherapy Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity.</a> Cancer Res. 63 (14), 4067-4073 (2003).</li><li>Oizumi, S., Strbo, N., Pahwa, S., Deyev, V., Podack, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+and+cellular+requirements+for+enhanced+antigen+cross-presentation+to+CD8+cytotoxic+T+lymphocytes.">Molecular and cellular requirements for enhanced antigen cross-presentation to CD8 cytotoxic T lymphocytes.</a> J Immunol. 179 (4), 2310-2317 (2007).</li><li>Sharif-Paghaleh, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+the+efficacy+of+dendritic+cell+vaccination+by+early+detection+of+(99m)+Tc-HMPAO-labelled+CD4(+)+T+cells.">Monitoring the efficacy of dendritic cell vaccination by early detection of (99m) Tc-HMPAO-labelled CD4(+) T cells.</a> Eur J Immunol. 44 (7), 2188-2191 (2014).</li><li>Sun, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+broad-range+of+recombination+cloning+vectors+in+mycobacteria.">A broad-range of recombination cloning vectors in mycobacteria.</a> Plasmid. 62 (3), 158-165 (2009).</li><li>Laitinen, O. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rational+design+of+an+active+avidin+monomer.">Rational design of an active avidin monomer.</a> J. Biol. Chem. 278 (6), 4010-4014 (2003).</li><li>Flynn, J. L., Chan, J., Triebold, K. J., Dalton, D. K., Stewart, T. A., Bloom, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+essential+role+for+interferon+gamma+in+resistance+to+Mycobacterium+tuberculosis+infection.">An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection.</a> J Exp Med. 178 (6), 2249-2254 (1993).</li><li>Liao, T. Y. A., Lau, A., Joseph, S., Hytonen, V., Hmama, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+immunogenicity+of+the+Mycobacterium+bovis+BCG+vaccine+by+non-genetic+bacterial+surface+decoration+using+the+avidin-biotin+system.">Improving the immunogenicity of the Mycobacterium bovis BCG vaccine by non-genetic bacterial surface decoration using the avidin-biotin system.</a> PLoS ONE. 10 (12), e0145833 (2015).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Howarth, M., Takao, K., Hayashi, Y., Ting, A. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+quantum+dots+to+surface+proteins+in+living+cells+with+biotin+ligase.">Targeting quantum dots to surface proteins in living cells with biotin ligase.</a> PNAS. 102 (21), 7583-7588 (2005).</li><li>Lesch, H. P., Kaikkonen, M. U., Pikkarainen, J. T., Yla-Herttuala, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin-biotin+technology+in+targeted+therapy.">Avidin-biotin technology in targeted therapy.</a> Expert Opin Drug Deliv. 7 (5), 551-564 (2010).</li><li>Paganelli, G., Bartolomei, M., Grana, C., Ferrari, M., Rocca, P., Chinol, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioimmunotherapy+of+brain+tumor.">Radioimmunotherapy of brain tumor.</a> Neurol Res. 28 (5), 518-522 (2006).</li><li>Cummings, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+immunogenicity+of+a+plant-produced+recombinant+monomer+hemagglutinin-based+influenza+vaccine+derived+from+influenza+A+(H1N1)pdm09+virus:+a+Phase+1+dose-escalation+study+in+healthy+adults.">Safety and immunogenicity of a plant-produced recombinant monomer hemagglutinin-based influenza vaccine derived from influenza A (H1N1)pdm09 virus: a Phase 1 dose-escalation study in healthy adults.</a> Vaccine. 32 (19), 2251-2259 (2014).</li><li>Kolotilin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant-based+solutions+for+veterinary+immunotherapeutics+and+prophylactics.">Plant-based solutions for veterinary immunotherapeutics and prophylactics.</a> Vet Res. 45, 114-117 (2014).</li><li>Demonte, D., Drake, E. J., Lim, K. H., Gulick, A. M., Park, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-based+engineering+of+streptavidin+monomer+with+a+reduced+biotin+dissociation+rate.">Structure-based engineering of streptavidin monomer with a reduced biotin dissociation rate.</a> Proteins. 81 (9), 1621-1633 (2013).</li><li>Deghmane, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipoamide+dehydrogenase+mediates+retention+of+coronin-1+on+BCG+vacuoles,+leading+to+arrest+in+phagosome+maturation.">Lipoamide dehydrogenase mediates retention of coronin-1 on BCG vacuoles, leading to arrest in phagosome maturation.</a> J Cell Sci. 120 (19), 3489-3489 (2007).</li><li>Soualhine, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mycobacterium+bovis+bacillus+Calmette-Guerin+secreting+active+cathepsin+S+stimulates+expression+of+mature+MHC+class+II+molecules+and+antigen+presentation+in+human+macrophages.">Mycobacterium bovis bacillus Calmette-Guerin secreting active cathepsin S stimulates expression of mature MHC class II molecules and antigen presentation in human macrophages.</a> J Immunol. 179 (8), 5137-5145 (2007).</li><li>Bubb, M. O., Green, F., Conradie, J. D., Tchernyshev, B., Bayer, E. A., Wilchek, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+antibodies+to+avidin+in+human+serum.">Natural antibodies to avidin in human serum.</a> ImmunolLett. 35 (3), 277-280 (1993).</li><li>Petronzelli, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+use+of+avidin+is+not+hampered+by+antiavidin+antibodies+in+humans.">Therapeutic use of avidin is not hampered by antiavidin antibodies in humans.</a> Cancer Biother Radiopharm. 25 (5), 563-570 (2010).</li><li>Bigini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+fate+of+avidin-nucleic+acid+nanoassemblies+as+multifunctional+diagnostic+tools.">In vivo fate of avidin-nucleic acid nanoassemblies as multifunctional diagnostic tools.</a> ACS Nano. 8 (1), 175-187 (2014).</li></ol>

저자는 공개 없다.

우리 보고이 연구에서 외 인 단백질의 신속 하 고 효과적인 디스플레이 위한 비 유전 접근 특정 항 원 또는 효율적으로 박테리아의 immunogenicity를 향상 시킬 것으로 예상 하는 특정 기능 속성을 추가 하려면 BCG 표면에. 우리는 BCG 세포 표면 수 쉽게 avidin 퓨전 단백질 즉각적인 표면 장식 biotinylated 시연. 유전자 변환 및 긍정적인 클론의 선택 필요 시간 지연의 2 ~ 3 개월 동안 2 h 이내 총 절차를 수행할 수 있습니다. 표면 수정 세균성 성장 및 생존에 영향을 미치지 않습니다. 박테리아는 대리 항 OVA 항 원 발표 통로에 항 원을 제공할 수 있었고, 특정 면역 응답 vivo에서 MHC tetramer 얼룩 등-cytometry 분석 실험에 의해 평가 되었다 유도로 장식 하 고 세포내 cytokine (ICS) 얼룩입니다. 더 중요 한 것은, vivo에서 학문은 명확 하 게 표면 장식 박테리아 BCG 익스프레스 유사한 항 원에 유전자 조작에 비해 면역 반응의 유도 수 있었다 보여주었다.
Avidin 비타민 b 복합체 상호 작용은 Kd 10−15 M13의 자연에서 알려진 가장 강한 비 공유 상호 작용. 그것은 생물학 연구14, 일반적으로 사용 되는 유용한 도구만 하지만 최근 암 치료15,16에 적용할 수 있도록 표시 되었습니다. 이 연구에서는 트리플 돌연변이 (N54A, W110K 및 N17I) 야생-타입 avidin tetrameric avidin 단위체 avidin는 크게 avidin 비타민 b 복합체 선호도 감소의 형태로 변환에 적용 된 (Kd= 10−7 M) 바인딩합니다 biotin 하 역. 이 단위체 avidin 게이트웨이 재결합 (Invitrogen) 관심사의 단백질의 한 단계 빠른 표현에 대 한 복제와 호환 되는 p17-Avi 플라스 미드를 개발 하기 위해 사용 되었다. 이 새로운 버전의 단위체 avidin 큰 세균 덩어리 집계 및 과도/취소가 세균성 표면 표시 관심사의 단백질의 방지 등 여러 장점이 있습니다. 따라서, 호스트 세포에 의해 섭취, 일단 Avi-퓨전 단백질 분리할 수 있습니다 biotinylated 박테리아와 교통의 표면에서 침. 마지막으로, 돌연변이 핵 시스템에 효 모 또는 avidin 융해 단백질의 대량 생산을 위한 유전자 변형 식물17,18 에 적용 될 수 있는 비 당화 형태로 avidin를 변환 합니다. 이 형태의 단위체 avidin 단위체 streptavidin (mSA)19, streptavidin 및 rhizavidin 시퀀스 및 높은 바인딩 선호도 (10−9 M의Kd ) 했다의 버전 대신 선정 되었다 mAvidin에 비해. 예비 테스트, mSA 키메라 단백질 biotinylated 박테리아 mAvidin 키메라 단백질에 비해 훨씬 낮은 바인딩 효율을 했다. 이 연구는 따라서, mAvidin에 근거 했다 하지만 단위체 streptavidin 또는 streptavidin/avidin 다른 형태의 것도 다른 응용 프로그램에 대 한 가능성.
설명된 프로토콜의 성공적인 구현을 생성 된 융해 단백질의 품질 및 세균성 표면 biotinylation의 효율성에 따라 달라 집니다. Eluted Avi 태그 단백질 드 소금 그리고 적절 한 분자량 단백질 집중 장치를 사용 하 여 PBS에 버퍼 교환 합니다. 강 수는 어떤 단백질에 대 한 높은 농도 요인에서 발생할 수 있습니다 따라서, 농도 테스트 해야 비율과 eluted 단백질의 작은 볼륨을 사용 하 여 첫 번째, 예를 들어, 0.5 ~ 1 mL PBS의 20 mL에 희석 solubilized 포함 바디의에서 결정 다음 집중. 그것은 또한 강 수를 피하기 위해 전체 과정 단백질 약 4 ° C의 온도 유지 하는 것이 중요입니다.
세균성 표면 biotinylation의 효율성을 높이기 위해 Sulfo NHS SS biotin 4 ° c.에 어둠 속에서 그것의 원래 컨테이너에 저장 한다 시 약은 매우 습기 과민 한; 따라서, 튜브는 시 약을 포함 하는 열기 전에 실내 온도에 equilibrated 한다. 또한, biotin 재고 솔루션 (10 mM) NHS 에스테 르 moiety hydrolyzes 사용 하기 바로 전에 만든 한다 고 비 반응성이 매우 신속 하 게 될. Biotin 재고 솔루션을 저장 하 고 다시; 수 없습니다. 새로운 biotin 유리병은 모든 biotinylation 실험을 위해 필요 합니다. 최상의 결과 얻으려면 BCG, 신선한 미디어 뿐만 아니라 신선한 버퍼의 신선한 문화를 사용 하는 것이 좋습니다. 프로토콜에서 설명 했 듯이, biotinylated 및 코팅된 BCG 수 동결 건조 된 되며 표면 코팅의 품질에 영향을 주지 않고 적어도 30 일 동안 보존. 이것은 특히 유용 보내거나 다른 한 위치에서 샘플을 전송 하는 경우 또는 긴 과정 실험을 수행할 때입니다.
이 BCG 표면 장식 메서드는 또한 분석 하 고 신속 하 고 정확한 방법으로 새로 개발된 된 백신 후보자의 immunogenicity를 평가 다른 흥미로운 가능성을 제공 합니다. 소설 결핵 백신의 기본 목표는 TH1 유형 세포 CD4 같은 유도+ 와 CD8+ T 세포 결핵에 대 한 보호에 그의 플레이 중요 한 역할. Avidin 비타민 b 복합체 시스템 연구에서 개발이 T 세포이 응답을 평가 하는 매우 유용한 도구를 제공 합니다. 빠르게 재조합 단백질/항 BCG 표면에 표시의이 새로운 기술을 나타냅니다 신속 하 게 평가 하는 훌륭한 도구와 정확 하 게 많은 면역성 단백질 (예를 들어, 분 비 특정 M.tb 의 보호 효능 단백질), 따라서 효율적인 백신의 개발으로 번역 될 수 있다.
조정 하 고 세균성 표면에 Avi 융해 단백질의 농도 변화,이 방법의 또 다른 장점은 백신의 효과 극대화 하기 위해 세균 표면에 관심의 다른 항을 동시에 표시 될 수 있습니다. 추가로 BCG를 개선 하기 위해 하나의 가능성 BCG 표면 장식 수 있기 때문에 연구는 BCG phagosome 성숙20,21 항 프레 젠 테이 션21등 중요 한 대 식 세포의 기능을 방해, 관심사의 항 원 함께 phagosome 성숙 가속 알려진 요인의 조합.
이 기술의 몇 가지 한계 저소득 지역에서 도전적이 고 비싼 수 있는 재조합 형 단백질의 대규모 생산의 요구 사항을 포함 합니다. 또한, 열심히 단백질 정화 생산 해야 문제 해결 및 최적화 합니다. 그러나, 이러한 한계는 재조합 단백질 생산 기술의 개선으로 피할 수 있습니다. 또 다른 한계는 자연스럽 게 발생 방지 avidin 항 체 실험실 동물 및 인간22 에서 일반적인 avidin 치료 목적 사용을 방해 수 있습니다 가능성을 포함 한다. 그러나, 다른 실험실 안전 및 avidin 치료의 효능 테스트 하 고는 avidin의 안전 성과 효능은 크게 영향을 받지의 immunogenicity23나타났습니다. 흥미롭게도, 상당히 야생-타입 tetrameric avidin 단위체 형태로 변환의 immunogenicity24감소 합니다.
정리해 보면,이 새로운 기술을 신속 하 고 재현성 유전자 비 세균성 표면 단백질의 수정 관심 통해 BCG의 immunogenicity를 개선 하는 avidin 비타민 b 복합체 시스템을 활용 하 여 성공적으로 BCG의 전통적인 변환 바꿀 수 있습니다. 항 원 인코딩 플라스 미드와 또한,이 새로운 방법만 현재 BCG 백신의 향상을 촉진 하지 수 있지만 또한 거의 모든 잠재적인 항 원 또는 단백질 유전자 BCG, 넓은 함께 표현 하 일반적으로 하드의 빠른 평가 위한 새로운 플랫폼을 제공할 수 있습니다. 결핵 백신 개발에 응용 프로그램입니다.

대체 현재 결핵 백신 BCG, 유전자 소개 하도 단백질 보조 시스템, 바이러스 벡터화 기술, 감쇠 라이브 M.tb 긴장, 및 유전자 변형된 BCG 긴장을 포함 한 다양 한 전략 제안 -감염1 또는 Mtb동안 충분히 표현 되지 않는다 BCG 항 원 표현-특정 항 BCG2에 존재 하지. 그러나 유전 공학,, 안전, 시간이 많이 걸리는 프로세스 및 식 벡터4,5의 낮은 효율의 불확 실한 수준을 포함 하는 많은 방 벽을 직면 한다. BCG를 개선에 관해서는 대체 접근 불확 실한 유전 교대에 대 한 필요 없이 immunogenicity를 개선 하기 위해 필요 합니다.
이 연구에서 biotin과 잘 알려진 높은 선호도 avidin 상호 작용을 기반으로 하는 BCG 세포 표면에 대 한 관심의 재조합 단백질의 디스플레이 대 한 새로운 전략을 소개 합니다. 이 접근 방식은 biotinylated BCG, 그것의 우수한 안전 하면서 효능의 최대한 향상을 달성 하기 위해 BCG의 광범위 한 조작을 용이 하 게 표면에 재조합 avidin 융해 단백질의 신속 하 고 재현할 수 첨부 파일 수 기록, 사용의 수 십년 동안 관찰 합니다.
Avidin 비타민 b 복합체에 대 한 선호도 매우 높은 (Kd = 10−15 M) 고 형성, 면 avidin 비타민 b 복합체 복합물은 매우 안정 조건6을 변성 시키기에서 중단 될 수 있습니다. 그러나, 유전자 전송 방법 대안 역할을 상호 작용의이 유형에 대 한 재조합 단백질의 장기 하지만 되돌릴 수 표시가 됩니다. 따라서, 우리는 여기 낮은 선호도 단위체 avidin 도입 (Kd = 10−7 M) 표면에서 단백질의 가역 릴리스 리드 BCG 항 원 제시 세포 안에 섭취 한 번 장식. 개념의 증거를 제공 하기 위해 ovalbumin (OVA)7,8에서 파생 된 대리 항 원에 해당 하는 단위체 avidin 공상 단백질을 사용 하 여이 방법을 테스트 했습니다. 결과 BCG 세포 표면 장식 하실 수 있습니다 쉽고 빠르게 단위체 avidin 융합 단백질 및이 바인딩 BCG 표면에는 안정 되 고 세균성 성장 및 생존에 감지 변경 없이 재현할 수 나타났다. 또한, 우리가 발견 BCG OVA (AviOVA)와 융합 하는 단위체 avidin 장식 BCG에 의해 유도 된 저것과 유사한 면역 반응을 일으킬 수 있다 유전으로 동일한 항 원 표현 둘 다 생체 외에서 그리고 에 비보. 이 기술은 세균성 표면에 관심사의 단백질의 가역 디스플레이의 따라서 전통적인 유전자 전송 접근법의 효과적인 보충 이며 BCG의 광범위 한 조작 및 백신에 추가 응용 프로그램을 위한 플랫폼을 제공할 수 있습니다. 개발입니다.

<table border="0" cellpadding="0" cellspacing="0" width="1046">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:531px;">Endotoxin-free RPMI 1640</td>
			<td style="width:229px;">StemCell Technologies&#160;</td>
			<td align="right" style="width:119px;">36750</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sulfo-NHS SS biotin</td>
			<td>Thermo Fisher&#160;</td>
			<td align="right" style="width:119px;">21328</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FITC-conjugated streptavidin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">S3762</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Phycoerythrin (PE)-conjugated I-Ab-OVA323-339 tetramer&#160;</td>
			<td>MBL International&#160;</td>
			<td>TS-M710-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7-AAD&#160;</td>
			<td>BD Pharmingen</td>
			<td align="right" style="width:119px;">559925</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TALON polyhistidine-Tag purification resin&#160;</td>
			<td>Clontech</td>
			<td align="right" style="width:119px;">635501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alexa Fluor (AF) 647 conjugated rat anti-mouse CD4</td>
			<td style="width:229px;">BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">557681</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AF647 rat anti-mouse IFN-g</td>
			<td>BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">557735</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AF647 rat anti-mouse I-A/I-E</td>
			<td>BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">562367</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PeCy7 rat anti-mouse CD4</td>
			<td>BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">552775</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE rat anti-mouse CD8 Ab</td>
			<td>BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">561095</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">AF 647 rat anti-mouse H-2kb&#160;</td>
			<td>BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">562832</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:531px;">FITC-conjugated goat anti rabbit antibody</td>
			<td style="width:229px;">Thermo Fisher</td>
			<td align="right" style="width:119px;">31635</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:531px;">AF 647 rat anti-mouse CD4</td>
			<td style="width:229px;">BD Bioscience&#160;</td>
			<td align="right" style="width:119px;">557681</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultra-small gold-conjugated goat anti-rabbit IgG&#160;</td>
			<td>Electron Microscopy Sciences&#160;</td>
			<td align="right" style="width:119px;">25100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Middlebrook 7H9 broth&#160;</td>
			<td>BD Diagnostic Systems</td>
			<td align="right" style="width:119px;">271310</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:531px;">OADC</td>
			<td>BD Diagnostic Systems</td>
			<td style="width:119px;">B11886</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tween 80</td>
			<td style="width:229px;">Sigma-Aldrich</td>
			<td style="width:119px;">P1379</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RAW 264.7 murine macrophage cell lines&#160;</td>
			<td>American Type Culture Collection</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pDEST17 plasmid&#160;</td>
			<td>Invitrogen</td>
			<td align="right" style="width:119px;">11803012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pUC57-OVA plasmid&#160;</td>
			<td>GenScript</td>
			<td style="width:119px;">SD1176</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BP clonase&#160;</td>
			<td>Invitrogen</td>
			<td align="right" style="width:119px;">11789020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LR clonase&#160;</td>
			<td>Invitrogen</td>
			<td align="right" style="width:119px;">11791043</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:531px;">pDONR221 plasmid</td>
			<td style="width:229px;">Invitrogen</td>
			<td align="right" style="width:119px;">12536017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ni-NTA columns&#160;</td>
			<td>Qiagen</td>
			<td align="right" style="width:119px;">31014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pierce protein concentrators&#160;</td>
			<td>Thermo Fisher&#160;</td>
			<td align="right" style="width:119px;">88527</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flurosave</td>
			<td>Calbiochem-Novabiochem</td>
			<td align="right" style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Axioplan II epifluorescence microscope</td>
			<td>Carl Zeiss Inc</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CCD digital camera&#160;</td>
			<td>Retiga EX, QImaging</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tecnai G2 200kV electron microscope&#160;</td>
			<td>FEI Company</td>
			<td style="width:119px;">G2 200Kv&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">70&#956;m Falcon cell strainer&#160;</td>
			<td style="width:229px;">Thermo Fisher&#160;</td>
			<td align="right" style="width:119px;">87712</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStep mouse biotin positive selection kit&#160;</td>
			<td>StemCell</td>
			<td align="right" style="width:119px;">18556</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:531px;">biotin-Ter119/Ertyroid cells antibody</td>
			<td style="width:229px;">BioLegend</td>
			<td align="right" style="width:119px;">116203</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Brefeldin A</td>
			<td>BD Pharmingen</td>
			<td align="right" style="width:119px;">555029</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cytofix/Cytoperm kit&#160;</td>
			<td>BD Pharmingen</td>
			<td align="right" style="width:119px;">554714</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bright-Glo Luciferase assay system</td>
			<td>Promega</td>
			<td style="width:119px;">e2620</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Turner Biosystem luminometer&#160;</td>
			<td>Promega</td>
			<td style="width:119px;">TD-20/20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Leica EM UC6 microtome</td>
			<td style="width:229px;">&#160;Leica Microsystems</td>
			<td style="width:119px;">UC6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Novalyphe NL 500 freeze dryer</td>
			<td style="width:229px;">Savant Instruments</td>
			<td style="width:119px;">&#160;NL 50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Wheaton boroscilicate glass vials</td>
			<td>Wheaton</td>
			<td style="width:119px;">&#160;VWR 66011-675</td>
			<td></td>
		</tr>
	</tbody>
</table>

expression of exogenous antigens in the mycobacterium bovis bcg vaccine via non-genetic surface decoration with the avidin-biotin system

결핵 (TB)는 심각한 전염 성 병과 사용 가능한 백신 M. bovis 균 메 게 랭 (BCG)는 안전 하 고 효과적인 어린이 심한 결핵 수 막 염과 결핵 전파의 일부 형태에 대 한 보호 하지만 보호 하기 위해 실패 폐 결핵에 대 한 질병의 가장 일반적인 형태입니다. 현재 BCG를 개선 하기 위해 유망 전략 immunodominant M. 결핵 (Mtb)를암호화 하는 유전자와 그것의 전이 의존-특정 항 원 또는 항 원 자극 하는 것이 공동 요소를 인코딩 하는 유전자와 보완성 셀을 제시. 이러한 접근을 주요 한계는 낮은 효율, 낮은 안정성, 그리고 불확 실한 식 벡터의 안전 수준을 포함합니다. 이 연구에서 우리는 백신 개선, BCG 보완성의 해당 유전자를 인코딩 하는 플라스 미드와 변환 보다는 박테리아의 표면에 대 한 관심의 외 인 단백질로 구성 된 다른 접근 방법 제시. 첫째, 관심사의 단백질은 표현 융합 표준 대장균 에서 단위체 avidin 식 시스템 biotinylated BCG의 표면을 장식 하는 데 사용 하는 고. 동물 실험 꾸며져 대리 ovalbumin 항 BCG 표면을 사용 하 여 수정 된 박테리아는 완벽 하 게 면역성 및 특정 T 세포 응답을 유도 할 수 보여줍니다. 모두, 여기에 강력 하 게 제시 하는 데이터 외 인 핵 산 보완성의 힘 드는 전통적인 접근 방식을 대체 현재 BCG 백신을 재편에 대 한 소설과 효율적인 방법을 지원 합니다.

Watch this Scientific Journal Video about Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System at JoVE.com

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

세균성 표면에 급속 한 항 원 디스플레이 대 한 새로운 기술, 표면 biotinylation 단위체 avidin와 퓨전에 관심사의 단백질에 노출에 의해 다음을 포함 하 제공 됩니다. 선택 된 항으로 BCG를 성공적으로 로드 표면 장식 전통적인 유전 접근을 대체할 수 있는 제안 그것의 immunogenicity를 향상 시킵니다.

외 인 항 원 비 유전 표면 장식 Avidin 비타민 b 복합체 시스템을 통해 진 균 bovis BCG 백신에의 표현

Tuberculosis (TB) is a serious infectious disease and the only available vaccine M. bovis bacillus Calmette-Gu&#233;rin (BCG) is safe and effective for ...

expression-exogenous-antigens-mycobacterium-bovis-bcg-vaccine-via-non

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

9.2K 조회수.  University of British Columbia. 세균성 표면에 급속 한 항 원 디스플레이 대 한 새로운 기술, 표면 biotinylation 단위체 avidin와 퓨전에 관심사의 단백질에 노출에 의해 다음을 포함 하 제공 됩니다. 선택 된 항으로 BCG를 성공적으로 로드 표면 장식 전통적인 유전 접근을 대체할 수 있는 제안 그것의 immunogenicity를 향상 시킵니다.

비디오: Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

A Functional Whole Blood Assay to Measure Viability of Mycobacteria, using Reporter-Gene Tagged BCG or M.Tb (BCG lux/M.Tb lux)

Functional assays have long played a key role in measuring of immunogenicity of a given vaccine. This is conventionally expressed as serum bactericidal titers. Studies of serum bactericidal titers in response to childhood vaccines have enabled us to develop and validate cut-off levels for protective immune responses and such cut-offs are in routine use. No such assays have been taken forward into the routine assessment of vaccines that induce primarily cell-mediated immunity in the form of effector T cell responses, such as TB vaccines. In the animal model, the performance of a given vaccine candidate is routinely evaluated in standardized bactericidal assays, and all current novel TB-vaccine candidates have been subjected to this step in their evaluation prior to phase 1 human trials. The assessment of immunogenicity and therefore likelihood of protective efficacy of novel anti-TB vaccines should ideally undergo a similar step-wise evaluation in the human models now, including measurements in bactericidal assays.
Bactericidal assays in the context of tuberculosis vaccine research are already well established in the animal models, where they are applied to screen potentially promising vaccine candidates. Reduction of bacterial load in various organs functions as the main read-out of immunogenicity. However, no such assays have been incorporated into clinical trials for novel anti-TB vaccines to date.
Although there is still uncertainty about the exact mechanisms that lead to killing of mycobacteria inside human macrophages, the interaction of macrophages and T cells with mycobacteria is clearly required. The assay described in this paper represents a novel generation of bactericidal assays that enables studies of such key cellular components with all other cellular and humoral factors present in whole blood without making assumptions about their relative individual contribution. The assay described by our group uses small volumes of whole blood and has already been employed in studies of adults and children in TB-endemic settings. We have shown immunogenicity of the BCG vaccine, increased growth of mycobacteria in HIV-positive patients, as well as the effect of anti-retroviral therapy and Vitamin D on mycobacterial survival in vitro. Here we summarise the methodology, and present our reproducibility data using this relatively simple, low-cost and field-friendly model.
Note: Definitions/Abbreviations
BCG lux = M. bovis BCG, Montreal strain, transformed with shuttle plasmid pSMT1 carrying the luxAB genes from Vibrio harveyi, under the control of the mycobacterial GroEL (hsp60) promoter. 
CFU = Colony Forming Unit (a measure of mycobacterial viability).

A Functional Whole Blood Assay to Measure Viability of Mycobacteria, using Reporter-Gene Tagged BCG or M.Tb BCG lux/M.Tb lux

We describe an alternative approach to the enumeration of mycobacteria in vitro, which uses reporter-gene tagged mycobacteria instead of colony-forming units (CFU). &#x201C;Survival&#x201D; of organisms as well as host response-markers are measured simultaneously, providing a low-cost, versatile and functional system for studies of host/pathogen interactions in the context of tuberculosis.

Mycobacteria의 가능성을 측정하는 기능 전체 혈액 분석은 리포터 - 진 BCG 또는 M. TB (BCG 태그 사용 럭스 / M. TB 럭스)

Functional assays have long played a key role in measuring of immunogenicity of a given vaccine. This is conventionally expressed as serum bactericidal ...

연구

면역학 및 감염병학

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

FDA 승인 베로 세포 백신 개발을위한 재조합 Arenavirus의 생성

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

The baculovirus expression system is a powerful tool for expression of recombinant proteins. Here we use it to produce correctly folded and glycosylated versions of the influenza A virus surface glycoproteins - the hemagglutinin (HA) and the neuraminidase (NA). As an example, we chose the HA and NA proteins expressed by the novel H7N9 virus that recently emerged in China. However the protocol can be easily adapted for HA and NA proteins expressed by any other influenza A and B virus strains. Recombinant HA (rHA) and NA (rNA) proteins are important reagents for immunological assays such as ELISPOT and ELISA, and are also in wide use for vaccine standardization, antibody discovery, isolation and characterization. Furthermore, recombinant NA molecules can be used to screen for small molecule inhibitors and are useful for characterization of the enzymatic function of the NA, as well as its sensitivity to antivirals. Recombinant HA proteins are also being tested as experimental vaccines in animal models, and a vaccine based on recombinant HA was recently licensed by the FDA for use in humans. The method we describe here to produce these molecules is straight forward and can facilitate research in influenza laboratories, since it allows for production of large amounts of proteins fast and at a low cost. Although here we focus on influenza virus surface glycoproteins, this method can also be used to produce other viral and cellular surface proteins.

Here we describe a way to express correctly folded and functional influenza virus surface antigens derived from the novel Chinese H7N9 virus in insect cells. The technique can be adapted to express ectodomains of any viral or cellular surface proteins.

배큘로 바이러스 발현 시스템을 사용하여 소설 H7N9 인플루엔자 바이러스의 기능 재조합 적혈구 응집소와 뉴 라미니다 아제 단백질의 발현

The baculovirus expression system is a powerful tool for expression of  recombinant proteins. Here we use it to produce correctly folded and  glycosylated ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

웨스트 나일 바이러스 돌연변이 균주의 감염에에서 MyD88 매개 세포 면역 반응의 생체 외 분석

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

개발<em&gt; 체외</em의 상호 작용을 연구&gt; 모델 시스템<em&gt; 에쿠스</em&gt;<em&gt; caballus</em높은 친 화성 수용체 FcεRI에&gt;의 IgE

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

A CFSE-based Assay to Study the Migration of Murine Skin Dendritic Cells into Draining Lymph Nodes During Infection with Mycobacterium bovis Bacille Calmette-Gu&#233;rin

Dendritic cells (DCs) are important for initiating immune responses, in part through their ability to acquire and shuttle antigen to the draining lymph node (DLN). The mobilization of DCs to the DLN is complex and remains to be fully elucidated during infection. Herein described is the use of an innovative, simple assay that relies on the fluorochrome 5- and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE) to track the migration of DCs during footpad infection with Mycobacterium bovis Bacille Calmette-Gu&#233;rin (BCG) in C57BL/6 mice. This assay enables the characterization of skin DC sub-populations that actively relocate to the draining, popliteal LN in response to BCG. This protocol originates from a BCG model where migratory skin DCs were identified by flow cytometry. The assay is amiable to the study and identification of DCs or other cells that home to the popliteal LN after inoculation of microbes, their metabolites or other inflammatory stimuli in the footpad, and consequently to study factors that regulate the migration of these cells.

An assay in mice to track cell migration from skin to draining lymph node is described which enables the characterization of skin Dendritic cells mobilized to the lymph node after footpad infection with Bacille Calmette-Gu&#233;rin.

와 감염시 배수 림프절에 쥐 피부 수지상 세포의 마이그레이션을 연구하는 CFSE 기반 분석<em&gt; 소 결핵균</em&gt; Bacille 칼 메트 - GUERIN

Dendritic cells (DCs) are important for initiating immune responses, in part through their ability to acquire and shuttle antigen to the draining lymph ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte extravasation might result in pathophysiological changes in the CNS. Thus, investigation of lymphocyte migration into the CNS is important to understand inflammatory CNS diseases and to develop new therapy approaches. Here we present an in vitro model of the human blood-brain barrier to study lymphocyte extravasation. Human brain microvascular endothelial cells (HBMEC) are confluently grown on a porous polyethylene terephthalate transwell insert to mimic the endothelium of the blood-brain barrier. Barrier function is validated by zonula occludens immunohistochemistry, transendothelial electrical resistance (TEER) measurements as well as analysis of evans blue permeation. This model allows investigation of the diapedesis of rare lymphocyte subsets such as CD56brightCD16dim/- NK cells. Furthermore, the effects of other cells, cytokines and chemokines, disease-related alterations, and distinct treatment regimens on the migratory capacity of lymphocytes can be studied. Finally, the impact of inflammatory stimuli as well as different treatment regimens on the endothelial barrier can be analyzed.

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Here, we describe a human blood-brain barrier model enabling to investigate lymphocyte transmigration into the central nervous system in vitro.

를 사용하여 림프구 혈관 외로 유출 분석<em&gt; 체외</em&gt; 인간의 혈액 - 뇌 장벽의 모델

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Purification of the Membrane Compartment for Endoplasmic Reticulum-associated Degradation of Exogenous Antigens in Cross-presentation

Dendritic cells (DCs) are highly capable of processing and presenting internalized exogenous antigens upon major histocompatibility class (MHC) I molecules also known as cross-presentation (CP). CP plays an important role not only in the stimulation of na&#239;ve CD8+ T cells and memory CD8+ T cells for infectious and tumor immunity but also in the inactivation of self-acting na&#239;ve T cells by T cell anergy or T cell deletion. Although the critical molecular mechanism of CP remains to be elucidated, accumulating evidence indicates that exogenous antigens are processed through endoplasmic reticulum-associated degradation (ERAD) after export from non-classical endocytic compartments. Until recently, characterizations of these endocytic compartments were limited because there were no specific molecular markers other than exogenous antigens. The method described here is a new vesicle isolation protocol, which allows for the purification of these endocytic compartments. Using this purified microsome, we reconstituted the ERAD-like transport, ubiquitination, and processing of the exogenous antigen in vitro, suggesting that the ubiquitin-proteasome system processed the exogenous antigen after export from this cellular compartment. This protocol can be further applied to other cell types to clarify the molecular mechanism of CP.

The method described here is a new vesicle isolation protocol, which allows for the purification of the cellular compartments where exogenous antigens are processed by endoplasmic reticulum-associated degradation in cross-presentation.

외 인 항 원 십자가-프레 젠 테이 션에의 바인딩과 그물 관련 성능 저하 막 구획의 정화

Dendritic cells (DCs) are highly capable of processing and presenting internalized exogenous antigens upon major histocompatibility class (MHC) I ...

Single-cell Quantitation of mRNA and Surface Protein Expression in Simian Immunodeficiency Virus-infected CD4+ T Cells Isolated from Rhesus macaques

Single-cell analysis is an important tool for dissecting heterogeneous populations of cells. The identification and isolation of rare cells can be difficult. To overcome this challenge, a methodology combining indexed flow cytometry and high-throughput multiplexed quantitative polymerase chain reaction (qPCR) was developed. The objective was to identify and characterize simian immunodeficiency virus (SIV)-infected cells present within rhesus macaques. Through quantitation of surface protein by fluorescence-activated cell sorting (FACS) and mRNA by qPCR, virus-infected cells are identified by viral gene expression, which is combined with host gene and protein measurements to create a multidimensional profile. We term the approach, targeted Single-Cell Proteo-transcriptional Evaluation, or tSCEPTRE. To perform the method, viable cells are stained with fluorescent antibodies specific for surface markers used for FACS isolation of a cell subset and/or downstream phenotypic analysis. Single cells are sorted followed by immediate lysis, multiplex reverse transcription (RT), PCR pre-amplification, and high throughput qPCR of up to 96 transcripts. FACS measurements are recorded at the time of sorting and subsequently linked to the gene expression data by well position to create a combined protein and transcriptional profile. To study SIV-infected cells directly ex vivo, cells were identified by qPCR detection of multiple viral RNA species. The combination of viral transcripts and the quantity of each provide a framework for classifying cells into distinct stages of the viral life cycle (e.g., productive versus non-productive). Moreover, tSCEPTRE of SIV+ cells were compared to uninfected cells isolated from the same specimen to assess differentially expressed host genes and proteins. The analysis revealed previously unappreciated viral RNA expression heterogeneity among infected cells as well as in vivo SIV-mediated post-transcriptional gene regulation with single-cell resolution. The tSCEPTRE method is relevant for the analysis of any cell population amenable to identification by expression of surface protein marker(s), host or pathogen gene(s), or combinations thereof.

Single-cell Quantitation of mRNA and Surface Protein Expression in Simian Immunodeficiency Virus-infected CD4+ T Cells Isolated from Rhesus macaques

Described is a methodology to quantitate the expression of 96 genes and 18 surface proteins by single cells ex vivo, allowing for the identification of differentially expressed genes and proteins in virus-infected cells relative to uninfected cells. We apply the approach to study SIV-infected CD4+ T cells isolated from rhesus macaques.

단일 셀 정량 mRNA와 유인원 면역 결핍 바이러스에 감염 된 CD4에 표면 단백질 표정+ T 세포 격리에서 붉은 털 원숭이

Single-cell analysis is an important tool for dissecting heterogeneous populations of cells. The identification and isolation of rare cells can be ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

호스트 병원 체 응답 및 쥐에 백신의 효능 평가

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...